Article

ISSN 0006-2979, Biochemistry (Moscow), 2026, Vol. 91, No. 6, pp. 992-1005 © Pleiades Publishing, Ltd., 2026.

992

Development of Metabolic Stress

in Vascular Organoids under Normal Conditions

and with AD/PD-Associated Genetic Backgrounds

Anna V. Blagova

1,a

, Elizaveta S. Perepelitsa

, Anakha Satish

Dmitry A. Lifanov

1,2

, Victoria I. Zhdankina

, Anna A. Kopylova

Polina V. Guk

, Alla B. Salmina

, and Sergey N. Illarioshkin

Federal State Budgetary Scientific Institution “Russian Center of Neurology and Neurosciences”,

125367 Moscow, Russia

Laboratory of Cell Technologies and Tissue Engineering,

Research and Education Center “Soft Matter and Fluid Physics”,

Bauman Moscow State Technical University, 105005 Moscow, Russia

e-mail: annablagova2000@mail.ru

Received January 30, 2026

Revised June 1, 2026

Accepted June 2, 2026

Abstract— Vascular organoids derived from human induced pluripotent stem cells (iPSCs) are promising

models for studying vascular pathology, including neurodegenerative diseases. In this study, we investigated

signs of mitochondrial dysfunction in the vascular organoids derived from the iPSCs of a healthy donor,

as well as patients with Alzheimer’s disease (AD) and Parkinson’s disease (PD). In the conditioned medium

of vascular organoids from the PD patient-derived cells, but not from the AD patient-derived cells, a trend

toward a disrupted NAD

/NADH balance was observed, accompanied by the reduced expression of the

connexin  43 (Cx43) protein. A sign of metabolic vulnerability of endothelial cells in the vascular organoids

from the PD patient-derived cells, but not from normal or AD patient-derived organoids, manifested as

reduced expression of c-Myc was observed. Changes in the membrane potential were detected in the vas-

cular organoids from the AD and PD patient-derived, as well as increase in the mitochondrial superoxide

anion production were observed, which may indicate development of oxidative stress in the microvessel

cells during neurodegeneration.

DOI: 10.1134/S0006297926600286

Keywords: vascular organoids, mitochondrial dysfunction, metabolic stress, Alzheimer’s disease, Parkinson’s

disease, iPSC

* To whom correspondence should be addressed.

# These authors contributed equally to this study.

INTRODUCTION

Traditionally, animal and cell models have been

used to study pathogenesis of neurodegenerative

diseases and vascular aging. However, animal mod-

els do not fully represent the processes occurring in

the human body, and classical two-dimensional cell

models are limited in replicating tissue architecture

and intercellular interactions. Therefore, the tech-

nology of organoids derived from human induced

pluripotent stem cells (iPSCs) is actively developing,

allowing creation of the patient-specific three-dimen-

sional models for detailed study of pathogenic pro-

cesses. Unlike the classical 2D monolayers, transition

to three-dimensional cultures allows recreating the

tissue microenvironment and many of the physico-

chemical effects occurring in the tissues of a living

organism: gradients and flows of oxygen, carbon

dioxide, metabolites, and pH  [1]. Additionally, when

growing organoids from iPSCs de  novo, it is possible

to obtain a specific repertoire of cells corresponding

to a particular tissue of interest, as well as accurately

model pathological processes characteristic of it  [2].

METABOLIC STRESS IN VASCULAR ORGANOIDS 993

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

To model pathological processes, iPSCs from both

healthy donors (which can be genetically modified

in  vitro, such as deletions or nonsense mutations that

may cause pathology) and patients with existing ge-

netic pathology can be used  [3, 4].

Despite the large number of studies performed

using brain  [5], intestinal  [6], and heart  [7] organoids,

protocols for obtaining vascular organoids have only

recently begun to emerge [8, 9]. During production of

vascular organoids, the iPSC spheroids (so-called em-

bryoid bodies) are sequentially differentiated in the

mesodermal and vascular directions and then embed-

ded in a gel matrix to induce sprouting – growth and

branching of vessel-like processes  [8]. Thus, vascular

organoids allow accurate modeling of vasculogenesis

and angiogenesis processes  [10]. The ability of cells

to self-organize enables them to form complex spa-

tial networks, including endothelial layer and other

components of the vascular wall, which ensures close

approximation of the architecture and intercellular

interactions characteristic of native vessels  [11,  12].

Vascular organoids are also of interest in solving

the problem of vascularizing organoids that model

other tissues, as their fusion could form a vascular

network that supplies deeper layers of the organoid

cells with oxygen and nutrients, similar to in  vivo

conditions  [13]. In addition, vascular organoids can

be considered as an independent model of vascular

pathology in various diseases, such as diabetes  [14].

However, vascular organoids have not previously

been used to study vascular pathology in neurode-

generative diseases such as Alzheimer’s disease (AD)

and Parkinson’s disease (PD).

It is known that vascular disorders play a crit-

ical role in the pathogenesis of AD: they not only

exacerbate classical pathogenic processes associated

with accumulation and spread of aberrant proteins

but can also be an early cause of neurodegeneration

due to excessive neovascularization, non-productive

angiogenesis, formation of a pathologically permeable

blood–brain barrier (BBB), and disorders in the neu-

rovascular unit of the brain  [15,  16]. In PD, vascular

changes also have a significant impact: pathological

activation of pericytes, reduced capillary network

density, endothelial dysfunction, and impaired angio-

genesis lead to impaired microcirculation and met-

abolic disorders in the brain  [17]. Overall, studying

vascular aspects of neurodegeneration is a key area

for understanding the pathogenesis of AD and PD, as

well as cerebrovascular aging in general.

Mitochondrial dysfunction is a key mechanism of

neurodegeneration in AD and PD. Currently, data on

mitochondrial dysfunction in vascular organoids are

limited, although there are data obtained using 2D

cultures of endothelium and cerebral organoids. For

example, in the brain microvascular endothelial cells

derived from iPSCs, the amyloid-β peptides (Aβ40

and Aβ42) and mutations in the PSEN1, PSEN2 genes

(characteristic of AD) and LRRK2 G2019S gene (char-

acteristic of PD) cause pronounced mitochondrial dys-

function, reduced membrane potential, depletion of

glycolytic reserve, accumulation of aberrant proteins,

increased oxidative stress, and reduced cell viability

[18-21]. Observations in cerebral organoids modeling

AD show decrease in the mitochondrial membrane

potential, increased production of mitochondrial su-

peroxide anion (O

−

), and disruption of redox ho-

meostasis, indicating increased oxidative stress in

the neurons  [22]. Mitochondrial metabolic disorders

are accompanied by imbalance in NAD

/NADH ratio,

reflecting deficiency in the energy metabolism and

reduced efficiency of the electron transport chain,

as demonstrated in the study by Hong et al. (2024)

devoted to organoids modeling another neurodegen-

erative pathology, Alpers syndrome  [23]. In the case

of endothelial cells, an imbalance in the NAD

/NADH

ratio may indicate cell aging, as extracellular NAD

an important signaling molecule, and its derivatives

are substrates for replenishing the NAD

pool in the

cell  [24]. In particular, disruption of the extracellu-

lar NAD

/NADH balance may occur due to activity of

the connexin Cx43, which can act as a transporter of

NAD

and regulate activity of the NAD

-dependent en-

zyme PARP1  [25], as well as due to activity of CD38,

an enzyme that hydrolyzes NAD

  [26].

Despite the advantages of the iPSC-based models

(including preservation of the authentic genetic con-

text of the donor), it is necessary to note some lim-

itations associated with the use of such models and

cells differentiated from iPSCs to study metabolism.

For example, the very procedure of reprogramming

of somatic cells into iPSCs is accompanied by mito-

chondrial DNA damage [27] and oxidative stress [28],

which should be considered as an additional factor

affecting functional competence of iPSCs and organ-

oids derived from them. However, it has been noted

that iPSCs retain key features of mitochondrial meta-

bolic disorders characteristic of the donor of somatic

cells, for example, during aging  [29], which justifies

relevance of the metabolic models based on iPSCs.

In particular, the literature data confirm that mi-

tochondrial metabolic disorders, associated reductive

or oxidative stress, and energy deficiency significant-

ly affect cell survival and their sensitivity to patho-

logical protein aggregates. This emphasizes the prom-

ise of studying mitochondrial dysfunction in vascular

organoids for more realistic modeling of the mecha-

nisms of neurodegeneration in AD and PD.

The aim of this study was to identify signs of

mitochondrial dysfunction and metabolic stress in the

vascular organoids derived from iPSCs of a healthy

donor and patients with AD and PD by measuring

BLAGOVA et al.994

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

NAD

/NADH levels, determining mitochondrial poten-

tial, and studying the level of reactive oxygen species

(ROS) in mitochondria.

MATERIALS AND METHODS

iPSC cultivation. In this work, we used iPSCs

lines from a healthy donor IPSRG2L (HD), a pa-

tient with Alzheimer’s disease with the V717I mu-

tation in the gene encoding amyloid precursor pro-

tein APP Alz-9L  (AD), and a patient with Parkinson’s

disease with mutation in the gene encoding LRRK2

IPSPDL2.6S (PD) (obtained at the Federal State Bud-

getary Scientific Institution “Russian Center of Neu-

rology and Neurosciences”, as well as kindly provided

by the Federal State Budgetary Scientific Institution

ICiG  SB  RAS). Previously, expression of pluripotency

markers, normal karyotype, and ability to form de-

rivatives of the three germ layers were confirmed in

these lines. iPSCs were cultured in a mixture of a Hy-

brid-S-8 medium with alanyl-glutamine (PanEco, Rus-

sia) and mTeSR 1 (StemCell Technologies, Canada) at

a 4  :  1 ratio with addition of penicillin-streptomycin

(50  U/mL, 50  µg/mL; PanEco) on a 1%  Matrigel matrix

(ABW, China). Cell lines were cultured at 37°C in an

atmosphere of 5%  CO

with daily medium changes.

Upon reaching 80-90% confluency, cells were pas-

saged using a 0.05% trypsin-EDTA solution (PanEco).

After passaging and thawing, 5  µM Y-27632 (StemCell

Technologies) was added to the medium.

To obtain spheroids from iPSCs, microwell

stamps manufactured using MSLA 3D printing tech-

nology from Anycubic Basic Translucent Green pho-

topolymer resin [30] and provided by the Institute

of Physics and Materials Science, Ural Branch of the

Russian Academy of Sciences, were used. To create

microwells, 2%  agarose (Helicon, Russia) diluted in

deionized water and boiled twice was used. Agarose

was poured into Petri dishes under a laminar hood,

and a microwell stamp was placed in the still hot

agarose. After the agarose solidified, the stamp was

slowly lifted, and the microwells were soaked in iPSC

culture medium for at least 24  h to avoid osmotic

shock to the cells. To form spheroids, iPSC suspension

was added at a rate of 3000 cells per microwell with

addition of 50  µM Y-27632. Medium replacement was

carried out 72  h after seeding the microwells.

To obtain vascular organoids, a modified pro-

tocol [8, 31] was used. After 5 days from the start

of spheroid formation, differentiation in the me-

sodermal direction was initiated in a mixture of

DMEM/F-12 (PanEco) and Neurobasal (PanEco) media

at a 1  :  1 ratio with addition of penicillin-streptomy-

cin (50 U/mL, 50  µg/mL), 2  mM L-glutamine (Service-

Bio, China), 50×  NeuroMax (PanEco), 100×  N-2 (Pan-

Eco), 12  µM CHIR99021 (Miltenyi Biotec, Germany),

and 30  ng/mL BMP-4 (ABclonal, China). On day  3,

differentiation in the vascular direction was induced

using a mixture of DMEM/F-12 and Neurobasal me-

dia at a 1  :  1 ratio with addition of penicillin-strep-

tomycin (50  U/mL, 50  µg/mL), 2 mM L-glutamine

(ServiceBio), 50× NeuroMax (PanEco), 100×  N-2 (Pan-

Eco), 100  ng/mL VEGF-A (sci-store, Russia), and 2 µM

forskolin (Miltenyi Biotec). Spheroids were incubated

for 48  h.

To obtain vascular networks, a mixture of a

GelNest Matrix (NEST, China) and 2.6  mg/mL type  I

collagen (Biolot, Russia) at a 1  :  1 ratio was used.

Before mixing with Matrigel, the collagen solution

was brought to neutral pH by adding 5  M  NaOH.

The required number of wells of a 6-well ultra-low

adhesion plate (SPL LifeSciences, South Korea) were

coated with 1  mL of cold matrix mixture. For po-

lymerization, the matrix was incubated at 37°C for

2-16  h. Spheroids were collected and resuspended in

1  mL of a cold matrix mixture, which was added to

the previously prepared 6-well plate. For polymeriza-

tion, the matrix was incubated at 37°C for 2  h, after

which a vascular differentiation medium was added

to the wells: RPMI-1640 (PanEco), penicillin-strepto-

mycin (50  U/mL, 50  µg/mL), 2  mM L-glutamine (Ser-

viceBio), 50× insulin-transferrin-selenium (PanEco),

15%  FBS (BioWest, France), 100  ng/mL VEGF-A (sci-

store), 100  ng/mL FGF-2 (sci-store). The medium was

replaced after 3  days, then every 2  days. The result-

ing vascular networks were cultured in the matrix

for 2 weeks.

Individual vascular networks were then extract-

ed from the matrix using sterile Pasteur pipettes

(MiniMed, Russia) or wide-bore tips (GenFollower,

China), transferred to 96-well round-bottom plates

(SPL LifeSciences), and cultured for 4-5 days until the

organoids rounded.

Immunocytochemistry. Vascular organoids

were fixed in 4% paraformaldehyde (Servicebio) and

washed three times with PBS (10min each). Non-spe-

cific binding was blocked with a 1%  BSA solution

(ABclonal) in PBS with incubation for 2  h at 37°C,

followed by three PBS washes for 10  min each. For

double staining for CD31 and CD34, primary mouse

antibodies against CD31 (1  :  100, 14-0319-82, Invitro-

gen, USA) and rabbit antibodies against CD34 (1  :  100,

PAB959Mu01, Cloud-Clone Corp., China) were used

with incubation for 16  h at 4°C, followed by wash-

ing with 0.01% Triton X-100 in PBS three times for

10  min each. Goat anti-rabbit IgG antibodies conju-

gated with FITC fluorophore (1  :  500, AS011, ABclonal,

China) and goat anti-mouse IgG antibodies conjugat-

ed with ABflo™ 594 (1  :  500, AS054, ABclonal, China)

were used as secondary antibodies with incubation

for 3  h at room temperature. Washing was also

METABOLIC STRESS IN VASCULAR ORGANOIDS 995

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

performed with 0.01% Triton X-100 in PBS three times

for 10 min each. Samples were mounted in a Lumi-

Mount mounting medium with DAPI (Lumiprobe,

Russia) and visualized using an Olympus FV-3000

confocal microscope.

Measurement of mitochondrial membrane

potential. To measure mitochondrial membrane po-

tential in organoids, tetramethylrhodamine ethyl es-

ter perchlorate (TMRE, Abcam) was used. A 500  nM

TMRE solution in PBS was added to the wells of

a 96-well plate with organoids and incubated for

30  min at 37°C. The wells were washed three times

with PBS. Fluorescence intensity was assessed using

a BioTek Synergy H1 Multimode Reader microplate

reader (Agilent) at a wavelength of 549/575 nm and

visualized using the Evos M7000 imaging system

(Thermo Fisher Scientific, USA).

To assess membrane potential, a JC-1 dye (Lu-

miprobe, Russia) was also used. A 200  µM JC-1 solu-

tion in DMSO was added to the wells of a 96-well plate

with organoids and incubated for 30 min at 37°C.

The wells were next washed with PBS. Fluorescence

intensity was assessed using a BioTek Synergy H1

Multimode Reader microplate reader at wavelengths

of 510/530  nm and 560/590  nm and visualized using

the Evos M7000 imaging system. Duration of organoid

staining with fluorescent probes was chosen based on

the manufacturer’s recommendations.

FCCP was used as a positive control for complete

mitochondrial depolarization. Samples were incubat-

ed with 10  µM FCCP for 30  min at 37°C. The obtained

fluorescence values were normalized relative to the

signal recorded in the presence of FCCP, which al-

lowed accounting for non-specific contributions as-

sociated with variability in the number of organoids

and intensity of the dye accumulation, ensuring cor-

rect comparison between experimental groups using

formulas (1) and (2):

ΔΨ

TMRE

= (F

Sample

– F

FCCP

)/F

Control

, (1)

ΔΨ

JC-1

= F

Sample

FCCP

, (2)

where ΔΨ is relative indicator of mitochondrial mem-

brane potential, F

Sample

is fluorescence intensity of the

studied sample, F

FCCP

is fluorescence intensity of the

sample after FCCP treatment, and F

Control

is average

fluorescence intensity in the control group.

Measurement of mitochondrial superoxide

production. To measure the level of mitochondrial

superoxide in organoids, a fluorescent probe Mito-

SOX Green (Invitrogen, Thermo Fisher Scientific) was

used. A 1  µM MitoSOX Green solution in Locke’s buf-

fer (pH  7.8) was added to the wells and incubated for

30  min at 37°C. The wells were washed three times

with a warm Locke’s buffer (pH  7.8). Fluorescence

intensity was assessed using a BioTek Synergy H1

Multimode Reader microplate reader at a wavelength

of 488/510  nm and visualized using an Evos M7000

imaging system.

Determination of NADH and NAD

levels.

Levels of NADH in the conditioned medium were de-

termined using a NAD

/NADH Colorimetric Assay Kit

(WST-8) (Elabscience, China; E-BC-K804-M) according

to the manufacturer’s recommendations.

RNA extraction. For RNA extraction, 10-30 organ-

oids from each line were pooled per biological rep-

licate. Total RNA was extracted using an ExtractRNA

reagent (Evrogen, Russia) according to the manufac-

turer’s recommendations. Concentration of extracted

RNA was measured using a Nano-500 spectrophotom-

eter (Allsheng, China).

Reverse transcription. 1  µg of RNA was used as

a template for cDNA synthesis using a Magnus re-

verse transcriptase (Evrogen) according to the manu-

facturer’s recommendations.

Quantitative real-time PCR (qPCR-RT). For gene

expression analysis using qPCR-RT, a ready-made 5X

qPCRmix-HS mixture (Evrogen) was used according

to the manufacturer’s recommendations. For the re-

action, 20× dilutions of cDNA were used. The primers

and fluorescent probes used are presented in Table  1.

The reaction mixture (20  µL) included 1  µL of for-

ward and reverse primers (10  µM), 0.25  µL of probe

(10  µM), 4  µL of 5X qPCRmix-HS, and 2  µL of cDNA

(20×); the volume was adjusted to 20  µL with a nu-

clease-free deionized water (Evrogen). Reaction con-

ditions: 95°C for 5  min; (95°C for 10  s; 60°C for 20  s;

72°C for 15  s), 45 cycles. qPCR-RT was performed with

a Rotor-Gene Q amplifier (Qiagen, Germany). To cal-

culate gene expression levels based on Ct values, the

Pfaffl method [21] was used. To calculate relative ex-

pression of the genes of interest, expression level of

the gene was normalized to the expression level of

the reference gene GAPDH.

Western blotting. Protein was extracted from

10-15 organoids using a RIPA buffer (ServiceBio)

with added protease inhibitors (Sigma-Aldrich, USA).

A 10% gel was used for protein separation. Protein

loading was 35  µg per lane. Electrophoresis was car-

ried out at 120  V until the dye front was reached.

Protein transfer to a nitrocellulose membrane was

performed for 1  h at a constant current of 200  mA.

After transfer, the membranes were blocked in a

5% bovine serum albumin solution for 30  min at

room temperature. The membranes were next in-

cubated with primary antibodies: Cx43 (AF0137,

Affinity Biosciences, USA; 1  :  10,000) and beta-Actin

(GB15001-1, ServiceBio; 1  :  1500) at 4°C overnight.

After this, the membranes were incubated with cor-

responding secondary antibodies: Goat Anti-Mouse

IgG 520 (12005866, Bio-Rad, USA; 1  :  2500) and

BLAGOVA et al.996

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

Table 1. Primer and fluorescent probe sequences for qPCR-RT

Name Sequence (5′-3′)

GAPDH Fw AGAAGTATGACAACAGCCTCA

GAPDH Rv CATGAGTCCTTCCACGATAC

GAPDH Probe /FAM/-AGATCATCAGCAATGCCTCCTGCAC-/BHQ2/

MYC Fw CGTCCTCGGATTCTCTG

MYC Rv ACATCGATTTCTTCCTCATCTT

MYC Probe /R6G/-TTGTTCCTCCTCAGAGTCGCTGCT-/BHQ1/

Goat Anti-Rabbit IgG 700 (12004161, Bio-Rad; 1  :  2500)

for 1  h at room temperature. Images were obtained

using a Chemidoc-MP fluorescent imager (Bio-Rad).

Fluorescence intensity was determined using the Im-

ageLab software (Bio-Rad). Expression levels of target

proteins in cell lines were normalized to the expres-

sion of beta-actin protein using ImageLab software.

Statistical analysis. Data analysis and visual-

ization were performed using GraphPad Prism  10.

Descriptive statistics data are presented as arithme-

tic means and standard deviation (SD). Normality

of distribution was assessed using the Shapiro–Wilk

test. Group comparisons were performed using one-

way ANOVA with Sidak’s post-hoc test for normally

distributed data, and the Kruskal–Wallis method with

Dunn’s post-hoc test for non-normally distributed

data. Differences were considered statistically signif-

icant at p  <  0.05.

RESULTS

Obtaining vascular organoids. Vascular organ-

oids were obtained from iPSCs  [31]. For phenotyping,

antibodies against endothelial cell markers CD31 and

CD34 were used. The presented images (Fig.  1) show

the levels of expression of these markers, confirming

their endothelial nature of the cells and successful

formation of vascular structures.

Pyridine nucleotide pool is disrupted in the

vascular organoids produced from the cells de-

rived from PD patients. No significant differences

in the NAD

and NADH levels were found in the

conditioned medium of vascular organoids generated

from different cell lines (Fig. 2, a and b). However,

in the vascular organoids produced from the PD pa-

tient-derived cells, we observed a trend toward de-

crease in the NAD

/NADH ratio, while in the vascular

organoids generated from the cell derived from AD

patients, we observed a trend toward increase in the

NAD

/NADH ratio (Fig.2c), indicating possible disrup-

tions in the processes associated with production and

utilization of pyridine nucleotides (glycolysis, oxida-

tive phosphorylation, activity of NAD

-converting en-

zymes, etc.).

Change in the NAD

/NADH ratio in the condi-

tioned medium could be associated with the change

in expression of the Cx43 hemichannels, which could

regulate NAD

transport across the membrane. In this

regard, we assessed the level of expression of Cx43 in

the lysate of the vascular organoids using the West-

ern blotting method and observed a trend toward in-

creased expression of Cx43 in the vascular organoids

from the cells derived from AD patient compared to

the normal vascular organoids from the cells derived

from a healthy donor (Fig.  3). This may indicate exis-

tence of a Cx43-mediated mechanism of NAD

/NADH

imbalance in the vascular organoids from the cells

derived from AD patients.

c-Myc expression is reduced in the vascular or-

ganoids produced from the cells derived from the

PD patient. Myc protein is a key regulator of a num-

ber of physiological processes in the cell, including mi-

tochondrial biogenesis and metabolic activity. In this

regard, we analyzed expression level of the MYC gene

in the vascular organoids using the qPCR-RT method.

We revealed a statistically significant decrease in the

expression of the MYC gene in the vascular organoids

produced from the PD patient-derived cells compared

to the organoids produced from the cells of a healthy

donor and AD patients (Fig.  4), which may be a sign

of metabolic vulnerability of endothelial cells in the

organoids based on the cells from the PD patient.

Mitochondrial potential is disrupted in the

vascular organoids derived from iPSCs of AD and

PD patients. Measurement of mitochondrial potential

in the vascular organoids was performed using the

potential-sensitive probes TMRE and JC-1. TMRE can

accumulate in active mitochondria in a potential-de-

pendent manner, resulting in fluorescence in the red

channel. Although JC-1 also selectively accumulates

in mitochondria in a potential-dependent manner,

METABOLIC STRESS IN VASCULAR ORGANOIDS 997

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

Fig. 1. Immunocytofluorescent images of a vascular organoid derived from iPSCs of a healthy donor. Organoids were fixed

with 4% paraformaldehyde and stained with antibodies against endothelial markers CD31 (red) and CD34 (green); DAPI

(blue). Images were obtained using an Olympus FV3000 confocal microscope. Co-expression of CD31 and CD34 markers in

the cells of the vascular organoid on day 30 of cultivation is shown.

its fluorescence depends on the mitochondrial mem-

brane potential: in the depolarized membranes, JC-1

exists as a monomer and emits fluorescence in the

green channel, while in the hyperpolarized mem-

branes, it is present as J-aggregates, producing a fluo-

rescent signal in the red channel. Therefore, the ratio

between the red and green fluorescence (R/G) could

indicate predominance of the “healthy” or depolar-

ized mitochondria in the sample.

When assessing the mitochondrial membrane

potential using TMRE (Fig.  5, a, b), no significant

differences were found between the integral fluores-

cence intensity signals of the probes in the vascular

organoids. At the same time, analysis of the ratio of

red and green fluorescence of JC-1 (Fig.  6) showed

decrease in the R/G in the vascular organoids de-

rived from the AD and PD patients, which may indi-

cate early or moderate changes in ΔΨm not detected

BLAGOVA et al.998

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

Fig. 2. Levels of NAD

(a), NADH (b), and the ratio of NAD

/NADH levels (c) in the conditioned medium of vascular organ-

oids derived from iPSCs of a healthy donor (HD) and patients with Alzheimer’s disease (AD) and Parkinson’s disease (PD).

Data are presented as mean values (n = 3).

Fig. 3. a and b)Expression of beta-actin (a) and Cx43 (b) proteins in the vascular organoids derived from iPSCs of a healthy

donor (HD) and patients with Alzheimer’s disease (AD) and Parkinson’s disease (PD), determined by Western blotting.

c) Level of Cx43 expression relative to beta-actin. Data are presented as a mean ±SD (n = 3).

by the TMRE method. Discrepancy between the re-

sults of the two probes may be due to the different

sensitivities and dependencies of TMRE fluorescence

on mitochondrial mass and dye accumulation.

Superoxide anion level is elevated in the vas-

cular organoids produced from iPSCs derived from

AD and PD patients. To determine the level of ROS in

the vascular organoids, the fluorescent probe MitoSOX

Green, which selectively accumulates in mitochondria

and is oxidized by superoxide anion to produce a flu-

orescent signal, was used. In the vascular organoids

produced from the iPSCs derived from AD and PD

patients, we observed a statistically significant in-

crease in the superoxide anion levels compared to the

METABOLIC STRESS IN VASCULAR ORGANOIDS 999

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

vascular organoids produced from the iPSC derived

from the healthy donor (Fig. 5, a and c).

DISCUSSION

Cerebrovascular pathology is a significant com-

ponent of AD and PD pathogenesis [16, 32]. Vascular

damage in the brain in neurodegenerative diseases

is associated with structural disorders of endotheli-

um, angiogenesis defects, dissemination of aberrant

proteins, chronic hypoperfusion, and impaired BBB

permeability, leading to the development of neu-

roinflammation [33-35]. Currently, it is believed that

for the neurodegenerative diseases, especially AD,

non-productive angiogenesis against the background

of hypervascularization is characteristic, leading to

formation of a large number of functionally and

structurally defective microvessels in the brain  [36,

37]. This phenomenon is associated with vascular ag-

ing, which could develop against the background of

cellular senescence, as well as oxidative stress and

mitochondrial dysfunction  [38]. The consequences of

vascular aging extend to other cells of the neurovas-

cular unit, damaging neurons, astrocytes, and microg-

lia, thereby exacerbating neuroinflammation and pre-

venting normal cell functioning [39, 40].

Mitochondrial dysfunction is considered the basis

of vascular aging [41-43]. It is known that endothelial

cells of the brain capillaries have a greater number

of mitochondria compared to the endothelium of pe-

ripheral vessels  [44]. This indicates high energy de-

mands of endothelial cells in the brain, which is es-

Fig. 4. Expression level of the MYC gene in the vascular or-

ganoids derived from iPSCs of a healthy donor (HD) and pa-

tients with Alzheimer’s disease (AD) and Parkinson’s disease

(PD), determined by qPCR-RT. Expression level of the MYC

gene is normalized to the expression of the reference gene

GAPDH. Data are presented as a mean ±SD, n = 3, *p < 0.05.

Fig. 5. a) Staining of mitochondria in vascular organoids derived from iPSCs of a healthy donor (HD) and patients with

Alzheimer’s disease (AD) and Parkinson’s disease (PD) using the potential-sensitive probe TMRE (red) and the superoxide-sen-

sitive probe MitoSOX Green (green). Magnification 10×. a,b)Relative intensity of TMRE (b) and MitoSOX (c) fluorescence in

vascular organoids. Data are presented as a mean ± SD. Each point on the graphs corresponds to the signal value measured

in an individual well of the microplate, **** p < 0.0001.

BLAGOVA et al.1000

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

Fig. 6. a) Staining of mitochondria in vascular organoids derived from iPSCs of a healthy donor (HD) and patients

with Alzheimer’s disease (AD) and Parkinson’s disease (PD) using the potential-sensitive probe JC-1 (JC-1 dimers – red;

JC-1 monomers (depolarized mitochondria) – green), magnification 10×. band c) Relative intensity of JC-1 fluorescence in

vascular organoids measured in (b) the red channel and (c) the green channel. d)Ratio of fluorescence in the red channel

to fluorescence in the green channel (ratio of the fluorescent signal of “healthy” mitochondria to the fluorescent signal of

depolarized mitochondria). Data are presented as a mean ± SD. Each point on the graphs corresponds to the signal value

measured in an individual well of the microplate, ** p < 0.01, *** p < 0.001.

pecially relevant for the effective functioning of the

neurovascular unit and the BBB  [45]. Experimentally,

it has been shown that pharmacological suppression

of mitochondrial activity in the brain microvascular

endothelial cells leads to the destruction of tight junc-

tions between them and, as a result, increased BBB

permeability  [46]. Consequences of the mitochondrial

dynamics changes characteristic of AD and PD (in-

cluding fragmentation, fusion, mitochondrial biogen-

esis, and mitophagy)  [47, 48] also extend to vascular

cells. For example, in the brain microvascular endo-

thelial cells of mice with AD induced by introduc-

tion of amyloid-β peptides into the hippocampus, in-

creased mitochondrial fragmentation and autophagy

levels were observed, as evidenced by the expression

of the Drp1 and LC3b proteins  [49].

Mitochondrial dysfunction could be associated

with oxidative [50,  51] and reductive stress  [52,  53],

which are manifested as increased production of ROS

by mitochondria and decreased NAD

/NADH ratio, re-

spectively. However, the data on the prevalence of ox-

idative or reductive stress in neurodegeneration are

quite contradictory: in the transgenic mouse model

of AD, decrease in the NADH level in the neurons

was noted  [54], and exogenous administration of

NAD

to maintain normal redox balance was asso-

ciated with improved cognitive processes in AD and

slowed disease progression  [55]. For PD, disruption

in the NAD

/NADH ratio is also characteristic, and its

pharmacological restoration is considered neuropro-

tective  [56]. Changes in the NAD

and NADH levels,

in turn, could be associated with the impaired elec-

tron transport chain (ETC) function and could lead

to the changes in mitochondrial membrane potential.

Indeed, mitochondrial dysfunction in neurodegenera-

tion could also be manifested as membrane depolar-

ization, which could exacerbate oxidative stress  [57]

and lead to apoptosis [58]. Although it has been noted

that mitochondrial depolarization is not necessary for

apoptosis in the neurons  [59]. In general, changes in

the NAD

and NADH ratio in the cells could serve

as indicators of metabolic distress in the brain tissue

during aging and neurodegeneration  [60].

Using vascular organoids produced from the

iPSCs derived from the healthy donor, as well as from

the AD and PD patients, we were able to register signs

of metabolic disorders in neurodegeneration: a trend

toward disruption of the NAD

and NADH balance in

the cell culture medium associated with the reduced

expression of the Cx43 protein, reduced expression of

c-Myc at the transcript level, and increased produc-

tion of ROS by mitochondria.

METABOLIC STRESS IN VASCULAR ORGANOIDS 1001

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

It is known that the Cx43 hemichannels are re-

sponsible for transmembrane transport of NAD

  [61],

which could explain the increased level of extracellu-

lar NAD

relative to NADH in the vascular organoids

produced from the cells derived from AD patients.

Thus, the trend toward change in the NAD

/NADH

balance in the conditioned medium could indicate re-

dox stress in the endothelial cells within the vascular

organoids produced from the cells derived from the

AD patient, but not from the PD patient. At the same

time, increased expression of Cx43 could be a sign

of metabolic adaptation of the cells to stress, since

their expression increases with suppression of cell

metabolism.

A significant regulator of metabolism is the

transcription factor c-Myc, which regulates mito-

chondrial biogenesis, expression of the nuclear-en-

coded mitochondrial genes  [62], and mitochondrial

dynamics [63], and is also involved in the regula-

tion of metabolic processes, including glycolysis and

oxidative phosphorylation  [64]. In addition, c-Myc

mediates endothelial cell proliferation  [65]. In this

study, we observed a statistically significant decrease

in the relative expression of the MYC gene in the

vascular organoids produced from the cells derived

from the PD patient compared to cells of the healthy

donor and the AD patient, which could indicate re-

duced mitochondrial biogenesis and mitochondrial

dysfunction. Interestingly, suppression of the c-Myc

expression is associated with the development of a

state of metabolic vulnerability in which cells resort

to compensatory mechanisms; however, with further

stress exposures, a full-fledged metabolic crisis could

occur, leading to the cell death  [66]. It is also known

that the increased expression of c-Myc is associated

with the increased NAD

levels and activation of the

NAD

-dependent enzyme SIRT1, which participates

in mitophagy and reduces the degree of cellular ag-

ing  [67]. The observed decrease in the c-Myc mRNA

expression, as well as the trend toward decrease in

the NAD

/NADH ratio, could serve as a prompt for

researchers to study the mechanisms of this imbal-

ance and involvement of the enzymes such as PARP1,

CD38, SIRT1, etc., in it further and in more detail.

In the endothelial cells that are part of vascu-

lar organoids produced from the cells derived from

AD and PD patients, a decrease in mitochondrial

membrane potential was detected, which is consis-

tent with the expected mitochondrial disorders in

these pathologies and is confirmed by the decrease

in the red/green fluorescence ratio of JC-1. However,

no statistically significant changes were found using

TMRE as a probe of mitochondrial membrane poten-

tial, which could be due to the different sensitivity

and dependence of TMRE fluorescence on the mito-

chondrial mass and dye accumulation. It should be

noted that the used imaging conditions do not allow

resolving individual mitochondria and assessing sub-

cellular localization of the fluorescent probes. In this

work, the main focus was on measuring the integral

fluorescent signal at the level of organoids. Methods

with higher spatial resolution (e.g., confocal microsco-

py) could be used in the future to clarify intracellular

localization of the signals.

At the same time, vascular organoids produced

from the cells derived from AD and PD patients

showed a significant increase in the mitochondri-

al superoxide anion levels, as evidenced by the in-

creased fluorescence of the MitoSOX probe. This in-

dicates increase in the ROS levels in mitochondria,

which could lead to their damage and corresponding

damage to metabolic pathways. These data are con-

sistent with the hypothesis suggesting that oxidative

stress is associated with mitochondrial dysfunction, as

well as with the literature data: in the animal mod-

els of AD and in the samples from the patients, the

increased level of mitochondrial superoxide was ob-

served, which disrupted functioning of the ETC in the

brain microvascular endothelial cells  [68]. It could be

assumed that for further modeling of mitochondrial

dysfunction in the vascular organoids, pharmacologi-

cal induction of stress or development of the methods

for “unifying” cellular composition of the organoids is

likely necessary, since it is known that organoids of-

ten contain immature cells  [69], which may not fully

correspond to the cellular composition of aging tissue

and its metabolic activity.

A limitation of this study is the use of only one

donor per group. This does not allow assessment of

interindividual variability or population range. At the

same time, such a design enables controlled compar-

ison while minimizing the influence of confounding

factors. The observed differences between groups

warrant attention and require replication on inde-

pendent cohorts with a larger number of donors.

CONCLUSION

Vascular organoids derived from iPSCs represent

a promising patient-specific model for studying vas-

cular pathology in various diseases, including neu-

rodegenerative diseases and aging. In the vascular

organoids derived from iPSCs of the patients with

neurodegeneration, signs of metabolic stress could

include decreased expression of the MYC gene, ex-

cessive production of reactive oxygen species by

mitochondria, and changes in mitochondrial poten-

tial. The obtained results could serve as a basis for

further research into the role of vascular pathology

in the pathogenesis of Alzheimer’s and Parkinson’s

diseases.

BLAGOVA et al.1002

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

Abbreviations

AD Alzheimer’s disease

BBB blood–brain barrier

Cx43 connexin 43

iPSC induced pluripotent stem cells

PD Parkinson’s disease

ROS reactive oxygen species

Acknowledgments

The authors express their gratitude to A.  S.  Minin (In-

stitute of Physics and Materials Science, Ural Branch

of the Russian Academy of Sciences) for providing

microwell stamps for spheroid production.

Contributions

A.  V.  Blagova, A.  Satish, E.  S.  Perepelitsa, D.  A.  Lifan-

ov, V.  I.  Zhdankina, and A.  A.  Kopylova – conducting

experiments; A.  V.  Blagova – statistical data analysis;

E.  S.  Perepelitsa and P.  V.  Guk – writing text of the

article; E.  S.  Perepelitsa and A.  V.  Blagova – planning

experiments; A.  B.  Salmina – editing text of the arti-

cle; A.  B.  Salmina and S.  N.  Illarioshkin – conceptual-

ization and administration of the project.

Funding

The work was financially supported by the grant

from the Ministry of Science and Higher Education

of the Russian Federation for implementation of the

large-scale scientific projects in the priority areas

of scientific and technological development (project

no. 075-15-2024-638).

Ethics approval and consent to participate

This article does not describe any studies involving

humans or the use of animals as subjects performed

by the authors. The study was approved by the local

ethics committee of the Federal State Budgetary Sci-

entific Institution “Russian Center of Neurology and

Neurosciences” (protocol no. 8-2/24 dated Septem-

ber16, 2024). Description of cell lines produced from

human cells obtained with their consent is presented

in previous papers, where these cell lines were first

introduced.

Conflict of interest

The authors of this work declare that they have no

conflicts of interest.

REFERENCES

1. Edmondson, R., Broglie, J. J., Adcock, A. F., and Yang, L. (2014) Three-dimensional cell culture systems and

their applications in drug discovery and cell-based biosensors, ASSAY Drug Dev. Technol., 12, 207-218, https://

doi.org/10.1089/adt.2014.573.

2. Ho, B., Pek, N., and Soh, B.-S. (2018) Disease modeling using 3D Organoids derived from human induced plu-

ripotent stem cells, Int. J. Mol. Sci., 19, 936, https://doi.org/10.3390/ijms19040936.

3. Bose, A., Petsko, G. A., and Studer, L. (2022) Induced pluripotent stem cells: a tool for modeling Parkinson’s

disease, Trends Neurosci., 45, 608-620, https://doi.org/10.1016/j.tins.2022.05.001.

4. Dinasarapu, A. R., Sutcliffe, D. J., Ozel, E., Thite, A., Grychowski, L., Visser, J. E., Hess, E. J., Kolk, S. M., and

Jinnah, H. A. (2025) Modeling rare genetic disease with gene-edited induced pluripotent stem cells: relevance

of the starting stock line, Stem Cells Transl. Med., 14, szaf065, https://doi.org/10.1093/stcltm/szaf065.

5. Chiaradia, I., Imaz-Rosshandler, I., Nilges, B. S., Boulanger, J., Pellegrini, L., Das, R., Kashikar, N. D., and

Lancaster, M. A. (2023) Tissue morphology influences the temporal program of human brain organoid develop-

ment, Cell Stem Cell, 30, 1351-1367.e10, https://doi.org/10.1016/j.stem.2023.09.003.

6. Yang, L., Wang, X., Zhou, X., Chen, H., Song, S., Deng, L., Yao, Y., and Yin, X. (2025) A tunable human intestinal

organoid system achieves controlled balance between self-renewal and differentiation, Nat. Commun., 16, 315,

https://doi.org/10.1038/s41467-024-55567-2.

7. Lewis-Israeli, Y.R., Volmert, B.D., Cho,S., Sallam,A., Aguirre,B., Jiang,M., Pestana, C.C., Lovano, M.R., Rollins,M.D.,

Alsayed, A. R., and Aguirre, A. (2021) Self-assembling human heart organoids for the modeling of cardiac de-

velopment and congenital heart disease, Nat. Commun., 12, 5142, https://doi.org/10.1038/s41467-021-25329-5.

8. Wimmer, R. A., Leopoldi, A., Aichinger, M., Kerjaschki, D., and Penninger, J. M. (2019) Generation of blood

vessel organoids from human pluripotent stem cells, Nat. Protoc., 14, 3082-3100, https://doi.org/10.1038/s41596-

019-0213-z.

9. Guelfi, S., Zhang, Y., Garside, G. B., Sreeram, S., Alenga, N. A., Cader, M. Z., and Cowley, S. A. (2025) Murine

vascular organoids are responsive and adaptable 3D systems with cellular heterogeneity and dynamic plasticity,

Sci. Adv., 11, eady4738, https://doi.org/10.1126/sciadv.ady4738.

10. Schmidt, S., To, F. T. K., Schäck, L. M., Solis, M. B. V., Akhyari, P., and Grottke, A. (2022) A blood vessel organoid

model recapitulating aspects of vasculogenesis, angiogenesis and vessel wall maturation, Organoids, 1, 41-53,

https://doi.org/10.3390/organoids1010005.

11. Cheruku, G. R., Wilson, C. V., Raviendran, S., and Xiao, Q. (2024) Recent advances and future perspectives in

vascular organoids and vessel-on-chip, Organoids, 3, 203-246, https://doi.org/10.3390/organoids3030014.

METABOLIC STRESS IN VASCULAR ORGANOIDS 1003

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

12. Naderi-Meshkin, H., He, Y., Sreeram, S., Guelfi, S., Cowley, S. A., and Cader, M. Z. (2023) Vascular organoids:

unveiling advantages, applications, challenges, and disease modelling strategies, Stem Cell Res. Ther., 14, 292,

https://doi.org/10.1186/s13287-023-03521-2.

13. Ahn, Y., An, J. H., Kim, M., Im, I., Son, M. Y., and Woo, D. H. (2021) Human blood vessel organoids penetrate

human cerebral organoids and form a vessel-like system, Cells, 10, 2036, https://doi.org/10.3390/cells10082036.

14. Wimmer, R. A., Leopoldi, A., Aichinger, M., Bouché, N., Nikitscher, B., Kokkinaki, M., Mirazimi, S., Öztürk, M.,

Schnürch, J., Fruhwirth, A., Marcic, A., Abizanda, F., Swerdlow, B. O., Schramek, D., Kornauth, C., Lesnicar-

Pucko, G., Oliver, G., Lemmens, R., Feijen, J. A., Cao, X., Lavender, G., Giamouridis, D., Warton, S. C., Lapinski, J.,

Braumann, H., Grabner, N., Fuchs, S., Killian, M., Gentili, F., Zangi, L., Kerjaschki, D., and Penninger, J. M.

(2019) Human blood vessel organoids as a model of diabetic vasculopathy, Nature, 565, 505-510, https://doi.org/

10.1038/s41586-018-0858-8.

15. Zlokovic, B. V. (2011) Neurovascular pathways to neurodegeneration in Alzheimer’s disease and other disorders,

Nat. Rev. Neurosci., 12, 723-738, https://doi.org/10.1038/nrn3114.

16. Fisher, R. A., Miners, J. S., and Love, S. (2022) Pathological changes within the cerebral vasculature in Alzhei-

mer’s disease: new perspectives, Brain Pathol., 32, e13061, https://doi.org/10.1111/bpa.13061.

17. Paul,G., and Elabi, O. F. (2022) Microvascular changes in Parkinson’s disease – focus on the neurovascular unit,

Front. Aging Neurosci., 14, 853372, https://doi.org/10.3389/fnagi.2022.853372.

18. Raut, S., Patel, R., Pervaiz, I., and Al-Ahmad, A. J. (2022) Abeta peptides disrupt the barrier integrity and glucose

metabolism of human induced pluripotent stem cell-derived brain microvascular endothelial cells, Neurotoxicity,

89, 110-120, https://doi.org/10.1016/j.neuro.2022.01.007.

19. Raut, S., Patel, R., and Al-Ahmad, A. J. (2021) Presence of a mutation in PSEN1 or PSEN2 gene is associated

with an impaired brain endothelial cell phenotype in vitro, Fluids Barriers CNS, 18, 3, https://doi.org/10.1186/

s12987-020-00235-y.

20. Sonninen, T.-M., Hämäläinen, R. H., Muhammad, Z., Földi, M. C., Qu, S., Deng, X., Tan, E.-K., and Malm, T. (2024)

LRRK2 G2019S Mutated iPSC-derived endothelial cells exhibit increased α-synuclein, mitochondrial impairment,

and altered inflammatory responses, Int. J. Mol. Sci., 25, 12874, https://doi.org/10.3390/ijms252312874.

21. Salmina, A. B., Gorina, Y. V., Komleva, Y. K., Panina, Y. A., Malinovskaya, N. A., Lopatina, O. L., Chernykh, A. I.,

and Shabalova, A. A. (2021) Blood-brain barrier and neurovascular unit in vitro models for studying mi-

tochondria-driven molecular mechanisms of neurodegeneration, Int. J. Mol. Sci., 22, 4661, https://doi.org/

10.3390/ijms22094661.

22. Holubiec, M. I., Romero, J. I., Hanschmann, E. M., and Selles, M. C. (2023) Mitochondrial vulnerability to oxi-

dation in human brain organoids modelling Alzheimer’s disease, Free Radic. Biol. Med., 208, 394-401, https://

doi.org/10.1016/j.freeradbiomed.2023.08.028.

23. Hong, Y., Wang, J., Yang, Z., Zhang, J., He, J., Shen, J., Zhou, Y., Cao, J., Li, M., and Zhao, J. (2024) The NAD

pre-

cursor nicotinamide riboside rescues mitochondrial defects and neuronal loss in iPSC derived cortical organoid

of Alpers’ disease, Int. J. Biol. Sci., 20, 1194-1217, https://doi.org/10.7150/ijbs.91624.

24. Jablonska, P., Kunc, M., Kutryb-Zajac, B., Mierzejewska, P., Koszalka, P., and Slominska, E. M. (2022) Differences

in extracellular NAD

and NMN metabolism on the surface of vascular endothelial cells, Biology, 11, 675, https://

doi.org/10.3390/biology11050675.

25. Zhan, R., Xu, K., Ye, S., Wu, Y., Xu, J., Lin, S., Fang, W., Zhou, Y., Zhang, J., and Lou, H. (2023) NAD

res-

cues aging-induced blood-brain barrier damage via the CX43-PARP1 axis, Neuron, 111, 3634-3649.e7, https://

doi.org/10.1016/j.neuron.2023.08.010.

26. Boslett, J., Hemann, C., Christofi, F. L., and Zweier, J. L. (2018) Characterization of CD38 in the major cell types

of the heart: endothelial cells highly express CD38 with activation by hypoxia-reoxygenation triggering NAD(P)H

depletion, Am. J. Physiol. Cell Physiol., 314, C297-C309, https://doi.org/10.1152/ajpcell.00139.2017.

27. Wei, W., Gaffney, D. J., and Chinnery, P. F. (2021) Cell reprogramming shapes the mitochondrial DNA landscape,

Nat. Commun., 12, 5241, https://doi.org/10.1038/s41467-021-25482-x.

28. Skvortsova, E. V., Nazarov, I. B., Tomilin, A.N., and Sinenko, S.A. (2022) Dual mode of mitochondrial ROS action

during reprogramming to pluripotency, Int. J. Mol. Sci., 23, 10924, https://doi.org/10.3390/ijms231810924.

29. Lejri, I., Cader, Z., Grimm, A., and Eckert, A. (2024) Human iPSCs from aged donors retain their mitochondrial

aging signature, Int. J. Mol. Sci., 25, 11199, https://doi.org/10.3390/ijms252011199.

30. Minin,A., Shvachko, A., Gasanov, V., Belogurov, A., and Ivanov, A. (2025) MSLASpheroidStamp: 3d cell spheroids

for everyone, Bioprinting, 49, e00416, https://doi.org/10.1016/j.bprint.2025.e00416.

31. Lifanov, D. A., Surovtseva, M. A., and Pokushalov, E. A. (2026) Generation of vascular organoids from human

iPSCs to study neurodegenerative processes [in Russian], KTBM, 2026, 13-22, https://doi.org/10.47056/1814-3490-

2026-1-13-22.

BLAGOVA et al.1004

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

32. Nanhoe-Mahabier, W., de Laat, K. F., Visser, J. E., Zijlmans, J. C., de Leeuw, F. E., and Bloem, B. R. (2009)

Parkinson disease and comorbid cerebrovascular disease, Nat. Rev. Neurol., 5, 533-541, https://doi.org/10.1038/

nrneurol.2009.136.

33. Duncombe, J., Kitamura, A., Hase, Y., Ihara, M., Kalaria, R. N., and Horsburgh, K. (2017) Chronic cerebral hy-

poperfusion: a key mechanism leading to vascular cognitive impairment and dementia. Closing the translational

gap between rodent models and human vascular cognitive impairment and dementia, Clin. Sci., 131, 2451-2468,

https://doi.org/10.1042/CS20160727.

34. Inoue, Y., Shue, F., Bu, G., and Kanekiyo, T. (2023) Pathophysiology and probable etiology of cerebral small

vessel disease in vascular dementia and Alzheimer’s disease, Mol. Neurodegener., 18, 46, https://doi.org/

10.1186/s13024-023-00640-5.

35. Ma, L., Chen, G., Zhang, J., Li, Y., Wang, X., Wang, Y., and Zhao, J. (2024) CNS resident macrophages enhance

dysfunctional angiogenesis and circulating monocytes infiltration in brain arteriovenous malformation, J. Cereb.

Blood Flow Metab., 44, 925-937, https://doi.org/10.1177/0271678X241236008.

36. Alvarez-Vergara, M. I., Rosales-Nieves, A. E., Ceano-Vivas, M., de la Cueva, M., and Gomez-Nicola, D. (2021)

Non-productive angiogenesis disassembles Aβ plaque-associated blood vessels, Nat. Commun., 12, 3098, https://

doi.org/10.1038/s41467-021-23337-z.

37. Biron, K. E., Dickstein, D. L., Gopaul, R., and Jefferies, W. A. (2011) Amyloid triggers extensive cerebral angio-

genesis causing blood brain barrier permeability and hypervascularity in Alzheimer’s disease, PLoS One, 6,

e23789, https://doi.org/10.1371/journal.pone.0023789.

38. Watanabe, R., and Hashimoto,M. (2022) Aging-related vascular inflammation: giant cell arteritis and neurological

disorders, Front. Aging Neurosci., 14, 843305, https://doi.org/10.3389/fnagi.2022.843305.

39. Göbel, J., Engelhardt, E., Pelzer, P., Sakthivelu, V., Jahn, H. M., Jevtic, M., Folz-Donahue, K., Kukat, C., and

Bergami, M. (2020) Mitochondria-endoplasmic reticulum contacts in reactive astrocytes promote vascular re-

modeling, Cell Metab., 31, 791-808.e8, https://doi.org/10.1016/j.cmet.2020.03.005.

40. Rinaldi, C., Donato, M. F., Daniele, A., and Salvatore, F. (2021) Oxidative stress and the neurovascular unit, Life,

11, 767, https://doi.org/10.3390/life11080767.

41. Ungvari, Z., Tarantini, S., Donato, A. J., Galvan, V., and Csiszar, A. (2018) Mechanisms of vascular aging, Circ.

Res., 123, 849-867, https://doi.org/10.1161/CIRCRESAHA.118.311378.

42. Velmurugan, G. V., Vekaria, H. J., Hartz, A. M. S., Bauer, B., and Hubbard, W. B. (2024) Oxidative stress al-

ters mitochondrial homeostasis in isolated brain capillaries, Fluids Barriers CNS, 21, 81, https://doi.org/10.1186/

s12987-024-00579-9.

43. Tyrrell, D.J., Blin, M. G., Song,J., Wood, S.C., Goldstein, D.R., and Goldstein, J. A. (2020) Age-associated mitochon-

drial dysfunction accelerates atherogenesis, Circ. Res., 126, 298-314, https://doi.org/10.1161/CIRCRESAHA.119.315644.

44. Oldendorf, W. H., Cornford, M. E., and Brown, W. J. (1977) The large apparent work capability of the blood-

brain barrier: A study of the mitochondrial content of capillary endothelial cells in brain and other tissues of

the rat, Ann. Neurol., 1, 409-417, https://doi.org/10.1002/ana.410010502.

45. Shao,Y., Zhao, Y., and Zhang, J. (2025) Endothelial mitochondria in the blood-brain barrier, Fluids Barriers CNS,

22, 88, https://doi.org/10.1186/s12987-025-00699-w.

46. Doll, D. N., Hu, H., Sun, J., Lewis, S. E., Simpkins, J. W., and Ren, X. (2015) Mitochondrial crisis in cerebrovas-

cular endothelial cells opens the blood-brain barrier, Stroke, 46, 1681-1689, https://doi.org/10.1161/STROKEAHA.

115.009099.

47. De La Cueva, M., Antequera, D., Silva, M., and Carro, E. (2022) Amyloid-β impairs mitochondrial dynamics and

autophagy in Alzheimer’s disease experimental models, Sci. Rep., 12, 10092, https://doi.org/10.1038/s41598-022-

13683-3.

48. Brown, H. J., Smith, J. A., and Jones, L. M. (2025) Imbalanced mitochondrial dynamics in human PD and α-sy-

nuclein mouse brains, Neurobiol. Dis., 212, 106976, https://doi.org/10.1016/j.nbd.2025.106976.

49. Averchuk, A. S., Yakovlev, A. A., and Godukhin, O. V. (2023) The neurotoxic effect of β-amyloid is accompa-

nied by changes in the mitochondrial dynamics and autophagy in neurons and brain endothelial cells in the

experimental model of Alzheimer’s disease, Bull. Exp. Biol. Med., 175, 315-320, https://doi.org/10.1007/s10517-

023-05859-2.

50. VanHook, A. M. (2013) ER-derived ROS and mitochondrial dysfunction, Sci. Signal., https://doi.org/10.1126/

scisignal.2004665.

51. Chen, S., Wang, Y., and Zhang, X. (2024) New insights into the role of mitochondrial dynamics in oxidative

stress-induced diseases, Biomed. Pharmacother., 178, 117084, https://doi.org/10.1016/j.biopha.2024.117084.

52. Mercola, J. (2025) Reductive stress and mitochondrial dysfunction: The hidden link in chronic disease, Free

Radic. Biol. Med., 233, 118-131, https://doi.org/10.1016/j.freeradbiomed.2025.03.029.

METABOLIC STRESS IN VASCULAR ORGANOIDS 1005

BIOCHEMISTRY (MOSCOW) Vol. 91 No. 6 2026

53. Yang, R., Guo, Z., and Li, B. (2025) NADH reductive stress drives metabolic reprogramming, Trends Cell Biol.,

36, 177-189, https://doi.org/10.1016/j.tcb.2025.07.005.

54. Dong, Y., Sameni, S., Digman, M. A., and Brewer, G. J. (2019) Reversibility of age-related oxidized free NADH

redox states in Alzheimer’s disease neurons by imposed external Cys/CySS Redox shifts, Sci. Rep., 9, 11274,

https://doi.org/10.1038/s41598-019-47582-x.

55. Ai, R., Zhang, L., and Wang, Y. (2025) NAD

reverses Alzheimer’s neurological deficits via regulating differential

alternative RNA splicing of EVA1C, Sci. Adv., 11, eady9811, https://doi.org/10.1126/sciadv.ady9811.

56. Tapias, V., McCoy, J. L., and Greenamyre, J. T. (2019) Phenothiazine normalizes the NADH/NAD

ratio, maintains

mitochondrial integrity and protects the nigrostriatal dopamine system in a chronic rotenone model of Parkin-

son’s disease, Redox Biol., 24, 101164, https://doi.org/10.1016/j.redox.2019.101164.

57. Ahmad, F., and Sachdeva, P. (2022) Critical appraisal on mitochondrial dysfunction in Alzheimer’s disease, Aging

Med., 5, 272-280, https://doi.org/10.1002/agm2.12217.

58. Kroemer, G., and Reed, J. C. (2000) Mitochondrial control of cell death, Nat. Med., 6, 513-519, https://

doi.org/10.1038/74994.

59. Krohn, A. J., Wahlbrink, T., and Prehn, J. H. M. (1999) Mitochondrial depolarization is not required for neuronal

apoptosis, J. Neurosci., 19, 7394-7404, https://doi.org/10.1523/JNEUROSCI.19-17-07394.1999.

60. Cuenoud, B., Ipek, Ö., Shevlyakova, M., Beaumont, M., Cunnane, S. C., Gruetter, R., and Xin, L. (2020) Brain

NAD is associated with ATP energy production and membrane phospholipid turnover in humans, Front. Aging

Neurosci., 12, 609517, https://doi.org/10.3389/fnagi.2020.609517.

61. Bruzzone,S., Guida, L., Zocchi,E., Franco,L., and Flora, A.D. (2001) Connexin 43 hemichannels mediate Ca

-reg-

ulated transmembrane NAD

fluxes in intact cells, FASEB J., 15, 10-12, https://doi.org/10.1096/fj.00-0566fje.

62. Li, F., Wang, Y., Zeller, K. I., Potter, J. J., Wonsey, D. R., O’Donnell, K. A., Kim, J. W., Yustein, J. T., Lee, L. A.,

and Dang, C. V. (2005) Myc stimulates nuclearly encoded mitochondrial genes and mitochondrial biogenesis,

Mol. Cell. Biol., 25, 6225-6234, https://doi.org/10.1128/MCB.25.14.6225-6234.2005.2005.

63. Graves, J. A., Wang, Y., and Prochownik, E. V. (2012) Mitochondrial structure, function and dynamics are tem-

porally controlled by c-Myc, PLoS One, 7, e37699, https://doi.org/10.1371/journal.pone.0037699.

64. Goetzman, E. S., and Prochownik, E. V. (2018) The role for Myc in coordinating glycolysis, oxidative phosphor-

ylation, glutaminolysis, and fatty acid metabolism in normal and neoplastic tissues, Front. Endocrinol., 9, 129,

https://doi.org/10.3389/fendo.2018.00129.

65. Testini, C., Smith, R. O., Jin, Y., Martinsson, P., Fryknäs, M., and Claesson-Welsh, L. (2019) Myc-dependent endo-

thelial proliferation is controlled by phosphotyrosine 1212 in VEGF receptor-2, EMBO Rep., 20, e47845, https://

doi.org/10.15252/embr.201947845.

66. Yang, W., Zhang, Y., and Li, X. (2025) Impaired mitochondrial metabolism is a critical cancer vulnerability for

MYC inhibitors, Sci. Adv., 11, eadw5228, https://doi.org/10.1126/sciadv.adw5228.

67. Menssen, A., Hydbring, P., Kapelle, K., Vervoorts, J., Sies, H., and Lüscher, B. (2012) The c-MYC oncoprotein, the

NAMPT enzyme, the SIRT1-inhibitor DBC1, and the SIRT1 deacetylase form a positive feedback loop, Proc. Natl.

Acad. Sci. USA, 109, E187-E196, https://doi.org/10.1073/pnas.1105304109.

68. Quintana, D. D., Garcia, J. A., and Simpkins, J. W. (2020) Amyloid-β causes mitochondrial dysfunction via a

-driven upregulation of oxidative phosphorylation and superoxide production in cerebrovascular endothelial

cells, J. Alzheimers Dis., 75, 119-138, https://doi.org/10.3233/JAD-190964.

69. Jensen, K. B., and Little, M. H. (2023) Organoids are not organs: sources of variation and misinformation in

organoid biology, Stem Cell Rep., 18, 1255-1270, https://doi.org/10.1016/j.stemcr.2023.05.009.

Publisher’s Note. Pleiades Publishing remains neutral with regard to jurisdictional claims in published

maps and institutional affiliations. AI tools may have been used in the translation or editing of this article.