ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 7, pp. 1183-1191 © The Author(s) 2024. This article is an open access publication.
1183
Use of qPCR to Evaluate Efficiency
of the Bulky DNA Damage Removal in Extracts
of Mammalian Cells with Different Maximum Lifespan
Aleksei A. Popov
1
, Vladimir A. Shamanin
2
, Irina O. Petruseva
1
,
Aleksei N. Evdokimov
1
, and Olga I. Lavrik
1,3,a
*
1
Institute of Chemical Biology and Fundamental Medicine, Siberian Branch Russian Academy of Sciences,
630090 Novosibirsk, Russia
2
LLC “BioLink”, 630090 Novosibirsk, Russia
3
Novosibirsk National Research State University, 630090 Novosibirsk, Russia
a
e-mail: lavrik@niboch.nsc.ru
Received March 1, 2024
Revised April 18, 2024
Accepted April 28, 2024
Abstract— Proteins of nucleotide excision repair system (NER) are responsible for detecting and removing awide
range of bulky DNA damages, thereby contributing significantly to the genome stability maintenance within
mammalian cells. Evaluation of NER functional status in the cells is important for identifying pathological chang-
es in the body and assessing effectiveness of chemotherapy. The following method, described herein, has been
developed for better assessment of bulky DNA damages removal invitro, based on qPCR. Using the developed
method, NER activity was compared for the extracts of the cells from two mammals with different lifespans:
along-lived naked mole-rat (Heterocephalus glaber) and a short-lived mouse (Musmusculus). Proteins of the
H. glaber cell extract have been shown to be 1.5 times more effective at removing bulky damage from the model
DNA substrate than the proteins of the M. musculus cell extract. These results are consistent with the experimen-
tal data previously obtained. The presented method could be applied not only in fundamental studies of DNA
repair in mammalian cells, but also in clinical practice.
DOI: 10.1134/S0006297924070022
Keywords: DNA repair, PCR, longevity
Abbreviations: BER, base excision repair; ODN,oligodeoxynucleotides; NER,nucleotide excision repair; nFlu,N-[6-(5(6)-
fluoresceinylcarbamoyl)hexanoyl]-3-amino-1,2-propanediol; TEG,tetraethylene glycol.
* To whom correspondence should be addressed.
INTRODUCTION
DNA repair systems ensure maintenance of ge-
nome stability in the cells of a living organism, remov-
al of the recurring damages induced by exogenous and
endogenous factors, and repair the DNA structure[1].
Nucleotide excision repair (NER) proteins remove a
wide range of bulky DNA lesions, including adducts
formed by UV light and harmful polycyclic compounds
from the environment. Such adducts cause significant
disruptions in the regular double-stranded DNA struc-
ture, which are recognized by the XPC factor, which,
inturn, induces recruitment of TFIIH and subsequent
repair complex assembly at the damaged DNA region.
After lesion verification by XPD helicase, excision of
the DNA fragment containing bulky damage catalyzed
by the XPF-ERCC1 and XPG endonucleases occurs.
Theresulting gap is filled in by synthesis using an in-
tact DNA strand as a template and subsequent ligation;
asaresult, the original DNA structure is restored [1].
Since activity of the DNA repair systems deter-
mines resistance of the cells to genotoxic stress effects,
functional status assessment of a particular DNA re-
pair system in the cells is crucial in clinical practice
POPOV et al.1184
BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024
and is conducted to diagnose various pathological
patterns. NER disruption is the cause of diseases such
as Xeroderma pigmentosum and Cockayne syndrome,
and decreased NER activity is expected to increase pre-
disposition to cancer and premature aging [2-4]. At the
same time, the increased NER activity characteristic of
cancer cells could reduce effectiveness of a chemother-
apy drug, since mechanism of their action is based on
formation of bulky adducts in DNA [5-7].
In most NER studies, specific excision activity of
the proteins was assessed by direct detection of the
model DNA excision products or by post-excision ra-
dioactive labeling of the 3’-ends of these products
[8-11]. A significant drawback of these methods, lim-
iting their application in the clinic, is the necessity of
using a radioactive label when constructing a model
DNA, or detecting excision products. In this regard,
quantitative polymerase chain reaction (qPCR) meth-
ods are of significant importance for the NER activity
determination invitro. The ability to assess the repair
effectiveness by measuring fluorescence in combi-
nation with simple and fast implementation process
makes qPCR-based methods promising tools for ap-
plication not only for research purposes, but also in
medicine. To date, two variants of the techniques for
NER activity measurement involving the use of qPCR
have been described. They are varying in complexity,
architecture of model DNA, and type of bulky lesions
to be removed (UV damage and DNA–protein crosslink-
ing) [12, 13].
The goal of this work is development of a meth-
od for assessing effectiveness of elimination of bulky
damage in vitro using qPCR and one of the damages
effectively recognized and processed by NER proteins–
polycyclic bulky damage analogue [8, 10, 14]. The de-
veloped approach was used to compare performance
of the NER system in the cells of mammals with dif-
ferent lifespans, a long-lived naked mole-rat (Hetero-
cephalus glaber) and a short-lived mouse (Mus mus-
culus). The results show that the proteins in H. glaber
cells more effectively remove bulky DNA lesions; this is
consistent with the previously published data obtained
by post-excision labeling [14].
MATERIALS AND METHODS
Preparation of DNA substrates. Sequences of
oligodeoxynucleotides (ODNs) used to synthesize DNA
substrates are shown in Table1.
Table 1. Oligodeoxynucleotide and primer sequences used in the study
Name Sequences
Oligodeoxynucleotides
ODN-1 cgatgaagctggtggtcaactggtcctccatgaagcgggtccaagtcggcagtaccggcataacc
ODN-2-nFlu
aagcctatgcctacagcatccaggg(nFlu)gacggtgccgaggatgacgatgagcgca
ODN-2 aagcctatgcctacagcatccagggcgacggtgccgaggatgacgatgagcgca
ODN-3 ttgttagatttcatacacggtgatgctacaagttcgtggcg
ODN-4 gtaggcataggcttggttatgccggtactg
ODN-5 gtatgaaatctaacaatgcgctcatcgtcatcctcg
ODN-6 cgccacgaacttgtagcatcaccgtgtatgaaatctaacaa
ODN-7 tgcgctcatcgtcatcctcggcaccgtcgccctggatgctgtaggcataggctt
ODN-8 ggttatgccggtactgccgacttggacccgcttcatggaggacc(PS-TEG)gttgaccaccagcttcatcg
ODN-9 gacgatgagcgcattgttagatttcatacacgg
ODN-10 taccggcataaccaagcctatgcctaca
ODN-11 agctgctgctcatctcgagatctgagtacattggattgccattctccgagtgtattaccgtgacg
Primers
Primer 1 cgccacgaacttgtagcatc
Primer 2 cgatgaagctggtggtcaa
Note. ODN, oligodeoxynucleotide sequence. Bold: nFlu, N-[6-(5(6)-fluoresceinylcarbamoyl)hexanoyl]-3-amino-1,2-propanediol;
PS-TEG,tetraethylene glycol with a phosphothioate group introduced from the 5’-side.
ASSESSMENT OF NER ACTIVITY BY qPCR 1185
BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024
Fig. 1. Chemical structures of nFlu (a) and TEG (b).
To obtain a DNA strand with non-nucleotide
modification of N-[6-(5(6)-fluoresceinylcarbamoyl)
hexanoyl]-3-amino-1,2-propanediol (nFlu), ODN-1,
ODN-2-nFlu, ODN-3, ODN-4, and ODN-5 were mixed in
an equimolar ratio, then incubated at 95°C for 5 min
and slowly cooled to room temperature. A ligation re-
action mixture, which contained a mixture of hybrid-
ized ODN (10 μM), T4 DNA ligase (2 U/μl; SibEnzyme,
Russia), ATP (10 mM), and 1 × DNA ligase T4 buffer
(50 mM Tris-HCl (pH 7.5); 10 mM MgCl
2
; 10 mM DTT;
1 mM ATP) was incubated for 16-18 h at 12°C. The re-
action was stopped by incubation for 20min at 70°C.
The ligation reaction products were separated using
10% PAGE under denaturing conditions, and the tar-
get single-stranded (ss) DNA was isolated from the
gel by electrotransfer to DEAE paper (Whatman, UK).
Elution of the target ssDNA from the DEAE paper was
carried out at 70°C by four portions (30 μl) of 3 M
aqueous LiClO
4
solution; next DNA was precipitated
with a 5-fold excess of cold acetone and incubated
for 30-40min at –20°C. After centrifugation (10 min,
12,000g, 4°C), the supernatant was removed and the
pellet washed with cold acetone. The precipitate was
then dried at room temperature and dissolved in H
2
O.
Similar procedures were performed for synthesis
of a non-modified strain (ODN-1, ODN-2, ODN-3, ODN-4,
and ODN-5 were used) and a complementary strain
of DNA containing modification on the basis of tetra-
ethylene glycol (TEG) (ODN-6, ODN-7, ODN-8, ODN-9,
and ODN-10 were used). Concentration of the obtained
ssDNA was determined by measuring absorbance of
the solution at 260nm using a U-0080D spectrophotom-
eter (Hitachi High-Technologies, Japan).
To form model DNA duplexes, nFlu- and TEG-con-
taining strands (nFlu/TEG-DNA), as well as non-modi-
fied and TEG-containing strands (nm/TEG-DNA) were
mixed in an equimolar ratio, after which they were
incubated at 95°C for 5min and cooled slowly to room
temperature. Chemical structures of nFlu and TEG are
shown in Fig.1.
Cultivation of the cells. Naked mole-rat (NSF8)
skin fibroblasts were cultured in a αMEM medium
containing fetal calf serum (15% v/v; Thermo Fisher
Scientific, USA), 10% AmnioMAX II Complete Medi-
um (Thermo Fisher Scientific, basic fibroblast growth
factor (bFGF; 5 ng/ml; PanEco, Russia), penicillin
(0.1 U/ml), streptomycin (100 μg/ml), and amphoteri-
cin B (2.5 μg/ml), at 32°C under 5% CO
2
atmosphere.
Mouse embryonic fibroblasts were cultured in a αMEM
medium containing fetal calf serum (15% v/v;), penicil-
lin (0.1 U/ml), streptomycin (100μg/ml), and amphoter-
icin B (2.5 μg/ml) at 37°C under 5% CO
2
. All cell lines
were provided by the IMCB SB RAS (General Biological
Cell Culture Collection; no.0310-2016-0002).
Preparation of NER-competent cell extracts.
The work was carried out according to the protocol
described by Reardon and Sancar [15]. Cells were re-
suspended in four PCVs (packed cell volume, volume
of cells biomass pre-harvested by centrifugation for
10 min at 1000g) of hypotonic lysis buffer (10 mM
Tris-HCl (pH 8.0); 1 mM EDTA; 5 mM DTT) and incu-
bated for 20 min on ice, followed by destruction with
a tight-fitting glass Potter homogenizer (20 pestle
movements). The resulting homogenate in a glass bea-
ker placed in an ice bath was resuspended in 4PCV
of sucrose-glycerol buffer [50 mM Tris-HCl (pH 8.0);
10mM MgCl
2
; 2mM DTT; 25% (m/v) sucrose; 50% (v/v)
glycerol], after which 1PCV of a saturated neutralized
solution of (NH
4
)
2
SO
4
(pH7.0) was gradually added for
over 30min.
After ultracentrifugation (3 h, 100,000g, 4°C), the
supernatant was collected and next finely ground
(NH
4
)
2
SO
4
powder (at a ratio 0.33g/ml) and 1 M NaOH
were added thereto to maintain neutral pH. The re-
sulted solution was stirred for 30 min. The pellet was
collected by centrifugation (45 min, 12,000g, 4°C),
followed by dissolution in an equal volume of
buffer for NER-competent extracts (25 mM Hepes
(pH 7.9); 100 mM KCl; 12 mM MgCl
2
; 0.5 mM EDTA;
2mM DTT; 12% (v/v) glycerol). The resulting solution
POPOV et al.1186
BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024
was dialyzed at 4°C against 500 ml of the same buf-
fer for 2 h, after which the dialysis buffer was re-
placed with the freshly prepared one and dialysis
was carried out for another 14-16 h. A precipitate of
denatured protein was removed by centrifugation
(10 min, 13,400g, 4°C). Aliquots of the resulting cell
extract were frozen in liquid nitrogen and stored
at –70°C.
Determination of protein concentration in cell
extracts. Protein concentration in the extract prepa-
rations was determined with the Quick Start™ Brad-
ford protein assay kit (Bio-Rad Laboratories, USA)
following the provided instructions. BSA was used as
a standard for calibration curve.
Conducting NER reaction. Reaction mixture
for the NER reaction (30μl), which contained 16 nM
DNA substrate, 0.4μg/μl NER competent cell extract,
0.5 mM deoxynucleoside triphosphate (dNTP) mix-
ture, 0.066U/μl Taq DNA polymerase and 0.5 μM oli-
godeoxynucleotide (ODN-11) for protection against nu-
cleases specific for ssDNA regions (Table 1), in buffer
(25 mM Tris-HCl (pH 7.8); 45 mM NaCl; 4.4 mM MgCl
2
;
0.1 mM EDTA; 4 mM ATP) was incubated at 30°C for
30min. The reaction was stopped by heating the re-
action mixture at 65°C for 20 min. An aliquot of the
reaction mixture inactivated after incubation with
the extract proteins (1μl) was diluted in H
2
O (to DNA
concentration of 1×10
–12
 M) and used for RT-qPCR
analysis.
qPCR analysis. PCR reaction mixture (25 μl) con-
tained 1 μl of diluted inactivated NER reaction mixture
and the following components (final concentrations
indicated): 0.3 μM primers 1 and 2 (Table 1); 0.06 U/µl
Taq DNA polymerases with hot start; 0.25 mM dNTP
mixture; 0.5×SYBR Green I dye (Lumiprobe, Rus-
sia); 1×PCR buffer (75 mM Tris-HCl (pH 8.8); 2 mM
(NH
4
)
2
SO
4
, 0.01% Tween 20; 3mM MgCl
2
). Thereaction
was carried out in 96-well plates (white, low-profile
plastic; BIOplastics BV, Netherlands) in a LightCycler
96 amplifier (Roche, Switzerland) using the following
PCR program: 95°C – 5 min, 1 cycle; 95°C – 15 s, 58°C –
15 s, 72°C – 10 s (detection of accumulated signal),
35 cycles; melting PCR products; cooling to 37°C.
Threshold cycle values, or C(t), obtained during
the analysis of amplification curves were used to cal-
culate the difference in dC(t) using the formula(1):
dC(t) = C(t)
nFlu/TEG-DNA
– C(t)
x
, (1)
where C(t)
x
is the value of C(t) for the analyzed sam-
ple; C(t)
nFlu/TEG-DNA
, C(t) value for nFlu/TEG-DNA in the
control sample that was not exposed to cell extract
proteins.
Statistical significance of the differences was de-
termined using Student’s t-test, *p<0.05; **p<0.01;
***p<0.001.
RESULTS AND DISCUSSION
We developed a qPCR-based method for assessing
efficacy of the invitro bulky lesion removal, which in-
volves using an extended (160bp) linear DNA duplex
containing one modified link in each of the strands
and NER-competent cell extracts as a substrate (Fig. 2).
Bulky modification of nFlu is easily recognized
and removed from DNA by the proteins of the NER
system [8, 10, 14]. The non-bulky modification based
on TEG is an analogue of the apurine/apyrimidine site
and is supposed to be subjected to the action of the
proteins of the base excision repair (BER) system, how-
ever, the phosphothioate group, introduced from the
5′-side of TEG and resistant to nucleases [16], blocks
the TEG processing by the endogenous AP endonucle-
ase of extracts. Presence of these modifications in the
strands of the DNA substrate prevents elongation of
the primers 1 and 2 catalyzed by Taq DNA polymerase
during PCR (Fig. 2). Removal of the DNA fragment con-
taining nFlu by the proteins of the NER system should
facilitate repair of one DNA strand, thereby this strand
can be copied during elongation of the primer1. This
copy of DNA without modifications becomes a full-
fledged template that is amplified during subsequent
PCR cycles without difficulty.
During development of the method, we construct-
ed and used two types of model DNA. The nFlu/TEG-
DNA model contains both modifications and is a sub-
strate for the NER system (Fig. 2). Relative position
of nFlu and TEG in this DNA model ensures that the
presence of TEG does not affect the ability of nFlu to
undergo a specific excision reaction catalyzed by NER
proteins [11]. The nm/TEG-DNA model containing only
TEG simulates the repair product of the DNA substrate
strand containing bulky damage (Fig. 2).
Using the synthesized templates and SYBR GreenI
as a fluorescent dye, PCR was performed to evaluate
amplification conditions. PCR efficiency was calcu-
lated based on the calibration curve data, for which
nm/TEG-DNA was used in the concentration range
from 4 × 10
–11
to 4 × 10
–15
 M (Fig.3,a-c).
To evaluate amplification of the model nFlu/TEG-
DNA and nm/TEG-DNA, we chose DNA concentration
of 4 × 10
–12
 M. The results of comparative evaluation of
the nFlu/TEG-DNA and nm/TEG-DNA amplification con-
firmed the possibility of using the DNA substrate de-
signed in this study (Fig. 3g). Threshold cycle values C(t)
for the nm/TEG and nFlu/TEG-DNA were 12.12 ± 0.29
and 19.28 ± 0.52 cycles, respectively (Fig. 3e); difference
in the threshold cycle values between the nFlu/TEG-
and nm/TEG-DNA (dC(t)) was 7.17 ± 0.43 cycles. Thus,
the substrate and specific excision reaction product
are distinguishable during PCR.
One possible reason for amplification of the
nFlu/TEG-DNA may be presence in the synthesized
ASSESSMENT OF NER ACTIVITY BY qPCR 1187
BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024
Fig. 2. Schematic representation of the proposed approach for evaluating removal of bulky lesions invitro by qPCR.
preparation of an admixture of DNA containing a
strand without modification (nm/TEG-DNA). Never-
theless, when analyzing melting curves of the nFlu/
TEG-DNA and nm/TEG-DNA amplification products, we
observed difference in the peaks of the PCR product
melting curves and, as a result, revealed a slight dif-
ference in their melting points(Tm)– 90.37 ± 0.11°C for
the nFlu/TEG-DNA and 90.99 ± 0.03°C for the nm/TEG-
DNA, respectively (Fig.3e). It could be suggested based
on these data that the nucleotide sequences of the nFlu/
TEG-DNA and nm/TEG-DNA amplification products are
slightly different. It may be caused by the tendency of
Taq DNA polymerase to translesion synthesis, when
the enzyme could insert (although with low probabil-
ity) a random nucleotide in the strand (preferably de-
oxyadenosine) opposite to the bulky DNA modification
during the elongation stage [17-20].
Using the designed nFlu/TEG-DNA substrate, we
evaluated efficiency of the in vitro removal of bulky
DNA damage using proteins from the cells of long-
lived naked mole-rat (H. glaber) and short-lived mouse
(M. musculus) with the help of qPCR. To date, H. glaber
cells are known to show high resistance to genotox-
ic effects, oncotransformation, and cellular aging,
which is largely ensured by the effective functioning
of cellular systems for maintaining genome stability
[21-24]. Comparative assessment of the NER activity in
H. glaber and M. musculus cells was previously car-
ried out using the method of post-excision labeling of
specific excision products [14]. The results of control
experiments conducted in this study showed that ef-
ficiency of excision of the damaged DNA fragment
containing nFlu from the model DNA duplex (137bp)
by the H. glaber cell extract proteins was 1.5-2 times
higher compared to the efficiency exhibited by the
proteins from M. musculus cells [14]. In this study we
intended to compare the results obtained with the de-
veloped method with the data reported in our previ-
ous study by Evdokimov etal. [14]. For this purpose,
similar preparations of H. glaber and M. musculus cell
extracts were used as model systems. We also made
some changes to adapt the NER response protocol to
subsequent qPCR detection.
For PCR, not only the stage of specific excision of
bulky damage is critical, but also the stage of the native
strand structure repair (Fig. 2). Being model systems
for invitro determination of NER activity, the extracts
of NER-competent cell derived from the cells or tissues
of various types may differ in the content of compo-
nents necessary for filling a single-strand gap. This fact
may affect significantly the results of assessment of
the NER excision activity using cell extracts. Tooffset
these effects, we added Taq DNA polymerase and dNTP
mixture to the reaction mixture for conducting NER.
POPOV et al.1188
BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024
Fig. 3. Analysis of nFlu/TEG and nm/TEG DNA amplification results. Standard amplification curves for nm/TEG-DNA(a), cali-
bration plot(b), and results of calculation of the nm/TEG-DNA amplification efficiency(c) are presented. d)Example of nm/TEG
and nFlu/TEG-DNA amplification curves; e)average C(t) values and standard deviation of nm/TEG and nFlu/TEG-DNA based
on three measurements; f)melting curves of nm/TEG and nFlu/TEG-DNA.
Using the developed protocol, we compared de-
pendencies of the nFlu/TEG-DNA repair efficiency on
incubation time for the H. glaber and M. musculus cell
extract proteins (Fig.4, a and b).
Efficiency of the nFlu/TEG-DNA repair was calculat-
ed based on the obtained mean dC(t) values converted
to percentages. When calculating, the difference in C(t)
for nFlu/TEG and nm/TEG-DNA obtained in the control
experiments conducted without incubation of the mod-
el DNA with the extract proteins was taken as 100%.
ThenFlu/TEG-DNA repair efficiency was higher over the
entire incubation interval with the H. glaber cell extract
proteins (Fig. 4c) and after 30 min was 55.67 ± 0.42%,
while after incubation with the M. musculus cell ex-
tract proteins the repair efficiency was significantly
lower and was 35.17 ± 1.42% (Fig. 4d). Incubation of
the nm/TEG-DNA with the proteins of cell extract for
30min did not lead to a noticeable change in C(t) val-
ues. This fact indicates absence of the significant effect
of non-specific exposure to the cell extract proteins in
both cases. The H. glaber cell extract proteins were al-
most 1.5-fold more effective at removing nFlu bulky
damage from the model DNA substrate than the M. mus-
culus cell extract proteins. These data are consistent
with the results of control experiments performed ear-
lier using similar cell extract preparations by post-exci-
sion labeling of excision products [14]. Similarity of the
Tm values and peak positions of the amplification prod-
uct melting curves, which we observed for the nFlu/
TEG-DNA processed by the extract proteins and the
control nm/TEG-DNA (90.98 ± 0.04°C and 91.00 ± 0.06°C,
respectively), further confirms the fact of removal of
the bulky damage from DNA and repair of its correct
nucleotide sequence in the process(Fig.4d).
Despite the fact that the skin fibroblasts of the
long-lived H. glaber and embryonic fibroblasts of the
ASSESSMENT OF NER ACTIVITY BY qPCR 1189
BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024
Fig. 4. Comparative evaluation of nFlu/TEG-DNA repair efficiency by Heterocephalus glaber and Musmusculus cell extract
proteins with qPCR. nm/TEG-DNA amplification curves (violet), nFlu/TEG-DNA (green) and nFlu/TEG-DNA after 30min incuba-
tion with extract proteins (dark green) obtained for H. glaber(a) and M. musculus(b); c)comparison of nFlu/TEG-DNA repair
efficiency by NER proteins of H. glaber (blue) and M. musculus (red) cell extracts, depending on incubation time; d)difference
in the nFlu/TEG DNA repair efficiency between H. glaber (blue) and M.musculus (red) cell extracts after 30min of incubation;
e)evaluation of the effect of H. glaber and M. musculus cell extract proteins on nm/TEG-DNA without bulky damage after
30min incubation; f)example of melting curves showing nm/TEG-DNA (violet), nFlu/TEG-DNA (green), and nFlu/TEG-DNA
amplification products after 30min incubation with NER (dark green) proteins of M.musculus cell extract. Results are present-
ed as a mean of three biological replicates with standard deviation, ***p<0.001.
short-lived M. musculus used to test the developed
method are different in nature, which may somewhat
reduce the observed difference between the efficiency
of bulky lesion removal by the proteins of these mam-
malian extracts, comparison of the results of post-exci-
sional labeling with the qPCR results indicates that the
removal of bulky damage by the NER system is indeed
more effective in H. glaber cells. This is consistent with
the current notions about the significant contribution
of DNA repair systems in ensuring high genome sta-
bility of the H. glaber, which lives under constant ox-
idative stress [25-27]. Apparently, other DNA repair
systems, such as BER, high activity of which was also
noted in H. glaber cells, may play an important role
in the effective removal of bulky damage in H. glaber
cells [14, 27]. Possible participation of BER proteins,
as well as some other systems in the repair of UV-in-
duced damage has recently been demonstrated in the
experiments with human cells deficient in XPA, one
of the main protein factors involved in the NER pro-
cess [28, 29]. Thus, the developed method is promis-
ing for further use in research aimed both at study-
ing DNA repair in the cells of long-lived mammals
and also at finding functional relationship of various
DNA repair systems involved in the removal of bulky
lesions.
POPOV et al.1190
BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024
CONCLUSION
The method we developed made it possible to
evaluate efficiency of removing bulky DNA damage
invitro using extracts of the cells of long-lived H. glaber
and short-lived M. musculus. Proteins of the H. glaber
cell extract facilitated more effective recognition and
removal of nFlu bulky damage from the model DNA
substrate compared to the M. musculus cell extract
proteins, which is consistent with the data published
previously [14]. Hence, a simple and fast procedure for
performing the developed method based on the use of
qPCR analysis could promote its further widespread
use both in basic research on the DNA repair processes
and for timely assessment of the status of DNA repair
systems of the patients in clinical practice.
Contributions. I.O.P. and O.I.L. supervised the
study; A.A.P., V.A.Sh., and I.O.P. conducted experiments;
A.A.P., I.O.P., A.N.E., and O.I.L. prepared and edited the
manuscript.
Funding. This work was financially supported
by the Russian Science Foundation (project no.19-74-
10056-P).
Ethics declaration. This work does not describe
any studies involving humans or animals as objects
performed by any of the authors. The authors of this
work declare that they have no conflicts of interest.
Open access. This article is licensed under a Cre-
ative Commons Attribution 4.0 International License,
which permits use, sharing, adaptation, distribution,
and reproduction in any medium or format, as long
as you give appropriate credit to the original author(s)
and the source, provide a link to the Creative Commons
license, and indicate if changes were made. Theimages
or other third-party material in this article are includ-
ed in the article’s Creative Commons license, unless
indicated otherwise in a credit line to the material.
Ifmaterial is not included in the article’s Creative Com-
mons license and your intended use is not permitted
by statutory regulation or exceeds the permitted use,
you will need to obtain permission directly from the
copyright holder. To view a copy of this license, visit
http://creativecommons.org/licenses/by/4.0/.
REFERENCES
1. Chatterjee,N., and Walker, G. C. (2017) Mechanisms
of DNA damage, repair, and mutagenesis, Environ.
Mol. Mutagen., 58, 235-263, https://doi.org/10.1002/
em.22087.
2. Krasikova,Y., Rechkunova, N., and Lavrik, O. (2021)
Nucleotide excision repair: from molecular defects to
neurological abnormalities, Int.J. Mol. Sci., 22, 6220,
https://doi.org/10.3390/ijms22126220.
3. Paccosi, E., Balajee, A. S., and Proietti-De-Santis, L.
(2022) A matter of delicate balance: loss and gain of
Cockayne syndrome proteins in premature aging and
cancer, Front. Aging, 3, 960662, https://doi.org/10.3389/
fragi.2022.960662.
4. Yurchenko, A.A., Rajabi,F., Braz-Petta,T., Fassihi,H.,
Lehmann, A., Nishigori, C., Wang, J., Padioleau, I.,
Gunbin,K., Panunzi,L., Morice-Picard,F., Laplante,P.,
Robert, C., Kannouche, P. L., Menck, C. F. M., Sara-
sin,A., and Nikolaev, S. I. (2023) Genomic mutation
landscape of skin cancers from DNA repair-deficient
xeroderma pigmentosum patients, Nat. Commun., 14,
2561, https://doi.org/10.1038/s41467-023-38311-0.
5. Kap, E. J., Popanda, O., and Chang-Claude, J. (2016)
Nucleotide excision repair and response and survival
to chemotherapy in colorectal cancer patients, Phar-
macogenomics, 17, 755-794, https://doi.org/10.2217/
pgs-2015-0017.
6. Bowden, N.A. (2014) Nucleotide excision repair: why
is it not used to predict response to platinum-based
chemotherapy? Cancer Lett., 346, 163-171, https://
doi.org/10.1016/j.canlet.2014.01.005.
7. Kiwerska, K., and Szyfter, K. (2019) DNA repair in
cancer initiation, progression, and therapy-a dou-
ble-edged sword, J.Appl. Genet., 60, 329-334, https://
doi.org/10.1007/s13353-019-00516-9.
8. Evdokimov,A., Petruseva,I., Tsidulko,A., Koroleva,L.,
Serpokrylova, I., Silnikov, V., and Lavrik, O. (2013)
New synthetic substrates of mammalian nucleotide
excision repair system, Nucleic Acids Res., 41, e123,
https://doi.org/10.1093/nar/gkt301.
9. Liu,Z., Ding,S., Kropachev,K., Lei,J., Amin,S., Broy-
de,S., and Geacintov, N.E. (2015) Resistance to nucle-
otide excision repair of bulky guanine adducts oppo-
site abasic sites in DNA duplexes and relationships be-
tween structure and function, PLoS One, 10, e0142068,
https://doi.org/10.1371/journal.pone.0137124.
10. Lukyanchikova, N. V., Petruseva, I. O., Evdokimov,
A. N., Silnikov, V. N., and Lavrik, O. I. (2016) DNA
with damage in both strands as affinity probes and
nucleotide excision repair substrates, Biochemis-
try (Moscow), 81, 263-274, https://doi.org/10.1134/
S0006297916030093.
11. Naumenko, N., Petruseva, I., Lomzov, A., and Lavr-
ik, O. (2021) Recognition and removal of clustered
DNA lesions via nucleotide excision repair, DNA
Repair (Amst), 108, 103225, https://doi.org/10.1016/
j.dnarep.2021.103225.
12. Chesner, L. N., and Campbell, C. (2018) A quantita-
tive PCR-based assay reveals that nucleotide excision
repair plays a predominant role in the removal of
DNA-protein crosslinks from plasmids transfected
into mammalian cells, DNA Repair (Amst), 62, 18-27,
https://doi.org/10.1016/j.dnarep.2018.01.004.
13. Shen, J.C., Fox, E.J., Ahn, E.H., and Loeb, L.A. (2014)
A rapid assay for measuring nucleotide excision
ASSESSMENT OF NER ACTIVITY BY qPCR 1191
BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024
repair by oligonucleotide retrieval, Sci. Rep., 4, 4894,
https://doi.org/10.1038/srep04894.
14. Evdokimov,A., Kutuzov,M., Petruseva,I., Lukjanchi-
kova, N., Kashina, E., Kolova, E., Zemerova, T., Ro-
manenko, S., Perelman, P., Prokopov, D., Seluan-
ov, A., Gorbunova,V., Graphodatsky,A., Trifonov,V.,
Khodyreva, S., and Lavrik, O. (2018) Naked mole
rat cells display more efficient excision repair than
mouse cells, Aging (Albany NY), 10, 1454-1473, https://
doi.org/10.18632/aging.101482.
15. Reardon, J. T., and Sancar, A. (2006) Purification
and characterization of Escherichia coli and human
nucleotide excision repair enzyme systems, Meth-
ods Enzymol., 408, 189-213, https://doi.org/10.1016/
S0076-6879(06)08012-8.
16. Clavé,G., Reverte,M., Vasseur, J.J., and Smietana,M.
(2020) Modified internucleoside linkages for nu-
clease-resistant oligonucleotides, RSC Chem. Biol.,
2, 94-150, https://doi.org/10.1039/d0cb00136h.
17. Smith, C.A., Baeten,J., and Taylor, J.S. (1998) Theabil-
ity of a variety of polymerases to synthesize past
site-specific cis-syn, trans-syn-II, (6-4), and Dewar
photoproducts of thymidylyl-(3′→5′)-thymidine, J.Biol.
Chem., 273, 21933-21940, https://doi.org/10.1074/
jbc.273.34.21933.
18. Taylor, J.S. (2002) New structural and mechanistic in-
sight into the A-rule and the instructional and non-in-
structional behavior of DNA photoproducts and other
lesions, Mutat. Res., 510, 55-70, https://doi.org/10.1016/
s0027-5107(02)00252-x.
19. Khare,V., and Eckert, K.A. (2002) The proofreading
3′→5′ exonuclease activity of DNA polymerases: a ki-
netic barrier to translesion DNA synthesis, Mutat.
Res., 510, 45-54, https://doi.org/10.1016/s0027-5107
(02)00251-8.
20. Obeid, S., Schnur, A., Gloeckner, C., Blatter, N., Wel-
te, W., Diederichs, K., and Marx,A. (2011) Learning
from directed evolution: Thermus aquaticus DNA poly-
merase mutants with translesion synthesis activity,
Chembiochem., 12, 1574-1580, https://doi.org/10.1002/
cbic.201000783.
21. Evdokimov,A., Popov,A., Ryabchikova,E., Koval,O.,
Romanenko, S., Trifonov, V., Petruseva, I., Lavr-
ik, I., and Lavrik, O. (2021) Uncovering molecular
mechanisms of regulated cell death in the naked
mole rat, Aging (Albany NY), 13, 3239-3253, https://
doi.org/10.18632/aging.202577.
22. Yamamura, Y., Kawamura, Y., Oka, K., and Miu-
ra, K. (2022) Carcinogenesis resistance in the lon-
gest-lived rodent, the naked mole-rat, Cancer Sci., 113,
4030-4036, https://doi.org/10.1111/cas.15570.
23. Boughey, H., Jurga, M., and El-Khamisy, S. F. (2021)
DNA homeostasis and senescence: lessons from the
naked mole rat, Int. J. Mol. Sci., 22, 6011, https://
doi.org/10.3390/ijms22116011.
24. Hadj-Moussa,H., Eaton,L., Cheng,H., Pamenter, M.E.,
and Storey, K. B. (2022) Naked mole-rats resist the
accumulation of hypoxia-induced oxidative damage,
Comp. Biochem. Physiol. A Mol. Integr. Physiol., 273,
111282, https://doi.org/10.1016/j.cbpa.2022.111282.
25. Buffenstein, R. (2005) The naked mole-rat: a new
long-living model for human aging research, J.Geron-
tol. A Biol. Sci. Med. Sci., 60, 1369-1377, https://
doi.org/10.1093/gerona/60.11.1369.
26. Gorbunova,V., Seluanov,A., Zhang,Z., Gladyshev, V.N.,
and Vijg,J. (2014) Comparative genetics of longevity
and cancer: insights from long-lived rodents, Nat. Rev.
Genet., 15, 531-540, https://doi.org/10.1038/nrg3728.
27. MacRae, S.L., Croken, M.M., Calder, R.B., Aliper,A.,
Milholland,B., White, R. R., Zhavoronkov,A., Glady-
shev, V.N., Seluanov,A., Gorbunova,V., Zhang, Z.D.,
and Vijg,J. (2015) DNA repair in species with extreme
lifespan differences, Aging (Albany NY), 7, 1171-1184,
https://doi.org/10.18632/aging.100866.
28. Gautam,A., Fawcett,H., Burdova,K., Brazina,J., and
Caldecott, K. W. (2023) APE1-dependent base exci-
sion repair of DNA photodimers in human cells,
Mol. Cell, 83, 3669-3678.e7, https://doi.org/10.1016/
j.molcel.2023.09.013.
29. Saha, L. K., Wakasugi, M., Akter, S., Prasad, R., Wil-
son, S. H., Shimizu, N., Sasanuma, H., Huang, S. N.,
Agama, K., Pommier, Y., Matsunaga, T., Hirota, K.,
Iwai,S., Nakazawa,Y., Ogi, T., and Takeda, S. (2020)
Topoisomerase I-driven repair of UV-induced damage
in NER-deficient cells, Proc. Natl. Acad. Sci. USA, 117,
14412-14420, https://doi.org/10.1073/pnas.1920165117.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in pub-
lished maps and institutional affiliations.