Article

ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 7, pp. 1183-1191 © The Author(s) 2024. This article is an open access publication.

1183

Use of qPCR to Evaluate Efficiency

of the Bulky DNA Damage Removal in Extracts

of Mammalian Cells with Different Maximum Lifespan

Aleksei A. Popov

, Vladimir A. Shamanin

, Irina O. Petruseva

Aleksei N. Evdokimov

, and Olga I. Lavrik

1,3,a

Institute of Chemical Biology and Fundamental Medicine, Siberian Branch Russian Academy of Sciences,

630090 Novosibirsk, Russia

LLC “BioLink”, 630090 Novosibirsk, Russia

Novosibirsk National Research State University, 630090 Novosibirsk, Russia

e-mail: lavrik@niboch.nsc.ru

Received March 1, 2024

Revised April 18, 2024

Accepted April 28, 2024

Abstract— Proteins of nucleotide excision repair system (NER) are responsible for detecting and removing awide

range of bulky DNA damages, thereby contributing significantly to the genome stability maintenance within

mammalian cells. Evaluation of NER functional status in the cells is important for identifying pathological chang-

es in the body and assessing effectiveness of chemotherapy. The following method, described herein, has been

developed for better assessment of bulky DNA damages removal invitro, based on qPCR. Using the developed

method, NER activity was compared for the extracts of the cells from two mammals with different lifespans:

along-lived naked mole-rat (Heterocephalus glaber) and a short-lived mouse (Musmusculus). Proteins of the

H. glaber cell extract have been shown to be 1.5 times more effective at removing bulky damage from the model

DNA substrate than the proteins of the M. musculus cell extract. These results are consistent with the experimen-

tal data previously obtained. The presented method could be applied not only in fundamental studies of DNA

repair in mammalian cells, but also in clinical practice.

DOI: 10.1134/S0006297924070022

Keywords: DNA repair, PCR, longevity

Abbreviations: BER, base excision repair; ODN,oligodeoxynucleotides; NER,nucleotide excision repair; nFlu,N-[6-(5(6)-

fluoresceinylcarbamoyl)hexanoyl]-3-amino-1,2-propanediol; TEG,tetraethylene glycol.

* To whom correspondence should be addressed.

INTRODUCTION

DNA repair systems ensure maintenance of ge-

nome stability in the cells of a living organism, remov-

al of the recurring damages induced by exogenous and

endogenous factors, and repair the DNA structure[1].

Nucleotide excision repair (NER) proteins remove a

wide range of bulky DNA lesions, including adducts

formed by UV light and harmful polycyclic compounds

from the environment. Such adducts cause significant

disruptions in the regular double-stranded DNA struc-

ture, which are recognized by the XPC factor, which,

inturn, induces recruitment of TFIIH and subsequent

repair complex assembly at the damaged DNA region.

After lesion verification by XPD helicase, excision of

the DNA fragment containing bulky damage catalyzed

by the XPF-ERCC1 and XPG endonucleases occurs.

Theresulting gap is filled in by synthesis using an in-

tact DNA strand as a template and subsequent ligation;

asaresult, the original DNA structure is restored [1].

Since activity of the DNA repair systems deter-

mines resistance of the cells to genotoxic stress effects,

functional status assessment of a particular DNA re-

pair system in the cells is crucial in clinical practice

POPOV et al.1184

BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024

and is conducted to diagnose various pathological

patterns. NER disruption is the cause of diseases such

as Xeroderma pigmentosum and Cockayne syndrome,

and decreased NER activity is expected to increase pre-

disposition to cancer and premature aging [2-4]. At the

same time, the increased NER activity characteristic of

cancer cells could reduce effectiveness of a chemother-

apy drug, since mechanism of their action is based on

formation of bulky adducts in DNA [5-7].

In most NER studies, specific excision activity of

the proteins was assessed by direct detection of the

model DNA excision products or by post-excision ra-

dioactive labeling of the 3’-ends of these products

[8-11]. A significant drawback of these methods, lim-

iting their application in the clinic, is the necessity of

using a radioactive label when constructing a model

DNA, or detecting excision products. In this regard,

quantitative polymerase chain reaction (qPCR) meth-

ods are of significant importance for the NER activity

determination invitro. The ability to assess the repair

effectiveness by measuring fluorescence in combi-

nation with simple and fast implementation process

makes qPCR-based methods promising tools for ap-

plication not only for research purposes, but also in

medicine. To date, two variants of the techniques for

NER activity measurement involving the use of qPCR

have been described. They are varying in complexity,

architecture of model DNA, and type of bulky lesions

to be removed (UV damage and DNA–protein crosslink-

ing) [12, 13].

The goal of this work is development of a meth-

od for assessing effectiveness of elimination of bulky

damage in vitro using qPCR and one of the damages

effectively recognized and processed by NER proteins–

polycyclic bulky damage analogue [8, 10, 14]. The de-

veloped approach was used to compare performance

of the NER system in the cells of mammals with dif-

ferent lifespans, a long-lived naked mole-rat (Hetero-

cephalus glaber) and a short-lived mouse (Mus mus-

culus). The results show that the proteins in H. glaber

cells more effectively remove bulky DNA lesions; this is

consistent with the previously published data obtained

by post-excision labeling [14].

MATERIALS AND METHODS

Preparation of DNA substrates. Sequences of

oligodeoxynucleotides (ODNs) used to synthesize DNA

substrates are shown in Table1.

Table 1. Oligodeoxynucleotide and primer sequences used in the study

Name Sequences

Oligodeoxynucleotides

ODN-1 cgatgaagctggtggtcaactggtcctccatgaagcgggtccaagtcggcagtaccggcataacc

ODN-2-nFlu

aagcctatgcctacagcatccaggg(nFlu)gacggtgccgaggatgacgatgagcgca

ODN-2 aagcctatgcctacagcatccagggcgacggtgccgaggatgacgatgagcgca

ODN-3 ttgttagatttcatacacggtgatgctacaagttcgtggcg

ODN-4 gtaggcataggcttggttatgccggtactg

ODN-5 gtatgaaatctaacaatgcgctcatcgtcatcctcg

ODN-6 cgccacgaacttgtagcatcaccgtgtatgaaatctaacaa

ODN-7 tgcgctcatcgtcatcctcggcaccgtcgccctggatgctgtaggcataggctt

ODN-8 ggttatgccggtactgccgacttggacccgcttcatggaggacc(PS-TEG)gttgaccaccagcttcatcg

ODN-9 gacgatgagcgcattgttagatttcatacacgg

ODN-10 taccggcataaccaagcctatgcctaca

ODN-11 agctgctgctcatctcgagatctgagtacattggattgccattctccgagtgtattaccgtgacg

Primers

Primer 1 cgccacgaacttgtagcatc

Primer 2 cgatgaagctggtggtcaa

Note. ODN, oligodeoxynucleotide sequence. Bold: nFlu, N-[6-(5(6)-fluoresceinylcarbamoyl)hexanoyl]-3-amino-1,2-propanediol;

PS-TEG,tetraethylene glycol with a phosphothioate group introduced from the 5’-side.

ASSESSMENT OF NER ACTIVITY BY qPCR 1185

BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024

Fig. 1. Chemical structures of nFlu (a) and TEG (b).

To obtain a DNA strand with non-nucleotide

modification of N-[6-(5(6)-fluoresceinylcarbamoyl)

hexanoyl]-3-amino-1,2-propanediol (nFlu), ODN-1,

ODN-2-nFlu, ODN-3, ODN-4, and ODN-5 were mixed in

an equimolar ratio, then incubated at 95°C for 5 min

and slowly cooled to room temperature. A ligation re-

action mixture, which contained a mixture of hybrid-

ized ODN (10 μM), T4 DNA ligase (2 U/μl; SibEnzyme,

Russia), ATP (10 mM), and 1 × DNA ligase T4 buffer

(50 mM Tris-HCl (pH 7.5); 10 mM MgCl

; 10 mM DTT;

1 mM ATP) was incubated for 16-18 h at 12°C. The re-

action was stopped by incubation for 20min at 70°C.

The ligation reaction products were separated using

10% PAGE under denaturing conditions, and the tar-

get single-stranded (ss) DNA was isolated from the

gel by electrotransfer to DEAE paper (Whatman, UK).

Elution of the target ssDNA from the DEAE paper was

carried out at 70°C by four portions (30 μl) of 3 M

aqueous LiClO

solution; next DNA was precipitated

with a 5-fold excess of cold acetone and incubated

for 30-40min at –20°C. After centrifugation (10 min,

12,000g, 4°C), the supernatant was removed and the

pellet washed with cold acetone. The precipitate was

then dried at room temperature and dissolved in H

Similar procedures were performed for synthesis

of a non-modified strain (ODN-1, ODN-2, ODN-3, ODN-4,

and ODN-5 were used) and a complementary strain

of DNA containing modification on the basis of tetra-

ethylene glycol (TEG) (ODN-6, ODN-7, ODN-8, ODN-9,

and ODN-10 were used). Concentration of the obtained

ssDNA was determined by measuring absorbance of

the solution at 260nm using a U-0080D spectrophotom-

eter (Hitachi High-Technologies, Japan).

To form model DNA duplexes, nFlu- and TEG-con-

taining strands (nFlu/TEG-DNA), as well as non-modi-

fied and TEG-containing strands (nm/TEG-DNA) were

mixed in an equimolar ratio, after which they were

incubated at 95°C for 5min and cooled slowly to room

temperature. Chemical structures of nFlu and TEG are

shown in Fig.1.

Cultivation of the cells. Naked mole-rat (NSF8)

skin fibroblasts were cultured in a αMEM medium

containing fetal calf serum (15% v/v; Thermo Fisher

Scientific, USA), 10% AmnioMAX II Complete Medi-

um (Thermo Fisher Scientific, basic fibroblast growth

factor (bFGF; 5 ng/ml; PanEco, Russia), penicillin

(0.1 U/ml), streptomycin (100 μg/ml), and amphoteri-

cin B (2.5 μg/ml), at 32°C under 5% CO

atmosphere.

Mouse embryonic fibroblasts were cultured in a αMEM

medium containing fetal calf serum (15% v/v;), penicil-

lin (0.1 U/ml), streptomycin (100μg/ml), and amphoter-

icin B (2.5 μg/ml) at 37°C under 5% CO

. All cell lines

were provided by the IMCB SB RAS (General Biological

Cell Culture Collection; no.0310-2016-0002).

Preparation of NER-competent cell extracts.

The work was carried out according to the protocol

described by Reardon and Sancar [15]. Cells were re-

suspended in four PCVs (packed cell volume, volume

of cells biomass pre-harvested by centrifugation for

10 min at 1000g) of hypotonic lysis buffer (10 mM

Tris-HCl (pH 8.0); 1 mM EDTA; 5 mM DTT) and incu-

bated for 20 min on ice, followed by destruction with

a tight-fitting glass Potter homogenizer (20 pestle

movements). The resulting homogenate in a glass bea-

ker placed in an ice bath was resuspended in 4PCV

of sucrose-glycerol buffer [50 mM Tris-HCl (pH 8.0);

10mM MgCl

; 2mM DTT; 25% (m/v) sucrose; 50% (v/v)

glycerol], after which 1PCV of a saturated neutralized

solution of (NH

)

(pH7.0) was gradually added for

over 30min.

After ultracentrifugation (3 h, 100,000g, 4°C), the

supernatant was collected and next finely ground

(NH

)

powder (at a ratio 0.33g/ml) and 1 M NaOH

were added thereto to maintain neutral pH. The re-

sulted solution was stirred for 30 min. The pellet was

collected by centrifugation (45 min, 12,000g, 4°C),

followed by dissolution in an equal volume of

buffer for NER-competent extracts (25 mM Hepes

(pH 7.9); 100 mM KCl; 12 mM MgCl

; 0.5 mM EDTA;

2mM DTT; 12% (v/v) glycerol). The resulting solution

POPOV et al.1186

BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024

was dialyzed at 4°C against 500 ml of the same buf-

fer for 2 h, after which the dialysis buffer was re-

placed with the freshly prepared one and dialysis

was carried out for another 14-16 h. A precipitate of

denatured protein was removed by centrifugation

(10 min, 13,400g, 4°C). Aliquots of the resulting cell

extract were frozen in liquid nitrogen and stored

at –70°C.

Determination of protein concentration in cell

extracts. Protein concentration in the extract prepa-

rations was determined with the Quick Start™ Brad-

ford protein assay kit (Bio-Rad Laboratories, USA)

following the provided instructions. BSA was used as

a standard for calibration curve.

Conducting NER reaction. Reaction mixture

for the NER reaction (30μl), which contained 16 nM

DNA substrate, 0.4μg/μl NER competent cell extract,

0.5 mM deoxynucleoside triphosphate (dNTP) mix-

ture, 0.066U/μl Taq DNA polymerase and 0.5 μM oli-

godeoxynucleotide (ODN-11) for protection against nu-

cleases specific for ssDNA regions (Table 1), in buffer

(25 mM Tris-HCl (pH 7.8); 45 mM NaCl; 4.4 mM MgCl

;

0.1 mM EDTA; 4 mM ATP) was incubated at 30°C for

30min. The reaction was stopped by heating the re-

action mixture at 65°C for 20 min. An aliquot of the

reaction mixture inactivated after incubation with

the extract proteins (1μl) was diluted in H

O (to DNA

concentration of 1×10

–12

 M) and used for RT-qPCR

analysis.

qPCR analysis. PCR reaction mixture (25 μl) con-

tained 1 μl of diluted inactivated NER reaction mixture

and the following components (final concentrations

indicated): 0.3 μM primers 1 and 2 (Table 1); 0.06 U/µl

Taq DNA polymerases with hot start; 0.25 mM dNTP

mixture; 0.5×SYBR Green I dye (Lumiprobe, Rus-

sia); 1×PCR buffer (75 mM Tris-HCl (pH 8.8); 2 mM

(NH

)

, 0.01% Tween 20; 3mM MgCl

). Thereaction

was carried out in 96-well plates (white, low-profile

plastic; BIOplastics BV, Netherlands) in a LightCycler

96 amplifier (Roche, Switzerland) using the following

PCR program: 95°C – 5 min, 1 cycle; 95°C – 15 s, 58°C –

15 s, 72°C – 10 s (detection of accumulated signal),

35 cycles; melting PCR products; cooling to 37°C.

Threshold cycle values, or C(t), obtained during

the analysis of amplification curves were used to cal-

culate the difference in dC(t) using the formula(1):

dC(t) = C(t)

nFlu/TEG-DNA

– C(t)

, (1)

where C(t)

is the value of C(t) for the analyzed sam-

ple; C(t)

nFlu/TEG-DNA

, C(t) value for nFlu/TEG-DNA in the

control sample that was not exposed to cell extract

proteins.

Statistical significance of the differences was de-

termined using Student’s t-test, *p<0.05; **p<0.01;

***p<0.001.

RESULTS AND DISCUSSION

We developed a qPCR-based method for assessing

efficacy of the invitro bulky lesion removal, which in-

volves using an extended (160bp) linear DNA duplex

containing one modified link in each of the strands

and NER-competent cell extracts as a substrate (Fig. 2).

Bulky modification of nFlu is easily recognized

and removed from DNA by the proteins of the NER

system [8, 10, 14]. The non-bulky modification based

on TEG is an analogue of the apurine/apyrimidine site

and is supposed to be subjected to the action of the

proteins of the base excision repair (BER) system, how-

ever, the phosphothioate group, introduced from the

5′-side of TEG and resistant to nucleases [16], blocks

the TEG processing by the endogenous AP endonucle-

ase of extracts. Presence of these modifications in the

strands of the DNA substrate prevents elongation of

the primers 1 and 2 catalyzed by Taq DNA polymerase

during PCR (Fig. 2). Removal of the DNA fragment con-

taining nFlu by the proteins of the NER system should

facilitate repair of one DNA strand, thereby this strand

can be copied during elongation of the primer1. This

copy of DNA without modifications becomes a full-

fledged template that is amplified during subsequent

PCR cycles without difficulty.

During development of the method, we construct-

ed and used two types of model DNA. The nFlu/TEG-

DNA model contains both modifications and is a sub-

strate for the NER system (Fig. 2). Relative position

of nFlu and TEG in this DNA model ensures that the

presence of TEG does not affect the ability of nFlu to

undergo a specific excision reaction catalyzed by NER

proteins [11]. The nm/TEG-DNA model containing only

TEG simulates the repair product of the DNA substrate

strand containing bulky damage (Fig. 2).

Using the synthesized templates and SYBR GreenI

as a fluorescent dye, PCR was performed to evaluate

amplification conditions. PCR efficiency was calcu-

lated based on the calibration curve data, for which

nm/TEG-DNA was used in the concentration range

from 4 × 10

–11

to 4 × 10

–15

 M (Fig.3,a-c).

To evaluate amplification of the model nFlu/TEG-

DNA and nm/TEG-DNA, we chose DNA concentration

of 4 × 10

–12

 M. The results of comparative evaluation of

the nFlu/TEG-DNA and nm/TEG-DNA amplification con-

firmed the possibility of using the DNA substrate de-

signed in this study (Fig. 3g). Threshold cycle values C(t)

for the nm/TEG and nFlu/TEG-DNA were 12.12 ± 0.29

and 19.28 ± 0.52 cycles, respectively (Fig. 3e); difference

in the threshold cycle values between the nFlu/TEG-

and nm/TEG-DNA (dC(t)) was 7.17 ± 0.43 cycles. Thus,

the substrate and specific excision reaction product

are distinguishable during PCR.

One possible reason for amplification of the

nFlu/TEG-DNA may be presence in the synthesized

ASSESSMENT OF NER ACTIVITY BY qPCR 1187

BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024

Fig. 2. Schematic representation of the proposed approach for evaluating removal of bulky lesions invitro by qPCR.

preparation of an admixture of DNA containing a

strand without modification (nm/TEG-DNA). Never-

theless, when analyzing melting curves of the nFlu/

TEG-DNA and nm/TEG-DNA amplification products, we

observed difference in the peaks of the PCR product

melting curves and, as a result, revealed a slight dif-

ference in their melting points(Tm)– 90.37 ± 0.11°C for

the nFlu/TEG-DNA and 90.99 ± 0.03°C for the nm/TEG-

DNA, respectively (Fig.3e). It could be suggested based

on these data that the nucleotide sequences of the nFlu/

TEG-DNA and nm/TEG-DNA amplification products are

slightly different. It may be caused by the tendency of

Taq DNA polymerase to translesion synthesis, when

the enzyme could insert (although with low probabil-

ity) a random nucleotide in the strand (preferably de-

oxyadenosine) opposite to the bulky DNA modification

during the elongation stage [17-20].

Using the designed nFlu/TEG-DNA substrate, we

evaluated efficiency of the in vitro removal of bulky

DNA damage using proteins from the cells of long-

lived naked mole-rat (H. glaber) and short-lived mouse

(M. musculus) with the help of qPCR. To date, H. glaber

cells are known to show high resistance to genotox-

ic effects, oncotransformation, and cellular aging,

which is largely ensured by the effective functioning

of cellular systems for maintaining genome stability

[21-24]. Comparative assessment of the NER activity in

H. glaber and M. musculus cells was previously car-

ried out using the method of post-excision labeling of

specific excision products [14]. The results of control

experiments conducted in this study showed that ef-

ficiency of excision of the damaged DNA fragment

containing nFlu from the model DNA duplex (137bp)

by the H. glaber cell extract proteins was 1.5-2 times

higher compared to the efficiency exhibited by the

proteins from M. musculus cells [14]. In this study we

intended to compare the results obtained with the de-

veloped method with the data reported in our previ-

ous study by Evdokimov etal. [14]. For this purpose,

similar preparations of H. glaber and M. musculus cell

extracts were used as model systems. We also made

some changes to adapt the NER response protocol to

subsequent qPCR detection.

For PCR, not only the stage of specific excision of

bulky damage is critical, but also the stage of the native

strand structure repair (Fig. 2). Being model systems

for invitro determination of NER activity, the extracts

of NER-competent cell derived from the cells or tissues

of various types may differ in the content of compo-

nents necessary for filling a single-strand gap. This fact

may affect significantly the results of assessment of

the NER excision activity using cell extracts. Tooffset

these effects, we added Taq DNA polymerase and dNTP

mixture to the reaction mixture for conducting NER.

POPOV et al.1188

BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024

Fig. 3. Analysis of nFlu/TEG and nm/TEG DNA amplification results. Standard amplification curves for nm/TEG-DNA(a), cali-

bration plot(b), and results of calculation of the nm/TEG-DNA amplification efficiency(c) are presented. d)Example of nm/TEG

and nFlu/TEG-DNA amplification curves; e)average C(t) values and standard deviation of nm/TEG and nFlu/TEG-DNA based

on three measurements; f)melting curves of nm/TEG and nFlu/TEG-DNA.

Using the developed protocol, we compared de-

pendencies of the nFlu/TEG-DNA repair efficiency on

incubation time for the H. glaber and M. musculus cell

extract proteins (Fig.4, a and b).

Efficiency of the nFlu/TEG-DNA repair was calculat-

ed based on the obtained mean dC(t) values converted

to percentages. When calculating, the difference in C(t)

for nFlu/TEG and nm/TEG-DNA obtained in the control

experiments conducted without incubation of the mod-

el DNA with the extract proteins was taken as 100%.

ThenFlu/TEG-DNA repair efficiency was higher over the

entire incubation interval with the H. glaber cell extract

proteins (Fig. 4c) and after 30 min was 55.67 ± 0.42%,

while after incubation with the M. musculus cell ex-

tract proteins the repair efficiency was significantly

lower and was 35.17 ± 1.42% (Fig. 4d). Incubation of

the nm/TEG-DNA with the proteins of cell extract for

30min did not lead to a noticeable change in C(t) val-

ues. This fact indicates absence of the significant effect

of non-specific exposure to the cell extract proteins in

both cases. The H. glaber cell extract proteins were al-

most 1.5-fold more effective at removing nFlu bulky

damage from the model DNA substrate than the M. mus-

culus cell extract proteins. These data are consistent

with the results of control experiments performed ear-

lier using similar cell extract preparations by post-exci-

sion labeling of excision products [14]. Similarity of the

Tm values and peak positions of the amplification prod-

uct melting curves, which we observed for the nFlu/

TEG-DNA processed by the extract proteins and the

control nm/TEG-DNA (90.98 ± 0.04°C and 91.00 ± 0.06°C,

respectively), further confirms the fact of removal of

the bulky damage from DNA and repair of its correct

nucleotide sequence in the process(Fig.4d).

Despite the fact that the skin fibroblasts of the

long-lived H. glaber and embryonic fibroblasts of the

ASSESSMENT OF NER ACTIVITY BY qPCR 1189

BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024

Fig. 4. Comparative evaluation of nFlu/TEG-DNA repair efficiency by Heterocephalus glaber and Musmusculus cell extract

proteins with qPCR. nm/TEG-DNA amplification curves (violet), nFlu/TEG-DNA (green) and nFlu/TEG-DNA after 30min incuba-

tion with extract proteins (dark green) obtained for H. glaber(a) and M. musculus(b); c)comparison of nFlu/TEG-DNA repair

efficiency by NER proteins of H. glaber (blue) and M. musculus (red) cell extracts, depending on incubation time; d)difference

in the nFlu/TEG DNA repair efficiency between H. glaber (blue) and M.musculus (red) cell extracts after 30min of incubation;

e)evaluation of the effect of H. glaber and M. musculus cell extract proteins on nm/TEG-DNA without bulky damage after

30min incubation; f)example of melting curves showing nm/TEG-DNA (violet), nFlu/TEG-DNA (green), and nFlu/TEG-DNA

amplification products after 30min incubation with NER (dark green) proteins of M.musculus cell extract. Results are present-

ed as a mean of three biological replicates with standard deviation, ***p<0.001.

short-lived M. musculus used to test the developed

method are different in nature, which may somewhat

reduce the observed difference between the efficiency

of bulky lesion removal by the proteins of these mam-

malian extracts, comparison of the results of post-exci-

sional labeling with the qPCR results indicates that the

removal of bulky damage by the NER system is indeed

more effective in H. glaber cells. This is consistent with

the current notions about the significant contribution

of DNA repair systems in ensuring high genome sta-

bility of the H. glaber, which lives under constant ox-

idative stress [25-27]. Apparently, other DNA repair

systems, such as BER, high activity of which was also

noted in H. glaber cells, may play an important role

in the effective removal of bulky damage in H. glaber

cells [14, 27]. Possible participation of BER proteins,

as well as some other systems in the repair of UV-in-

duced damage has recently been demonstrated in the

experiments with human cells deficient in XPA, one

of the main protein factors involved in the NER pro-

cess [28, 29]. Thus, the developed method is promis-

ing for further use in research aimed both at study-

ing DNA repair in the cells of long-lived mammals

and also at finding functional relationship of various

DNA repair systems involved in the removal of bulky

lesions.

POPOV et al.1190

BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024

CONCLUSION

The method we developed made it possible to

evaluate efficiency of removing bulky DNA damage

invitro using extracts of the cells of long-lived H. glaber

and short-lived M. musculus. Proteins of the H. glaber

cell extract facilitated more effective recognition and

removal of nFlu bulky damage from the model DNA

substrate compared to the M. musculus cell extract

proteins, which is consistent with the data published

previously [14]. Hence, a simple and fast procedure for

performing the developed method based on the use of

qPCR analysis could promote its further widespread

use both in basic research on the DNA repair processes

and for timely assessment of the status of DNA repair

systems of the patients in clinical practice.

Contributions. I.O.P. and O.I.L. supervised the

study; A.A.P., V.A.Sh., and I.O.P. conducted experiments;

A.A.P., I.O.P., A.N.E., and O.I.L. prepared and edited the

manuscript.

Funding. This work was financially supported

by the Russian Science Foundation (project no.19-74-

10056-P).

Ethics declaration. This work does not describe

any studies involving humans or animals as objects

performed by any of the authors. The authors of this

work declare that they have no conflicts of interest.

Open access. This article is licensed under a Cre-

ative Commons Attribution 4.0 International License,

which permits use, sharing, adaptation, distribution,

and reproduction in any medium or format, as long

as you give appropriate credit to the original author(s)

and the source, provide a link to the Creative Commons

license, and indicate if changes were made. Theimages

or other third-party material in this article are includ-

ed in the article’s Creative Commons license, unless

indicated otherwise in a credit line to the material.

Ifmaterial is not included in the article’s Creative Com-

mons license and your intended use is not permitted

by statutory regulation or exceeds the permitted use,

you will need to obtain permission directly from the

http://creativecommons.org/licenses/by/4.0/.

REFERENCES

1. Chatterjee,N., and Walker, G. C. (2017) Mechanisms

of DNA damage, repair, and mutagenesis, Environ.

Mol. Mutagen., 58, 235-263, https://doi.org/10.1002/

em.22087.

2. Krasikova,Y., Rechkunova, N., and Lavrik, O. (2021)

Nucleotide excision repair: from molecular defects to

neurological abnormalities, Int.J. Mol. Sci., 22, 6220,

https://doi.org/10.3390/ijms22126220.

3. Paccosi, E., Balajee, A. S., and Proietti-De-Santis, L.

(2022) A matter of delicate balance: loss and gain of

Cockayne syndrome proteins in premature aging and

cancer, Front. Aging, 3, 960662, https://doi.org/10.3389/

fragi.2022.960662.

4. Yurchenko, A.A., Rajabi,F., Braz-Petta,T., Fassihi,H.,

Lehmann, A., Nishigori, C., Wang, J., Padioleau, I.,

Gunbin,K., Panunzi,L., Morice-Picard,F., Laplante,P.,

Robert, C., Kannouche, P. L., Menck, C. F. M., Sara-

sin,A., and Nikolaev, S. I. (2023) Genomic mutation

landscape of skin cancers from DNA repair-deficient

xeroderma pigmentosum patients, Nat. Commun., 14,

2561, https://doi.org/10.1038/s41467-023-38311-0.

5. Kap, E. J., Popanda, O., and Chang-Claude, J. (2016)

Nucleotide excision repair and response and survival

to chemotherapy in colorectal cancer patients, Phar-

macogenomics, 17, 755-794, https://doi.org/10.2217/

pgs-2015-0017.

6. Bowden, N.A. (2014) Nucleotide excision repair: why

is it not used to predict response to platinum-based

chemotherapy? Cancer Lett., 346, 163-171, https://

doi.org/10.1016/j.canlet.2014.01.005.

7. Kiwerska, K., and Szyfter, K. (2019) DNA repair in

cancer initiation, progression, and therapy-a dou-

ble-edged sword, J.Appl. Genet., 60, 329-334, https://

doi.org/10.1007/s13353-019-00516-9.

8. Evdokimov,A., Petruseva,I., Tsidulko,A., Koroleva,L.,

Serpokrylova, I., Silnikov, V., and Lavrik, O. (2013)

New synthetic substrates of mammalian nucleotide

excision repair system, Nucleic Acids Res., 41, e123,

https://doi.org/10.1093/nar/gkt301.

9. Liu,Z., Ding,S., Kropachev,K., Lei,J., Amin,S., Broy-

de,S., and Geacintov, N.E. (2015) Resistance to nucle-

otide excision repair of bulky guanine adducts oppo-

site abasic sites in DNA duplexes and relationships be-

tween structure and function, PLoS One, 10, e0142068,

https://doi.org/10.1371/journal.pone.0137124.

10. Lukyanchikova, N. V., Petruseva, I. O., Evdokimov,

A. N., Silnikov, V. N., and Lavrik, O. I. (2016) DNA

with damage in both strands as affinity probes and

nucleotide excision repair substrates, Biochemis-

try (Moscow), 81, 263-274, https://doi.org/10.1134/

S0006297916030093.

11. Naumenko, N., Petruseva, I., Lomzov, A., and Lavr-

ik, O. (2021) Recognition and removal of clustered

DNA lesions via nucleotide excision repair, DNA

Repair (Amst), 108, 103225, https://doi.org/10.1016/

j.dnarep.2021.103225.

12. Chesner, L. N., and Campbell, C. (2018) A quantita-

tive PCR-based assay reveals that nucleotide excision

repair plays a predominant role in the removal of

DNA-protein crosslinks from plasmids transfected

into mammalian cells, DNA Repair (Amst), 62, 18-27,

https://doi.org/10.1016/j.dnarep.2018.01.004.

13. Shen, J.C., Fox, E.J., Ahn, E.H., and Loeb, L.A. (2014)

A rapid assay for measuring nucleotide excision

ASSESSMENT OF NER ACTIVITY BY qPCR 1191

BIOCHEMISTRY (Moscow) Vol. 89 No. 7 2024

repair by oligonucleotide retrieval, Sci. Rep., 4, 4894,

https://doi.org/10.1038/srep04894.

14. Evdokimov,A., Kutuzov,M., Petruseva,I., Lukjanchi-

kova, N., Kashina, E., Kolova, E., Zemerova, T., Ro-

manenko, S., Perelman, P., Prokopov, D., Seluan-

ov, A., Gorbunova,V., Graphodatsky,A., Trifonov,V.,

Khodyreva, S., and Lavrik, O. (2018) Naked mole

rat cells display more efficient excision repair than

mouse cells, Aging (Albany NY), 10, 1454-1473, https://

doi.org/10.18632/aging.101482.

15. Reardon, J. T., and Sancar, A. (2006) Purification

and characterization of Escherichia coli and human

nucleotide excision repair enzyme systems, Meth-

ods Enzymol., 408, 189-213, https://doi.org/10.1016/

S0076-6879(06)08012-8.

16. Clavé,G., Reverte,M., Vasseur, J.J., and Smietana,M.

(2020) Modified internucleoside linkages for nu-

clease-resistant oligonucleotides, RSC Chem. Biol.,

2, 94-150, https://doi.org/10.1039/d0cb00136h.

17. Smith, C.A., Baeten,J., and Taylor, J.S. (1998) Theabil-

ity of a variety of polymerases to synthesize past

site-specific cis-syn, trans-syn-II, (6-4), and Dewar

photoproducts of thymidylyl-(3′→5′)-thymidine, J.Biol.

Chem., 273, 21933-21940, https://doi.org/10.1074/

jbc.273.34.21933.

18. Taylor, J.S. (2002) New structural and mechanistic in-

sight into the A-rule and the instructional and non-in-

structional behavior of DNA photoproducts and other

lesions, Mutat. Res., 510, 55-70, https://doi.org/10.1016/

s0027-5107(02)00252-x.

19. Khare,V., and Eckert, K.A. (2002) The proofreading

3′→5′ exonuclease activity of DNA polymerases: a ki-

netic barrier to translesion DNA synthesis, Mutat.

Res., 510, 45-54, https://doi.org/10.1016/s0027-5107

(02)00251-8.

20. Obeid, S., Schnur, A., Gloeckner, C., Blatter, N., Wel-

te, W., Diederichs, K., and Marx,A. (2011) Learning

from directed evolution: Thermus aquaticus DNA poly-

merase mutants with translesion synthesis activity,

Chembiochem., 12, 1574-1580, https://doi.org/10.1002/

cbic.201000783.

21. Evdokimov,A., Popov,A., Ryabchikova,E., Koval,O.,

Romanenko, S., Trifonov, V., Petruseva, I., Lavr-

ik, I., and Lavrik, O. (2021) Uncovering molecular

mechanisms of regulated cell death in the naked

mole rat, Aging (Albany NY), 13, 3239-3253, https://

doi.org/10.18632/aging.202577.

22. Yamamura, Y., Kawamura, Y., Oka, K., and Miu-

ra, K. (2022) Carcinogenesis resistance in the lon-

gest-lived rodent, the naked mole-rat, Cancer Sci., 113,

4030-4036, https://doi.org/10.1111/cas.15570.

23. Boughey, H., Jurga, M., and El-Khamisy, S. F. (2021)

DNA homeostasis and senescence: lessons from the

naked mole rat, Int. J. Mol. Sci., 22, 6011, https://

doi.org/10.3390/ijms22116011.

24. Hadj-Moussa,H., Eaton,L., Cheng,H., Pamenter, M.E.,

and Storey, K. B. (2022) Naked mole-rats resist the

accumulation of hypoxia-induced oxidative damage,

Comp. Biochem. Physiol. A Mol. Integr. Physiol., 273,

111282, https://doi.org/10.1016/j.cbpa.2022.111282.

25. Buffenstein, R. (2005) The naked mole-rat: a new

long-living model for human aging research, J.Geron-

tol. A Biol. Sci. Med. Sci., 60, 1369-1377, https://

doi.org/10.1093/gerona/60.11.1369.

26. Gorbunova,V., Seluanov,A., Zhang,Z., Gladyshev, V.N.,

and Vijg,J. (2014) Comparative genetics of longevity

and cancer: insights from long-lived rodents, Nat. Rev.

Genet., 15, 531-540, https://doi.org/10.1038/nrg3728.

27. MacRae, S.L., Croken, M.M., Calder, R.B., Aliper,A.,

Milholland,B., White, R. R., Zhavoronkov,A., Glady-

shev, V.N., Seluanov,A., Gorbunova,V., Zhang, Z.D.,

and Vijg,J. (2015) DNA repair in species with extreme

lifespan differences, Aging (Albany NY), 7, 1171-1184,

https://doi.org/10.18632/aging.100866.

28. Gautam,A., Fawcett,H., Burdova,K., Brazina,J., and

Caldecott, K. W. (2023) APE1-dependent base exci-

sion repair of DNA photodimers in human cells,

Mol. Cell, 83, 3669-3678.e7, https://doi.org/10.1016/

j.molcel.2023.09.013.

29. Saha, L. K., Wakasugi, M., Akter, S., Prasad, R., Wil-

son, S. H., Shimizu, N., Sasanuma, H., Huang, S. N.,

Agama, K., Pommier, Y., Matsunaga, T., Hirota, K.,

Iwai,S., Nakazawa,Y., Ogi, T., and Takeda, S. (2020)

Topoisomerase I-driven repair of UV-induced damage

in NER-deficient cells, Proc. Natl. Acad. Sci. USA, 117,

14412-14420, https://doi.org/10.1073/pnas.1920165117.

Publisher’s Note. Pleiades Publishing remains

neutral with regard to jurisdictional claims in pub-

lished maps and institutional affiliations.