ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 6, pp. 773-785 © Pleiades Publishing, Ltd., 2025.
Russian Text © The Author(s), 2025, published in Biokhimiya, 2025, Vol. 90, No. 6, pp. 833-846.
773
Selection of Optimal pegRNAs to Enhance Efficiency
of Prime Editing in AT-Rich Genome Regions
Olga V. Volodina
1,a
*, Anna G. Demchenko
1
, Arina A. Anuchina
1
,
Oxana P. Ryzhkova
1
, Valeriia A. Kovalskaya
1
, Ekaterina V. Kondrateva
1
,
Vyacheslav Y. Tabakov
1
, Alexander V. Lavrov
1
, and Svetlana A. Smirnikhina
1
1
Research Centre for Medical Genetics, 115522 Moscow, Russia
a
e-mail: volodold@gmail.com
Received December 27, 2024
Revised March 18, 2025
Accepted March 26, 2025
Abstract— Prime editing is a highly promising strategy for treating hereditary disorders due to its superior
efficiency and safety profile compared to the conventional CRISPR-Cas9 systems. This study is dedicated to
development of a causal therapy for cystic fibrosis by targeting the F508del variant of the CFTR gene using
prime editing, as this specific deletion accounts for a substantial proportion of cystic fibrosis cases. While
prime editing has shown remarkable precision in introducing targeted genetic modifications, its application
in AT-rich genomic regions, such as the one containing the F508del variant, remains challenging. To over-
come this limitation, we systematically evaluated 24 pegRNAs designed for two distinct prime editing sys-
tems, PEmax and PE2-NG. Efficiency of the F508del variant correction reached 2.81% (without normalization
for transfection efficiency) in the airway basal cells from the patients with homozygous F508del mutation.
However, the average transfection efficiency was only 11.9%, emphasizing critical need for the advancements
in delivery methodologies. These findings highlight potential of prime editing as an approach for treating
cystic fibrosis, while also underscoring necessity for further optimization of both editing constructs and de-
livery vectors to achieve clinically relevant correction levels.
DOI: 10.1134/S0006297924604672
Keywords: prime editing, CFTR, genome editing, pegRNA, F508del
* To whom correspondence should be addressed.
INTRODUCTION
Genome editing methods have been often used
recently for the development of gene therapy tech-
niques, which allow introducing targeted changes
to the genome such as correcting genetic variants
and gene knockouts. At present the system based on
the clustered regularly interspaced short palindrom-
ic repeats, CRISPR, associated with the Cas9 protein
(CRISPR/Cas9 system) has been used most often [1],
because, unlike its progenitors (transcription activa-
tor-like effector nucleases (TALEN), zinc finger nucle-
ases (ZFN) [2], and meganucleases [3]) it is easy to
use and optimize for the research needs, it is suffi-
ciently effective and simple. In the course of editing
with the standard CRISPR/Cas9 method, a single guide
RNA (sgRNA) that forms a ribonucleoprotein complex
with the Cas9 nuclease binds to the DNA molecule
at the editing locus via complementary base pairing,
and next Cas9 introduces a double-strand break to
the DNA molecule at a precise location of 3 nucleo-
tides (nt) from the protospacer adjacent motif (PAM),
which is followed by the repair according to one of
the main mechanisms. The first mechanism– non-ho-
mologous end joining (NHEJ) – is a more mutagenic
one, as it could result in undesirable insertion and
deletions of nucleotides in the process of DNA repair,
and also could be the cause of chromosome rearrange-
ments. The second mechanism– homology-directed re-
pair (HDR)– allows introducing specific changes to the
genome. In order to activate this mechanism introduc-
tion of an additional molecular template (donor DNA
molecule) carrying desired changes is required. How-
ever, even in the case of presence of such molecule,
VOLODINA et al.774
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
NHEJ is the predominant repair pathway. Low effi-
ciency of HDR and high percent of undesirable chang-
es do not allow using CRISPR/Cas9 for gene therapy
involving directed correction of pathological variants.
Moreover, CRISPR/Cas9 could exhibit non-target activ-
ity, which results in formation of double strand DNA
breaks outside of the editing locus. Such undesirable
effects as chromosome rearrangements and additional
mutations also limit use of the CRISPR/Cas9 system for
the gene therapy development [4].
New variants of editing platforms based on mod-
ified CRISPR/Cas9 technology are being developed by
the researchers to enhance efficiency of editing and to
avoid double strands brakes in the DNA molecule [5].
One of such modification, prime editing (PE), has been
chosen for this study, which is composed of several
required components (Fig. 1):
(i) nCas9 nickase – a mutant form of the wild type
Cas9 nuclease, it introduces a single-strand break
to the DNA molecule instead of a double-strand
one [6];
(ii) MMLV-RT – Moloney murine leukemia virus
reverse transcriptase fused with Cas9 nickase
through a linker;
(iii) prime editing guide RNA (pegRNA).
During prime editing guide RNA (pegRNA) inter-
acts with the DNA molecule at the targeted editing
site, Cas9 nickase introduces a single-strand break at
a distance of 3  nt from PAM, one strand is released
and binds complementary to the primer binding site
(PBS) in the pegRNA, and next the strand is complet-
ed with the help of reverse transcriptase (RT) based
on the reverse transcriptase template (RTT) with the
desired change [5]. HDR and NHEJ repair mechanisms
are not involved in the mechanism of prime editing,
and the site of pegRNA serves as a molecular tem-
plate, hence, it could be assumed that the efficiency of
genomic DNA correction should be higher. Moreover,
considering that only single-strand DNA break is in-
troduced in the course of PE, safety of this approach
is potentially higher than in the case of classic variant
of CRISPR/Cas9.
After the PE discovery various modification of
the system have been developed to increase efficien-
cy of introduction of changes. The following modifi-
cations have been selected for this study: PE2-NG –
second generation of prime editing using nickase
that recognizes PAM NG, as well as PEmax modifica-
tion – improved PE2 editor with nickase recognizing
PAM NGG.
Fig. 1. Ribonucleoprotein complex for prime editing, details in the text.
pegRNA OPTIMIZATION 775
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
pegRNA plays an important role in prime editing,
because both efficiency and accuracy of the method
depend on the selected sequence. pegRNA is composed
from a scaffold, spacer site, PBS, RTT, and protective
hairpin structure (tevopreQ
1
) at the 3′-end connected
to the construct via the linker (Fig. 1).
The spacer site is bound to the target DNA at the
editing locus, its optimal length is 20 nt with added
G nucleotide at the 5′-end [7], and optimal GC-compo-
sition should be in the range from 20 to 80% [8]. The
PBS fragment is involved in complementary binding
of the single strand, which is released after introduc-
tion of a single-strand break to the DNA; in the case
of PBS not binding to the chain, the changes will not
be introduced. RTT contains the desired change, the
single-strand DNA is synthesized on its basis.
The 3′-end of pegRNA containing PBS and RTT
sites is prone to degradation by exonucleases, hence,
the pegRNA design includes the tevopreQ
1
hairpin at
the 3′-end. The hairpin is connected to the main se-
quence of pegRNA through a linker. When selecting the
linker sequence, it is important to avoid its potential
interactions with PBS and spacer site of pegRNA [9].
Both length and composition of the pegRNA frag-
ments are important. It could be suggested based on
the literature data that editing would be successful in
the case of GC content above 20%. Selection of pegRNA
for AT-rich regions (GC-content below 40%) is chal-
lenging because at present there are no recommenda-
tion in the literature on selection of pegRNAs for these
types of loci. This study is devoted to prime editing of
such region. The pathological genetic variant F508del
in the gene of cystic fibrosis transmembrane conduc-
tance regulator (CFTR) was selected for this study,
which is located at the AT-rich region of the genome.
This variant is associated with cystic fibrosis (CF) –
prevalent monogenic autosomal recessive disease;
average incidence rate in Russia is 1  :  10,250 [10], in
Europe – from 1  :  3000 to 1  :  6000 of newborns [11].
The most common pathogenic variant of the CFTR
gene in the world is the 3-nucleotide deletion F508del;
in the European population this mutation was de-
tected in 70% of alleles of the patients of European
ancestry with CF [12], while in Russia frequency of
this allele is 51.6% [13]. F508del causes disruption of
the process of folding of the trans-membrane protein
transporter of chloride ions CFTR resulting in lack of
protein transport to apical membrane and its degra-
dation by active proteases. Ion disbalance leads to dis-
ruption of functions of many organs, however, accu-
mulation of thick mucus in the respiratory airways is
the most serious manifestation of this disorder, which
facilitates development of bacterial and viral infec-
tions [14] that eventually result in fibrotic changes in
lungs and respiratory failure causing death of the CF
patients. Median life expectancy of the patients in Eu-
rope is 51.7 years [15], and in Russia – 25 years [16].
At present pathogenetic treatment of this disease has
been developed, but the therapeutics have serious side
effects, are not suitable for all patients, and they must
be taken for life. Hence, development of causal thera-
py for CF is important [17-19].
As has been mentioned above, selection of
pegRNAs for AT-rich genome regions potentially con-
taining pathogenic variants associated with serious
diseases for which development of gene therapy is
vital, such as F508del variant in the CFTR, is especially
challenging. Furthermore, it is impossible to predict
most optimal pegRNA in silico without experimental
testing. The goal of this study was selection of most
effective conditions for correction of the F508del vari-
ant in the CFTR gene. The most optimal pegRNAs for
correction of the F508del mutation have been identi-
fied in the course of exvivo experiments.
MATERIALS AND METHODS
Cell culture. Basal cells (BCs) of airway epi-
thelium derived from the induced pluripotent stem
cells (IPSCs) of the patients with CF with homozygote
pathogenic variant F508del in the CFTR gene (patients
P1 and P7) were used in the experiments [20, 21]. All
participant or their legal representatives provided vol-
untary informed consent to participate in the study,
which was approved by the ethics committee of the
Research Centre for Medical Genetics (protocol no.  1,
January 28, 2016). Protocol for BCs generation has
been described previously  [22]. Medium for cultiva-
tion of BCs cells consisted of a PneumaCult™-Ex Plus
Medium (StemCell Technologies, Canada) supplement-
ed with 1  µM A83-01 (Tocris, United Kingdom) and
1 µM DMH1 (Tocris).
Selection and synthesis of oligonucleotides,
generation of a plasmid for editing. Twenty-four
variants of pegRNA were selected for prime editing of
F508del mutation (Table S1 in the Online Resourse 1)
differing in variable sites (Table 1). Selection was car-
ried out with the help of the internet resource PE De-
signer (CRISPR RGEN Tools) [8]. Sequences of pegRNAs
included modified 3′-end with the tevopreQ
1
site (5′-
CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA-3′)
for their protection from degradation; the protective
fragment is connected with each of the pegRNA via a
unique linker. Linkers for each of 24 pegRNAs were
selected using the internet resource pegLIT [9]. Total
length of pegRNA after modification was more than
170nt, while the standard amidophosphite method of
oligonucleotide sequence synthesis allows error-free
synthesis of molecules with length no more than
130 nt, hence, it was decided to divide each plasmid
insert into two parts for cloning. For each pegRNA
VOLODINA et al.776
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
2 pairs of oligonucleotides were synthesized (Evrogen,
Russia), which were complementary to each other for
further annealing, as well as they contained protrud-
ing ends for ligation both between each other and
into the plasmid at the restriction sites. To assembly
plasmids containing pegRNA, the pU6-pegRNA-GG-
acceptor plasmid was used [a gift from David Liu (Ad-
dgene plasmid #132777; http://n2t.net/addgene:132777;
RRID:Addgene_132777)]. The plasmid contained the
gene of red fluorescent protein (mRFP), which was
deleted via treatment of the plasmid with the restric-
tion endonuclease Bso31 I (Sibenzim, Russia). After
purification the plasmid backbone was ligated with
pegRNA using T4-ligase (New England Biolabs, USA);
prior to that the complementary parts of pegRNA were
annealed in an Eppendorf 5332 Mastercycler Personal
PCR Thermal Cycle (Eppendorf, Germany) and treated
with a T4 polynucleotide kinase (T4PNK, New England
Biolabs) (Fig.2). Presence of mRFP allows selection of
the clones with successful insertion, because the colo-
nies with initial plasmid were red, while the colonies
with specific insertion were colorless. The obtained li-
gase mixture was used for transformation Escherichia
coli using a standard protocol. Testing of colonies for
successful insertion of pegRNA was carried out us-
ing PCR (primers: saCas9-sgRNA-seq-F – 5′-TGGACTA
TCATATGCTTACCG-3′; mRFP.R – 5′-GTACCTCGAGCGGC
CCA-3′). PCR results were confirmed using agarose gel
electrophoresis. After confirming correct length of the
fragment, samples were subjected to Sanger sequenc-
ing using the same primers to verify sequence of the
insertion.
Selection of modifications for prime editing. At
present several platforms have been developed for PE.
The PEmax platform (pCCF-PEmax plasmid was a kind
gift from David Liu (Addgene plasmid #174820; http://
n2t.net/addgene:174820; RRID:Addgene_174820) [23]
and the PE2-NG platform (pCCF-PE2-NG plasmid
was a kind gift from Yongsub Kim (Addgene plas-
mid #159977; http://n2t.net/addgene:159977; RRID:
Addgene_159977) [18] were selected for editing the
F508del variant of the CFTR gene. The PE2 system,
unlike the original PE1, contains several mutations
in the M-MLV RT for increasing efficiency, and the
PE2-NG contains Cas9 recognizing PAM NG [24]. The
PEmax system has been developed based on PE2, this
variant includes NLS sequences, additional mutations
in the SpCas9 nickase, and codon-optimized reverse
transcriptase. For screening 24 pegRNA were selected:
15 – for PEmax and 9 – for PE2-NG.
Electroporation of airway BCs. Electroporation
of two lines of airway BCs homozygous for the F508del
variants of the CFTR gene derived from the patients
P1 and P7 was carried out using a Neon™ Transfec-
tion System (Thermo Fisher Scientific, USA). For this
purpose, BCs were detached from a polymer surface
using a Versene solution (PanEko, Russia), cells were
counted using an automatic cell counter Countess II
(Thermo Fisher Scientific) and centrifuged at 150g for
5min. Cell deposit was resuspended in an Opti-MEM™
medium (Gibco™, USA) to concentration 0.5×10
6
cells
per 100 µl. Plasmids were added to cell suspension
at the amount 400 ng per 0.5×10
6
cells: 200  ng of the
plasmid with editor and 200 ng of the plasmid with
pegRNA. The following controls were used: plasmid
encoding PEmax without pegRNA (400  ng per well);
mix plasmid encoding PEmax with non-target pegRNA
(totally 400  ng per well); plasmid encoding PE2-NG
without pegRNA (400  ng per well); non-transfected
control. Electroporation of the suspension of BCs and
plasmid was carried out in a 10-µl volume with two
20-ms pulses at voltage 1290CF. Next cells were placed
Fig. 2. Scheme of plasmid assembly with pegRNA.
pegRNA OPTIMIZATION 777
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
Table 1. Variable regions of pegRNA for prime editing
No.
Spacer site – site hybridizing
with DNA molecule (5′ → 3′)
RTT – reverse transcription
template (5′ → 3′)
PBS – primer
binding site (5′ → 3′)
Linker sequence for
tevopreQ
1
(5′ → 3′)
#1 ACCATTAAAGAAAATATCAT ACCAAAGATG ATATTTTCTTTA TACCAACT
#2 ACCATTAAAGAAAATATCAT ACACCAAAGATG ATATTTTCTTTA CTAACTTT
#3 ACCATTAAAGAAAATATCAT AACACCAAAGATG ATATTTTCTTTA CCCACCGA
#4 ACCATTAAAGAAAATATCAT GAAACACCAAAGATG ATATTTTCTTTA CCACCCAC
#5 ACCATTAAAGAAAATATCAT AGGAAACACCAAAGATG ATATTTTCTTTA CACATACG
#6 ACCATTAAAGAAAATATCAT ACCAAAGATG ATATTTTCTTTAA CTACAACA
#7 ACCATTAAAGAAAATATCAT CACCAAAGATG ATATTTTCTTTAA CTACCCAG
#8 ACCATTAAAGAAAATATCAT AACACCAAAGATG ATATTTTCTTTAA ACCCTATT
#9 ACCATTAAAGAAAATATCAT GAAACACCAAAGATG ATATTTTCTTTAA CCCAACGC
#10 ACCATTAAAGAAAATATCAT AGGAAACACCAAAGATG ATATTTTCTTTAA CATAAGCA
#11 ACCATTAAAGAAAATATCAT ACCAAAGATG ATATTTTCTTTAAT ACTAATAG
#12 ACCATTAAAGAAAATATCAT CACCAAAGATG ATATTTTCTTTAAT ACTAATAG
#13 ACCATTAAAGAAAATATCAT AACACCAAAGATG ATATTTTCTTTAAT ACTAATAG
#14 ACCATTAAAGAAAATATCAT GAAACACCAAAGATG ATATTTTCTTTAAT TATACCAA
#15 ACCATTAAAGAAAATATCAT AGGAAACACCAAAGATG ATATTTTCTTTAAT ACTAACAG
#16 ATTATGCCTGGCACCATTAA AAAGATGATATTTTCTTTA ATGGTGCCAGGCAT AGAATAGT
#17 CCATTAAAGAAAATATCATT GGAAACACCAAAGAT GATATTTTCTTT CTACCAAG
#18 CCATTAAAGAAAATATCATT GGAAACACCAAAGAT GATATTTTCTTTA CTCAAACA
#19 CCATTAAAGAAAATATCATT GGAAACACCAAAGAT GATATTTTCTTTAA CCAATAAC
#20 TTCATCATAGGAAACACCAA ATCATCTTTG GTGTTTCCTATG ATCGTAAT
#21 TTCATCATAGGAAACACCAA TATCATCTTTG GTGTTTCCTATG TATAATTA
#22 TTCATCATAGGAAACACCAA AATATCATCTTTG GTGTTTCCTATG TCTCAGTC
#23 TTCATCATAGGAAACACCAA AAAATATCATCTTTG GTGTTTCCTATG CTCCTTCC
#24 TTCATCATAGGAAACACCAA AGAAAATATCATCTTTG GTGTTTCCTATG CCTTTAAT
onto a polymer surface in a medium for BCs. Effi-
ciency of transfection was evaluated indirectly based
on the number of GFP
+
-cells transfected with an eGFP
(AAT-PB-CG2APtk F508del) plasmid with the size of
10,067 bp in a separate well using a CytoFLEX S flow
cytometer (Beckman Coulter, USA) 72  h after elec-
troporation. Indirect evaluation is required, because
there was no possibility to add reporter gene into the
plasmid with editor due to its size, because increase
ofthe plasmid size could significantly reduce efficien-
cy of both transfection and editing.
Lipofection of airway BCs. Lipofection of two
lines of BCs, P1 and P7, was carried out with the help
of a commercial Lipofectamine LTX kit (Thermo Fisher
VOLODINA et al.778
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
Fig.  3. Scheme of experiments for screening of 24 pegRNAs in airway BCs from two patients with homozygous F508del
variant of the CFTR gene.
Scientific). One day prior to lipofection BCs were pas-
saged into 24-well plates (SPL Lifesciences, Korea) at
the amount of 40×10
3
cells per well in the medium
for BC. Transfection conditions: 2.5  µl of a Lipofect-
amine LTX and 700 ng plasmid DNA (570  ng of the
plasmid with editor and 130  ng of the plasmid with
pegRNA) were added to a well (40×10
3
cells). Efficien-
cy of transfection was evaluated as described above.
Evaluation of editing efficiency. DNA for am-
plification and deep targeted sequencing of the CFTR
fragment with NGS (next-generation sequencing)
was isolated using phenol-chloroform extraction
technique according to the standard protocol fol-
lowed by amplification (primers: 5F – 5′-TGGAGCC
TTCAGAGGGTAAAAT-3′ and 8R – 5′-TGGCATGCTTTGA
TGACGCT-3′). Next the obtained amplicons were
subjected to deep targeted sequencing at the Center
for Collective Use “Genome” at the Research Cen-
tre for Medical Genetics. Deep targeted sequencing
was carried out with a new-generation sequencer
NextSeq500 (Illumina, USA) using pair-end sequenc-
ing reads method (2×150 bp). A library preparation
kit for amplicon sample SG GM Ampli (Raissol, Rus-
sia) was used for library generation according to the
manufacturer’s protocol. Number of cycles for final
amplification was reduced to  4. Primers for library
preparation with Illumina platform were used for
dual indexing. Concentration of the produced libraries
was measured with the help of a Qubit2.0 fluorimeter
(Invitrogen, USA) using a Qubit dsDNA HS Assay kit
(Invitrogen). Processing of sequencing data was car-
ried out with the NGSdata program developed in the
department of Bioinformatics of the Research Centre
for Medical Genetics (registration no.  2021662113).
The obtained results were analyzed with the help
of CRISPResso2 program [25].
Statistical data processing. Dunn's test was used
for statistical processing of the data using the Graph-
Pad Prism program. Differences with negative control
were considered significant at p < 0.05.
RESULTS
Screening of 24 variants of prime editing of air-
way BC. In order to correct pathogenic variant F508del
in the CFTR gene the PE method was chosen, which
is a genome editing method that allows introducing
a broad range of changes into the DNA molecule not
involving generation of a double-strand DNA break.
Thedesired correction suggests introduction of a 3-nu-
cleotide insertion at the site of deletion. F508del is lo-
cated in the AT-rich locus, which complicates selection
of pegRNA for prime editing. Screening of 24 pegRNAs
differing in composition of spacer sequences, PBS, and
RTT, as well as in lengths of PBS and RTT was car-
ried out to select most efficient sequences. From those,
15 pegRNAs were designed for PEmax, which is a PE
variant containing Cas9 nickase recognizing PAMNGG,
and 9 – for PE2-NG, which involves Cas9 nickase rec-
ognizing PAM NG. Experiments were performed with
airway BCs derived from two patients with homozy-
gous F508del variant of the CFTR gene – P1 and P7.
Plasmids with the editor and pegRNA were co-trans-
fected using electroporation, 72  h after transfection
DNA was isolated, targeted region was amplified, and
deep targeted sequencing was performed (Fig.  3). The
sequencing data were analyzed with the help of on-
line resource CRISPResso2, and statistical analysis was
performed using the GraphPad Prism9 program.
First, the initial screening was carried out – two
experiments with airway BCs from two patients using
pegRNA OPTIMIZATION 779
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
Fig. 4. Efficiency of correction of the pathogenic variant after prime editing using 24 pegRNAs in the airway BCs from
two patients with homozygous F508del variant of the CFTR gene. Genetic constructs were delivered with electroporation.
Average efficiency of correction of the pathogenic variant in two experiment is shown in the plot. Error bars for Y-axis
represent standard error of the mean; C, non-transfected control.
all 24 variants of pegRNA. The results of NGS re-
vealed that the pegRNA1 and pegRNA5 are potentially
most effective for PEmax, and pegRNA17, pegRNA19,
pegRNA20, pegRNA21, and pegRNA22 – for PE2-NG:
average efficiency of editing in two experiments was
from 2.4 to 6.1% without accounting for transfec-
tion efficiency (Fig. 3), which was 25.4% on average.
Fractions of the alleles with the desired CTT inser-
tion to the region of the F508del in the CFTR gene
are presented in Fig.  4; in the process this insertion
could be accompanied with introduction of additional
non-target changes in the same allele. It could be seen
from the data presented in Fig.  4 that there is high
variability of editing in the case of electroporation,
which, likely, could be explained by high variability of
plasmid delivery with the help of this method.
Testing of most effective variants of pegRNAs.
Further experiments were carried out using pegRNAs
shown to be most effective in the screening experi-
ments. Two biological and three technical replicates
were performed in the experiment with the BCs from
the patients P1 and P7. Plasmids with the editor and
pegRNA were co-transfected using lipofection tech-
nique. In the case of PE2-NG the highest efficiency
of correcting pathogenic variant was observed for
pegRNA19, pegRNA20, pegRNA21, and pegRNA22; it
was on average 2.50% (p  =  0.03), 2.81% (p  =  0.0005),
2.06% (p  =  0.01), and 1.79% (p  =  0.03), respectively.
All pegRNAs selected for the PEmax platform did not
demonstrate high efficiency, and differences between
the efficiencies of correction of the F508del variant in
the CFTR gene in the test sample and in the control
were not statistically significant (p  >  0.05). The differ-
ences between the correction efficiency of this variant
for each pegRNA with other pegRNAs were statistical-
ly insignificant (p  >  0.05) (Fig. 5). The data are shown
without adjustment for the transfection efficiency, on
average it was 11.9%.
Evaluation of undesirable changes in the edit-
ing locus. All undesirable changes in the 20-nt win-
dow around the editing locus were assessed in the
experiment, sequences of 10-nt before and after the
Fig. 5. Efficiency of correction of the pathogenic variant us-
ing prime editing in the airway BCs from two patients with
homozygous F508del variant of the CFTR gene with 7 most
effective pegRNAs. Average efficiency of editing for each
pegRNA calculated based on the combined data from two
biological and three technical replicates of the experiment
with airway BCs from two patients is shown on the graph.
Dunn index was used for statistical analysis. Y-axis error
bars show standard error of the mean; C, non-transfected
cells; *  p  <  0.05; ***  p  <  0.001.
VOLODINA et al.780
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
Fig.  6. Evaluation of non-target changes in DNA after prime editing in the samples without targeted CTT insertion. The
analyzed DNA sequence (with F508del variant) is shown and corresponding amino acid sequence (amino acid is shown
together with its position in the polypeptide chain) as well as site of introduction of single-strand break in the process
of editing by pegRNA20, -21, and -22. Distribution of single-nucleotide substitutions c.1528G>N, c.1529T>N, c.1531T>N, and
c.1531delT is shown on the graph, which were introduced during editing using pegRNA20, -21, and -22. Y-axis error bars
show standard error of the mean.
Fig.  7. Evaluation of non-target changes in DNA after prime editing of the samples with CTT targeted insertion. The ana-
lyzed DNA sequence is shown (without the F508del variant), as well as corresponding amino acid sequence (amino acid is
shown together with its position in the polypeptide chain) and sites of introduction of single-strand breaks in the process
of editing by various pegRNAs. Y-axis error bars show standard error of the mean. a) Introduction of changes into the
target insertion during edition with the help of pegRNA1, -17, -19, and -20. b)Distribution of single-nucleotide substitutions
c.1528G>A, c.1529T>S, and c.1531T>C introduced during editing with the help of pegRNA20, -21, and -22.
pegRNA OPTIMIZATION 781
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
single-strand break site were analyzed. In most of
the cases, frequency and spectrum of the introduced
changes were the same for the transfected and control
samples, although some exceptions were observed.
Non-target changes that are absent in the
non-transfected control were revealed in the samples
subjected to PE without the target CTT insertion that
were transfected with pegRNA20, -21, and -22. These
pegRNAs contain identical spacer sequence and, cor-
respondingly, the same site of single-strand break.
Among the non-target changes not only synonymous
substitutions (c.1530T>N) were observed, but also vari-
ants with undefined significance: c.1528G>N observed
with average frequencies 0.03%, 0.05%, and 0.03%;
c.1529T>N observed with average frequencies 0.08%,
0.08%, and 0.08%; c.1531T>N also observed with av-
erage frequencies 0.08%, 0.08%, and 0.08% from to-
tal number of reads in the samples edited with the
help of pegRNA20, -21, and -22, respectively. In ad-
dition, a single-nucleotide probably pathogenic dele-
tion c.1531delT was observed with mean frequency
of 0.02% in the samples edited with pegRNA20, and
0.01%– in the samples edited with pegRNA21 (Fig.6).
The variants with undefined significance were
also observed in the samples with successful correc-
tion edited with the help of pegRNA20, pegRNA21, and
pegRNA22: c.1528G>A with average frequency 0.04%
for pegRNA20; c.1529T>S with average frequencies
0.02% and 0.02% for pegRNA20 and -21, respectively;
c.1531T>C with average frequencies 0.02% and 0,02%
for pegRNA20 and -22, respectively. The fraction was
calculated with respect to total number of reads.
The substitutions c.1522T>M in the insert itself
also were observed in the cases of editing with the
help of pegRNA1, -17, -19, -20, and -21, their frequen-
cies were on average 0.05%, 0.02%, 0.02%, 0.02%, and
0.04% of total number of reads, respectively. These
variants were also of unidentified significance (Fig. 7).
DISCUSSION
The F508del variant of the CFTR gene is located in
the AT-rich genome region, which complicates its ef-
fective correction with the help of prime editing. That
is why it was important to identify effective editing
systems allowing selection of the largest number of
pegRNAs. The PEmax and PE2-NG systems were se-
lected for the study. Both variants introduce only one
break to DNA, unlike in the case of more effective PE3
system involving introduction of two breaks, which
is accompanied by the significant increase of the fre-
quency of undesired insertions and deletions at the
editing locus [26,27]. Moreover, both these variants do
not use supplementary proteins affecting repair of the
introduced breaks, hence, they have smaller size (and
higher efficiency of intracellular delivery) than, for
example, more effective system PE4 [23]. The PEmax
editor contains nCas9 recognizing PAM NGG, which
limits the possibilities of pegRNA selection. Hence, the
PE2-NG editor, which demonstrates lower efficiency
in this system, was also selected [23], however, nCas9
in this case recognizes PAM NG, which allows selec-
tion of other pegRNAs with higher GC-content, which
proved to be very important in this study, because
these variants demonstrated the highest efficiency.
In all pegRNAs selected for the PEmax editor con-
tent of GC nucleotides in the spacer composition was
20%, and in the PBS composition – was below 10%.
It was possible to select guide RNAs for the PE2-NG
system with higher GC-content in both spacer and
PBS fragments. The highest efficiency was observed
with the pegRNA20 (2.81%), in this case GC content of
the spacer was 35%, and of the PBS– 42%. We suggest
that the higher efficiency could be associated with
the increase of GC content in the variable regions of
pegRNAs.
Experiments in this study involved two steps. In
the first step initial screening of the pegRNAs was car-
ried out, which allowed selecting the most effective
pegRNAs for each editor. In this step transfection was
performed with the help of electroporation. Howev-
er, the obtained results (efficiency of transfection and
editing) were not sufficiently reproducible between
the technical and biological replicates, hence, the fol-
lowing experiments were carried out using lipofection
as more reproducible technique [28]. As a result, the
most effective pegRNA for correction of the pathogenic
F508del variant of the CFTR gene in the AT-rich ge-
nome region was identified. Efficiency of this mutation
correction with the help of pegRNA20 reached 2.81%.
Despite the fact that the exact efficiency of transfection
of the plasmid with the genome editor is unknown,
based on the indirect data it is predicted to be 11.9%,
and, thus, it could be expected in this case that the ef-
ficiency of editing under optimal conditions is 23.6% of
all alleles. Furthermore, it is known from the literature
data that 6-10% of the CFTR-expressing cells is suffi-
cient for normalization of chlorine ion transport [29],
hence, we assume that if the efficiency of pegRNA20
delivery could be increased, this approach could a
form a basis for the development of CF therapy.
At present, delivery of the prime editing system
is one of the main limitations of this method. Its low
efficiency is determined by the large size of the prime
editor. In particular, the size of plasmid construct of
the editor is up to 10  kb, as it includes Cas9 nickase
consisting of approximately 4100  nt, reverse transcrip-
tase with size ~2000  bp, as well as other required se-
quences including regulatory sequences, origin of rep-
lication, and antibiotic resistance cassette [26, 30,31].
In the case of airway BCs, as has been noted by
VOLODINA et al.782
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
Bulcaen et al. [32], the delivery is even more compli-
cated due to existence of the cell barriers preventing
penetration of genetic constructs. In the cited study
prime editing was used for correction of the patho-
genic variants L227R and N1303K in the CFTR gene.
The authors reported restoration of CFTR function in
the intestine organoids and in the primary cells of
nasal epithelium, but there were complications with
the delivery of this system to the airway cells.
In one of the studies devoted to correction of the
W1282X mutation in the CFTR gene in the airway BCs
with the help of PE the authors selected a helper-de-
pendent adenovirus, which demonstrated high effi-
ciency of transduction, however, correction of W1282X
was only 2.4  ±  0.6% [33].
In one of the studies the authors demonstrated
significant results in correction of the F508del variant
in the CFTR gene. Sousa et al. reported [34] that the
PE6 system in combination with improved pegRNAs,
additional guide RNAs, and MLH1dn protein demon-
strated efficiency of correction up to 51% in the im-
mortalized airway cells. High efficiency of transfec-
tion with electroporation also has been demonstrated
in this study. Unfortunately, not all of the used condi-
tions could be used for further development of gene
therapy for mucoviscidosis. Firstly, high percentage of
introduced undesirable changes in the editing locus
was observed – 13%. Likely this was due to the use
of additional guide RNA and introduction of one more
break to the DNA molecule, as well as due to suppres-
sion of the system of repair of noncomplementary nu-
cleotides. Secondly, electroporation is not suitable for
introduction of genetic constructs in vivo [34].
In some studies efficiency of prime editing was
shown to be comparable with the CRISPR/Cas9 sys-
tem, which contradicts the previously obtained data
demonstrating higher efficiency of the PE system [35].
Nevertheless, PE remain a preferable method for in-
troduction of targeted changes to nucleotide sequence,
due to the fact that it is the safest. In the studies asso-
ciated with correction of the F508del mutation in the
CFTR gene with the help of CRISPR/Cas9, the standard
system was shown to be ineffective and resulted in
high percentage of undesirable changes in the editing
locus because NHEJ was predominant repair pathway
[36,37]. Another limitation for the use of CRISPR/Cas9
system for development of gene therapy is the fact
that the HDR mechanism is active only in dividing
cells. And majority of airway cells are in the state
of quiescence and are not dividing actively, which
increases probability of the repair via NHEJ when
CRISPR/Cas9 is used in vivo [38].
Prime editing, on the other hand, demonstrates
very low percentage of undesirable changes in the ed-
iting locus, although it does not demonstrate high ef-
ficiency due to peculiarities of delivery. We were able
tomake such conclusion based on the results of analy-
sis of frequencies of single-nucleotide substitutions,
insertions, and deletions. In most of the cases frequen-
cy of such changes was the same as in the non-trans-
fected controls and samples. The errors could appear
and accumulate at the stage of amplification, as well
as at the stage of deep targeted sequencing [39,  40].
The single-nucleotide substitutions not observed in the
controls were mostly observed in the samples with
unsuccessful insertion, and fraction of such changes
did not exceed 0.08%. In the process only one sin-
gle-nucleotide deletion was observed, and its fraction
did not exceed 0.02% of total number of reads.
CONCLUSIONS
Despite the fact that prime editing is a very
promising tool for development of gene therapy, its
use could be limited in the AT-rich genome regions.
In this study we conducted screening of 24 pegRNA
in the airway BC from the patients with homozygous
F508del variant of the CFTR gene. pegRNAs were se-
lected for two different editors, PEmax and PE2-NG,
and the most effective molecule, pegRNA20, was iden-
tified as a result. According to the literature data, the
editor PE2-NG, for which this pegRNA was designed,
is less effective editor than the PEmax, however, for
correction of the AT-rich region flexibility of PAM was
found to be more important.
Efficiency of correction of the pathogenic variant
with the help of pegRNA20 was only 2.81% without
consideration of transfection efficiency. This could be
due to the fact that the genetic construct encoding
the editor is large, and it is difficult to deliver it with
the help of existing delivery systems. In order to de-
velop mucoviscidosis therapy based on prime editing
it is necessary to find effective and safe method for
delivering large genetic constructs to the cell.
Abbreviations. BCs, basal cells; Cas, CRISPR-asso-
ciated protein; CF, cystic fibrosis; CFTR, gene of cystic
fibrosis transmembrane conductance regulator, mu-
coviscidosis transmembrane conductance regulator;
CRISPR, system of clustered regularly interspaced
short palindromic repeats; HDR, homology-directed re-
pair; nt, nucleotide; NGS, next-generation sequencing;
NHEJ, non-homologous end joining; PAM, protospacer
adjacent motif; PBS, primer binding site; PE, prime ed-
iting; pegRNA, prime editing guide RNA; PEmax and
PE2-NG, two different systems for prime editing; RT,
reverse transcriptase; RTT, reverse transcriptase tem-
plate.
Supplementary information. The online version
contains supplementary material available at https://
doi.org/10.1134/S0006297924604672.
pegRNA OPTIMIZATION 783
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
Acknowledgments. The authors express their
gratitude to Elena Lvovna Amelina (PhD, Scientific-
Research Institute of Pulmonology, FMBA of Russia)
for providing initial cell material from the patients.
Images were created with the help of BioRender
(https://www.biorender.com/).
Contributions. O. V. Volodina, A. A. Anuchina,
A. V. Lavrov, and S. A. Smirnikhina – concept and su-
pervision of the study; O. V. Volodina, A. G. Demchenko,
A. A. Anuchina, and E. V. Kondrateva – conducting ex-
periments; O. P. Ryzhkova and V. A. Kovalskaya – con-
ducting deep targeted sequencing; E. V. Kondrateva,
V. Yu. Tabakov and A. G. Demchenko– preparation of
cell material; O. V. Volodina and S. A. Smirnikhina –
discussion of the results of the study, writing text of
the paper; S. A. Smirnikhina – procuring funding for
the study.
Funding. This study was financially supported
by the State Budget Project of the Ministry of Sci-
ence and Higher Education of the Russian Federation.
Work with pegRNA1, pegRNA5, pegRNA17, pegRNA19,
pegRNA20, pegRNA21, pegRNA22 was financially sup-
ported by the LLC “MK Development” with informa-
tion support provided by AVVA PharmaceuticalsLtd.
Ethics approval and consent to participate. All
procedures performed in studies involving human
participants were in accordance with the ethical stan-
dards of the institutional and/or national research
committee and with the 1964 Helsinki declaration and
its later amendments or comparable ethical standards.
Voluntary informed consent was obtained from all
participants.
Conflict of interest. The authors of this work de-
clare that they have no conflicts of interest.
REFERENCES
1. Xiao-Jie, L., Hui-Ying, X., Zun-Ping, K., Jin-Lian, C.,
and Li-Juan, J. (2015) CRISPR-Cas9: a new and
promising player in gene therapy, J. Med. Gen-
et., 52, 289-296, https://doi.org/10.1136/jmedgenet-
2014-102968.
2. Gaj, T., Gersbach, C. A., and Barbas, C. F. (2013) ZFN,
TALEN, and CRISPR/Cas-based methods for genome
engineering, Trends Biotechnol., 31, 397-405, https://
doi.org/10.1016/j.tibtech.2013.04.004.
3. Tröder, S.E., and Zevnik,B. (2022) History of genome
editing: from meganucleases to CRISPR, Lab. Anim.,
56, 60-68, https://doi.org/10.1177/0023677221994613.
4. Uddin, F., Rudin, C. M., and Sen, T. (2020) CRISPR
gene therapy: applications, limitations, and implica-
tions for the future, Front. Oncol., 10, 1387, https://
doi.org/10.3389/fonc.2020.01387.
5. Kantor, A., McClements, M. E., and MacLaren, R. E.
(2020) CRISPR-Cas9 DNA base-editing and prime-
editing, Int.J. Mol. Sci., 21, 6240, https://doi.org/
10.3390/ijms21176240.
6. Lee, J., Lim, K., Kim, A., Mok, Y. G., Chung, E., Cho,
S.-I., Lee, J. M., and Kim, J.-S. (2023) Prime editing
with genuine Cas9 nickases minimizes unwanted in-
dels, Nat. Commun., 14, 1786, https://doi.org/10.1038/
s41467-023-37507-8.
7. Chow, R. D., Chen, J. S., Shen, J., and Chen, S. (2021)
Aweb tool for the design of prime-editing guide RNAs,
Nat. Biomed. Eng., 5, 190-194, https://doi.org/10.1038/
s41551-020-00622-8.
8. Hwang, G.-H., Jeong, Y. K., Habib, O., Hong, S.-A.,
Lim,K., Kim, J.-S., and Bae,S. (2021) PE-Designer and
PE-Analyzer: web-based design and analysis tools
for CRISPR prime editing, Nucleic Acids Res., 49,
W499-W504, https://doi.org/10.1093/nar/gkab319.
9. Nelson, J. W., Randolph, P. B., Shen, S. P., Everette,
K.A., Chen, P.J., Anzalone, A.V., An,M., Newby, G.A.,
Chen, J. C., Hsu, A., and Liu, D. R. (2022) Engineered
pegRNAs improve prime editing efficiency, Nat. Bio-
technol., 40, 402-410, https://doi.org/10.1038/s41587-
021-01039-7.
10. Kiseleva,A., Klimushina,M., Sotnikova,E., Skirko,O.,
Divashuk, M., Kurilova, O., Ershova, A., Khlebus, E.,
Zharikova,A., Efimova,I., Pokrovskaya,M., Slominsky,
P. A., Shalnova, S., Meshkov, A., and Drapkina, O.
(2020) Cystic fibrosis polymorphic variants in a
Russian population, Pharmgenomics Pers. Med., 13,
679-686, https://doi.org/10.2147/PGPM.S278806.
11. Scotet,V., L’Hostis,C., and Férec,C. (2020) Thechang-
ing epidemiology of cystic fibrosis: incidence, survival
and impact of the CFTR gene discovery, Genes (Basel),
11, 589, https://doi.org/10.3390/genes11060589.
12. Bobadilla, J. L., Macek, M., Fine, J. P., and Farrell,
P. M. (2002) Cystic fibrosis: a worldwide analysis of
CFTR mutations– correlation with incidence data and
application to screening, Hum. Mutat., 19, 575-606,
https://doi.org/10.1002/humu.10041.
13. Registry of Patients with Cystic Fibrosis in Russia [in
Russian], URL: https://mukoviscidoz.org/mukovist-
sidoz-v-rossii.html.
14. De Boeck,K. (2020) Cystic fibrosis in the year 2020: a
disease with a new face, Acta Paediatr., 109, 893-899,
https://doi.org/10.1111/apa.15155.
15. McKone, E. F., Ariti, C., Jackson, A., Zolin, A., Carr,
S. B., Orenti, A., van Rens, J. G., Lemonnier, L.,
Macek, M., Keogh, R. H., Naehrlich, L., and Europe-
an Cystic Fibrosis Society Patient Registry (2021)
Survival estimates in European cystic fibrosis pa-
tients and the impact of socioeconomic factors:
a retrospective registry cohort study, Eur. Re-
spir. J., 58, 2002288, https://doi.org/10.1183/13993003.
02288-2020.
16. Amelina, E. L., Cherniak, A. V., and Cherniaev, A. L.
(2001) Cystic fibrosis: current survival [in Russian],
Pulmonologiya, 3, 61-64.
VOLODINA et al.784
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
17. Spoletini, G., Gillgrass, L., Pollard, K., Shaw, N.,
Williams, E., Etherington, C., Clifton, I. J., and
Peckham, D.G. (2022) Dose adjustments of Elexacaftor/
Tezacaftor/Ivacaftor in response to mental health side
effects in adults with cystic fibrosis, J.Cyst. Fibros.,
21, 1061-1065, https://doi.org/10.1016/j.jcf.2022.05.001.
18. Papadakis,L., Stander,T., Mombourquette,J., Richards,
C. J., Yonker, L. M., Lawton, B., Hardcastle, M.,
Zweifach, J., Sicilian, L., Bringhurst, L., and Neuring-
er, I. P. (2025) Heterogeneity in reported side effects
following initiation of elexacaftor-tezacaftor-iva-
caftor: experiences at a quaternary CF care center,
Pediatr. Pulmonol., 60, e27382, https://doi.org/10.1002/
ppul.27382.
19. Safety and Possible Side Effects|TRIKAFTA® (el-
exacaftor/tezacaftor/ivacaftor and ivacaftor), URL:
https://www.trikafta.com/safety-side-effects.
20. Kondrateva, E., Adilgereeva, E., Amelina, E.,
Tabakov, V., Demchenko, A., Ustinov, K., Yasinov-
sky, M., Voronina, E., Lavrov, A., and Smirnikhina, S.
(2020) Generation of induced pluripotent stem cell
line (RCMGi001-A) from human skin fibroblasts
of a cystic fibrosis patient with p.F508del muta-
tion, Stem Cell Res., 48, 101933, https://doi.org/
10.1016/j.scr.2020.101933.
21. Kondrateva, E., Demchenko, A., Slesarenko, Y.,
Yasinovsky,M., Amelina,E., Tabakov,V., Voronina,E.,
Lavrov, A., and Smirnikhina, S. (2021) Derivation
of iPSC line (RCMGi002-A) from dermal fibroblasts
of a cystic fibrosis female patient with homozy-
gous F508del mutation, Stem Cell Res., 53, 102251,
https://doi.org/10.1016/j.scr.2021.102251.
22. Demchenko, A., Belova, L., Balyasin, M., Kochergin-
Nikitsky, K., Kondrateva, E., Voronina, E., Pozhit-
nova, V., Tabakov, V., Salikhova, D., Bukharova, T.,
Goldshtein, D., Kondratyeva, E., Kyian, T., Amelina, E.,
Zubkova, O., Popova, O., Ozharovskaia, T., Lavrov, A.,
and Smirnikhina, S. (2024) Airway basal cells from
human-induced pluripotent stem cells: a new frontier
in cystic fibrosis research, Front. Cell. Dev. Biol., 12,
1336392, https://doi.org/10.3389/fcell.2024.1336392.
23. Chen, P. J., Hussmann, J. A., Yan, J., Knipping, F.,
Ravisankar, P., Chen, P.-F., Chen, C., Nelson, J. W.,
Newby, G.A., Sahin,M., Osborn, M.J., Weissman, J.S.,
Adamson, B., and Liu, D. R. (2021) Enhanced prime
editing systems by manipulating cellular determi-
nants of editing outcomes, Cell, 184, 5635-5652.e29,
https://doi.org/10.1016/j.cell.2021.09.018.
24. Kweon, J., Yoon, J.-K., Jang, A.-H., Shin, H. R., See,
J.-E., Jang, G., Kim, J.-I., and Kim, Y. (2021) Engi-
neered prime editors with PAM flexibility, Mol.
Ther., 29, 2001-2007, https://doi.org/10.1016/j.ymthe.
2021.02.022.
25. Clement, K., Rees, H., Canver, M. C., Gehrke, J. M.,
Farouni, R., Hsu, J. Y., Cole, M. A., Liu, D. R., Joung,
J. K., Bauer, D. E., and Pinello, L. (2019) CRISPResso2
provides accurate and rapid genome editing se-
quence analysis, Nat. Biotechnol., 37, 224-226, https://
doi.org/10.1038/s41587-019-0032-3.
26. Anzalone, A. V., Randolph, P. B., Davis, J. R., Sousa,
A.A., Koblan, L.W., Levy, J.M., Chen, P.J., Wilson,C.,
Newby, G.A., Raguram,A., and Liu, D.R. (2019) Search-
and-replace genome editing without double-strand
breaks or donor DNA, Nature, 576, 149-157, https://
doi.org/10.1038/s41586-019-1711-4.
27. Kim, D.Y., Moon, S.B., Ko, J.-H., Kim, Y.-S., and Kim,D.
(2020) Unbiased investigation of specificities of prime
editing systems in human cells, Nucleic Acids Res.,
48, 10576-10589, https://doi.org/10.1093/nar/gkaa764.
28. Fajrial, A. K., He, Q. Q., Wirusanti, N. I., Slansky,
J. E., and Ding, X. (2020) A review of emerging phys-
ical transfection methods for CRISPR/Cas9-mediated
gene editing, Theranostics, 10, 5532-5549, https://
doi.org/10.7150/thno.43465.
29. Johnson, L. G., Olsen, J. C., Sarkadi, B., Moore, K. L.,
Swanstrom,R., and Boucher, R.C. (1992) Efficiency of
gene transfer for restoration of normal airway epi-
thelial function in cystic fibrosis, Nat. Genet., 2, 21-25,
https://doi.org/10.1038/ng0992-21.
30. Ribeiro, S., Mairhofer, J., Madeira, C., Diogo, M. M.,
Lobato da Silva, C., Monteiro, G., Grabherr, R., and
Cabral, J. M. (2012) Plasmid DNA size does affect
nonviral gene delivery efficiency in stem cells, Cell
Reprogram., 14, 130-137, https://doi.org/10.1089/cell.
2011.0093.
31. Felgner, P.L., Gadek, T.R., Holm,M., Roman,R., Chan,
H. W., Wenz, M., Northrop, J. P., Ringold, G. M., and
Danielsen,M. (1987) Lipofection: a highly efficient, lip-
id-mediated DNA-transfection procedure, Proc. Natl.
Acad. Sci. USA, 84, 7413-7417, https://doi.org/10.1073/
pnas.84.21.7413.
32. Bulcaen, M., Kortleven, P., Liu, R. B., Maule, G.,
Dreano, E., Kelly, M., Ensinck, M. M., Thierie, S.,
Smits, M., Ciciani, M., Hatton, A., Chevalier, B.,
Ramalho, A. S., Casadevall i Solvas, X., Debyser, Z.,
Vermeulen, F., Gijsbers, R., Sermet-Gaudelus, I.,
Cereseto, A., and Carlon, M. S. (2024) Prime editing
functionally corrects cystic fibrosis-causing CFTR
mutations in human organoids and airway epithelial
cells, Cell Rep. Med., 5, 101544, https://doi.org/10.1016/
j.xcrm.2024.101544.
33. Li, C., Liu, Z., Anderson, J., Liu, Z., Tang, L., Li, Y.,
Peng,N., Chen,J., Liu,X., Fu,L., Townes, T.M., Rowe,
S. M., Bedwell, D. M., Guimbellot, J., and Zhao, R.
(2023) Prime editing-mediated correction of the
CFTR W1282X mutation in iPSCs and derived air-
way epithelial cells, PLoS One, 18, e0295009, https://
doi.org/10.1371/journal.pone.0295009.
34. Sousa, A. A., Hemez, C., Lei, L., Traore, S., Kulhan-
kova,K., Newby, G.A., Doman, J.L., Oye,K., Pandey,S.,
Karp, P. H., McCray, P. B., and Liu, D. R. (2025) Sys-
tematic optimization of prime editing for the efficient
pegRNA OPTIMIZATION 785
BIOCHEMISTRY (Moscow) Vol. 90 No. 6 2025
functional correction of CFTR F508del in human air-
way epithelial cells, Nat. Biomed. Eng., 9, 7-21, https://
doi.org/10.1038/s41551-024-01233-3.
35. Averina, O. A., Permyakov, O. A., Grigorieva, O. O.,
Starshin, A. S., Mazur, A. M., Prokhortchouk, E. B.,
Dontsova, O. A., and Sergiev, P. V. (2021) Compara-
tive analysis of genome editors efficiency on a model
of mice zygotes microinjection, Int.J. Mol. Sci., 22,
10221, https://doi.org/10.3390/ijms221910221.
36. Bassai, L., Shigunov, P., and Soares, L. (2021) Cor-
rection of the mutation cause of cystic fibrosis
(F508DEL) in pulmonary epithelius line cells BY
CRISPR/CAS9, Cytotherapy, 23, 8, https://doi.org/
10.1016/j.jcyt.2021.02.028.
37. Smirnikhina, S.A., Kondrateva, E.V., Adilgereeva, E.P.,
Anuchina, A.A., Zaynitdinova, M.I., Slesarenko, Y.S.,
Ershova, A. S., Ustinov, K. D., Yasinovsky, M. I.,
Amelina, E.L., Voronina, E.S., Yakushina, V.D., Tabakov,
V.Y., and Lavrov, A.V. (2020) P.F508del editing in cells
from cystic fibrosis patients, PLoS One, 15, e0242094,
https://doi.org/10.1371/journal.pone.0242094.
38. Graham,C., and Hart,S. (2021) CRISPR/Cas9 gene ed-
iting therapies for cystic fibrosis, Expert Opin. Biol.
Ther., 21, 767-780, https://doi.org/10.1080/14712598.
2021.1869208.
39. Pfeiffer,F., Gröber,C., Blank,M., Händler,K., Beyer,M.,
Schultze, J. L., and Mayer, G. (2018) Systematic eval-
uation of error rates and causes in short samples
in next-generation sequencing, Sci. Rep., 8, 10950,
https://doi.org/10.1038/s41598-018-29325-6.
40. Ma, X., Shao, Y., Tian, L., Flasch, D. A., Mulder, H. L.,
Edmonson, M. N., Liu, Y., Chen, X., Newman, S.,
Nakitandwe, J., Li, Y., Li, B., Shen, S., Wang, Z.,
Shurtleff, S., Robison, L. L., Levy, S., Easton, J., and
Zhang, J. (2019) Analysis of error profiles in deep
next-generation sequencing data, Genome Biol., 20,
50, https://doi.org/10.1186/s13059-019-1659-6.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in published
maps and institutional affiliations. AI tools may have
been used in the translation or editing of this article.