ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 12, pp. 1970-1984 © The Author(s) 2025. This article is an open access publication.
Russian Text © The Author(s), 2025, published in Biokhimiya, 2025, Vol. 90, No. 12, pp. 2077-2092.
1970
Progeroid Syndrome with Signs
of Autophagy Dysfunction
in the Naked Mole Rat (Heterocephalus glaber)
Vasiliy N. Manskikh
1,a
*, Eugene V. Sheval
1
, Maria V. Marey
2
,
Olga A. Averina
1
, and Mikhail Yu. Vyssokikh
1,2
1
A. N. Belozersky Research Institute of Physico-Chemical Biology, Lomonosov Moscow State University,
119992 Moscow, Russia
2
V. I. Kulakov National Medical Research Center for Obstetrics, Gynecology, and Perinatology,
Ministry of Health of the Russian Federation, 117997 Moscow, Russia
a
e-mail: manskikh@mail.ru
Received July 1, 2025
Revised November 27, 2025
Accepted November 27, 2025
Abstract— The naked mole rat is considered a unique non-aging mammalian species and is widely used in
laboratories to study the biology of longevity. Previously, our group was the first to describe a new fatal
disease in the naked mole rat, termed “idiopathic cachexia.” A detailed study of pathological changes in the
organs of affected animals, combined with the data on gene expression changes, allows us to interpret this
disease as a highly specific variant of accelerated aging (progeroid syndrome or progeria) in these animals.
Symptoms of the disease include cachexia, cataracts, lipofuscinosis, and appearance of amyloid bodies (corpora
amylacea) in the brain, severe degeneration of cardiomyocytes, fatty degeneration, and generalized lipofus-
cinosis of the liver and kidneys, with signs of autophagy dysfunction in these organs. Further research is
needed to elucidate the mechanism of this disease in animals with negligible aging, such as naked mole rats,
which may provide insights into the mechanisms of aging and lifespan extension.
DOI: 10.1134/S0006297925601960
Keywords: naked mole rat, autophagy, progeria, aging, lipofuscin
* To whom correspondence should be addressed.
INTRODUCTION
Since the publication of Buffenstein etal. [1], the
naked mole rat has been regarded as a mammalian
species with negligible or no aging. Indeed, this ani-
mal exhibits numerous unique features, including an
unusually long lifespan for a rodent (up to 40 years)
[1, 2], no increase in mortality risk with age [1-3],
resistance to spontaneous and induced carcinogenesis
[4-8], many neotenic traits [3], and other physiological
characteristics [9, 10]. Without delving into the debate
about how much the focus on studying these features
is tied to the fascination with a new research sub-
ject, and why similar traits are not studied in other
animals (for example, resistance to tumor growth in
guinea pigs [11]), it must be acknowledged that the
naked mole rat is truly a unique model organism for
studying gerontology. While physiology of this ani-
mal has been extensively studied, its pathology has
received relatively little attention – only a few studies
have broadly described the spontaneous pathology of
the naked mole rat [6, 10, 12-15]. Although several
potentially age-related diseases have been identified
(progressive rodent nephropathy [13, 16], malignant
tumors [6, 14], skin and organ mineralization [12]),
in general, the presence of aging-related pathologies
in this animal remains poorly studied and rarely
debated.
Previously, our research group described a new
disease in the naked mole rats, characterized by a
sharp decline in body weight, a distinctive exter-
nal appearance, ascites, neurological symptoms, and
PROGEROID SYNDROME 1971
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
death of the relatively young individuals (2-6 years
old). This disease was termed “idiopathic cachexia”
[17]. A detailed pathological examination of the de-
ceased and euthanized animals with signs of this
disease revealed a range of morphological and histo-
chemical changes traditionally associated with aging
at the cellular and tissue levels. This article describes
these changes. Since the preliminary data on the mi-
croRNA spectrum in these animals indicated altered
regulation of gene expression related to autophagy
[17], and based on the available morphological data
(lipofuscin accumulation), this study investigated
markers of this process.
MATERIALS AND METHODS
Animal care. A colony of naked mole rats at
the Belozersky Institute of Physico-Chemical Biology,
Lomonosov Moscow State University (comprising 54
individuals), was obtained from a core group import-
ed from the Leibniz Institute for Zoo and Wildlife
Research (IZW) in Berlin, Germany. All animals de-
scribed in this study were from the same colony and
were housed together in a system of cylindrical plas-
tic containers connected by plastic tubes, at 27  ±  1°C
and 50  ±  10% humidity, with a 12/12-hour light/dark
cycle (10:00-22:00 light) and atmospheric ventilation.
The diet consisted of apples, sweet potatoes, carrots,
and grains, provided daily. To enrich the habitat, a
rectangular container with high-density clay, mim-
icking the natural soil of their habitat, was installed.
Six months after the container was introduced, some
worker animals began to lose weight rapidly. The
container was immediately removed after signs of
cachexia were detected in 9 out of 54 animals (3 fe-
males and 6 males, aged 2-6 years). The animals were
then observed for 3 years. To monitor their condi-
tion, the body mass index was measured every 4-5
months in both cachexic and healthy control animals
of the same age (n  =  9; 4 females and 5 males) from
the same colony. Euthanasia was performed by de-
capitation after anesthesia with isoflurane inhalation
(5% at 0.4  L/min flow; Laboratorios Karizoo S.A.,
Spain) using an R500 system (RWD, China).
Necropsy and histopathological examination.
Spontaneously deceased (n  =  2) and euthanized (n = 7)
animals with signs of cachexia underwent patholog-
ical examination. The criteria for euthanasia were
as follows: 15% reduction in body weight and visual
signs of cachexia, ascites, and neurological symptoms
(stupor and ataxia). Additionally, 7 healthy control
animals without signs of cachexia, kept under the
same conditions, were euthanized and examined. All
animals underwent thorough macroscopic examina-
tion. Samples were taken from the heart, lungs, liver,
kidneys, pancreas, mesenteric lymph nodes, spleen,
brain, adrenal glands, stomach, large and small in-
testines, skin, skeletal muscles, thyroid gland, salivary
glands, eyes, and reproductive organs.
Organ samples were fixed in a 10% formalin (and
in some cases, zinc formalin, Champy’s, Carnoy’s, and
Bouin’s mixtures), dehydrated in a 99.7% isopropa-
nol (Biovitrum, Russia), and embedded in a paraffin
(Biovitrum), followed by staining with hematoxylin
and eosin using a routine protocol [18]. Microscopic
examination was performed using an AxioScope  A1
microscope (Carl Zeiss, Germany), and microphoto-
graphs were taken with an MRc.5 camera (Carl Zeiss).
Identified changes were classified according to
the criteria accepted in the pathology of laboratory
animals [19-22].
Histochemical examination. Paraffin sections
(3  µm) were examined unstained using a fluorescence
microscope with a FITC filter (excitation at 493  nm),
stained with Sudan IV, Schmorl’s method (for lipo-
fuscin), Giemsa, PAS, Warthin–Starry (for bacteria),
Van Gieson (for collagen), Altman (for mitochondria),
Lepehne–Pickworth (for hemoglobin), Landrum (for
intracellular protein granules), Stein, Fouchet (for
bilirubin), and Perl’s method (for hemosiderin) us-
ing routine protocols [18]. Additionally, immunohis-
tochemical examination of the brain was performed
using rabbit monoclonal antibodies against beta-amy-
loid (ab201060; Abcam, USA; dilution 1  :  1000), using
standard immunoperoxidase techniques on paraffin
sections after heat-induced epitope retrieval in a ci-
trate buffer (pH  6.0), with a detection system (Cell
Margue, USA) and appropriate positive and negative
controls.
For score assessment of changes, the following
criteria were used: hepatic lipofuscinosis (0 – none,
1 – pigment visible in individual hepatocytes, 2 – pig-
ment present in most hepatocytes in the perinuclear
zone, 3 – pigment present in all hepatocytes); fatty
degeneration (0 – none, 1 – fatty degeneration in indi-
vidual cells, 2 – involvement of up to 50% of hepato-
cytes, 3 – involvement of more than 50% of hepato-
cytes); myocardial degeneration (0 – none, 1 – single
foci, 2 – multiple foci, 3 – total involvement); cataract
(0 – none, 1 – single subcapsular foci, 2 – involve-
ment of less than 50% of the lens, 3 – involvement of
more than 50% of the lens); amyloid deposits in the
thalamus (0 – none, 1 – single deposits per section,
2 – single deposits in each 1000× microscope field, 3–
multiple deposits in each field); renal lipofuscinosis
(0 – none, 1 – present in individual tubules, 2 – in-
volvement of up to 50% of tubules, 3 – involvement
of more than 50% of tubules).
Electron microscopy. Samples of liver and
kidney tissues were taken for electron microsco-
py. Tissue samples (0.5×0.5×1  mm) were fixed in a
MANSKIKH et al.1972
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
Table 1. Gene-specific primers for autophagy marker genes and the reference gene
Gene Forward primer; Tm (°C) Reverse primer; Tm (°C)
p62 GCTGTCTGCCCTGTTTTCAT; 58.75 GGCCCAAGTGCTATTCACAG; 58.90
LC3b AAGAGTGGAAGACGTTCGGC; 60.32 GGTTTTATCCAGGACGGGCA; 60.03
ATG14 AAGCAGAGAGGCAAACTCCC; 59.96 TGTGATCAGCTCTTGGGAACT; 59.02
ATG9a TGCATGCTCTACGAATCCCC; 59.89 GAAACAGAGAGCCAGGTCCC; 60.04
GAPDH TGGCAAGGTGGATATCGTGG; 59.82 CTTCTCGTGGTTCACACCCA; 59.89
Note. Tm, melting temperature.
2.5% glutaraldehyde (Sigma, USA) in a cacodylate
buffer, post-fixed in 1% OsO
4
(EMS, USA), dehydrat-
ed in ethanol and acetone, and embedded in SPI-Pon
812 (Structure Probe, Inc., USA). Ultrathin sec-
tions were made using a diamond knife (DiATOME,
USA) and mounted on copper slot grids (Ted Pella,
USA). Sections were stained with uranyl acetate and
lead nitrate and examined using a JEM 1400 elec-
tron microscope (JEOL, Japan) at accelerating voltage
of 80 kV.
Gene expression analysis of autophagy mark-
ers. Liver tissue samples obtained at necropsy (n = 6
for both cachexic and control animals) were mechan-
ically homogenized in liquid nitrogen and lysed in an
ExtractRNA reagent (Evrogen, Russia). Total RNA was
isolated using a standard method with a guanidine
thiocyanate/phenol/chloroform mixture. RNA con-
centration was determined using a NanoPhotometer
(Implen, Munich, Germany) at 260/240 nm. Reverse
transcription was performed using a RevertAid First
Strand cDNA Synthesis Kit (Thermo Scientific, USA).
Quantitative reverse transcription PCR (RT-qPCR)
was performed in real-time using a qPCRmix-HS
SYBR+LowROX (5X) kit (Evrogen) with gene-specific
primers (Evrogen) (Table 1). Primers were selected
using the Primer Blast service (https://www.ncbi.nlm.
nih.gov/tools/primer-blast/). Primer validation was
performed by matching melting temperature (Tm)
with the calculated value (provided in Table 1). For
negative control, RNA isolated from Escherichia coli
after reverse transcription was used as a template,
as described above. Amplification and detection were
performed using a DT Prime 4 amplifier (DNA-Tech-
nology, Russia). For all primers, absence of DNA
contamination in the isolated RNA samples was con-
firmed by performing amplification without reverse
transcription under the described conditions and
parameters. No DNA contamination was detected in
the samples. Gene expression analysis was performed
using the 2
−ΔΔCt
method, with GAPDH as the reference
gene. Results were normalized to the average expres-
sion level of GAPDH.
Electrophoresis and Western blot analysis.
Electrophoresis in 12% polyacrylamide gel was per-
formed using a routine method with minor modifica-
tions described previously [23]. Liver tissue fragments
obtained at necropsy (n = 3 for both cachexic and
control animals) were lysed in a buffer containing:
150 mM NaCl, 50 mM Tris-HCl (pH 8.0), 0.5% Nonidet
P-40, 1% sodium deoxycholate, 0.5% sodium dodecyl
sulfate, and protease inhibitors (Thermo Fisher Sci-
entific, USA). After separation (30 µg of protein per
lane), proteins were electrophoretically transferred to
a nitrocellulose membrane (Bio-Rad, USA) and incu-
bated with diluted antibodies using a routine meth-
od. Primary antibodies included rabbit monoclonal
antibodies against mouse proteins ATG14 (ab315009;
dilution 1  :  1000), ATG9a (ab108338; dilution 1  :  1000),
and rabbit polyclonal antibodies against mouse pro-
teins p62 (ab91526; concentration 1  µg/mL) [24, 25]
and housekeeping protein beta-actin (ab8227; dilution
1  :  2000) [26], obtained from Abcam; and antibodies
against LC3b (Cell Signaling, USA; #2775; dilution
1  :  1000) [25]. Dilution was performed as recom-
mended by the manufacturers in a buffer containing
150  mM NaCl, 50mM Tris-HCl (pH 7.5), 0.1% Tween  20,
and 1% bovine serum albumin. Secondary antibodies,
conjugated with horseradish peroxidase and specific
to rabbit antibodies, were diluted in the same buffer
at a ratio of 1  :  20,000 according to the manufactur-
er’s recommendations (ab6721; Abcam). Luminescent
signal was visualized using a Novex ECL kit (Invitro-
gen, USA) and a ChemiDoc scanner (Bio-Rad). Due to
the lack of commercially available antibodies against
Heterocephalus glaber proteins, validation of anti-
bodies against ATG14 and ATG9a, used for the first
time, was performed by aligning the peptide antigen
sequences used by the companies to produce antibod-
ies against the protein sequences of the naked mole
rat, obtained using the online services at https://
www.uniprot.org/ and the database at http://naked-
mole-rat.org/annotations/details/XP_004871135.1/
and http://naked-mole-rat.org/annotations/details/
XP_004864595.1/ for ATG14 and ATG9a, respectively.
PROGEROID SYNDROME 1973
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
In all cases, suitability of the antibodies for the naked
mole rat was established by the presence of a single
specifically stained band corresponding to the molec-
ular weight and mobility of the protein under study.
Protein concentration determination. Protein
concentration in the samples for Western blot analy-
sis was determined using bicinchoninic acid and
bovine serum albumin as a standard, following the
manufacturer’s recommendations (Pierce, USA).
Statistical analysis. Data analysis was performed
using GraphPad Prism 8. Data were first tested for
Gaussian distribution using the D’Agostino & Pearson
omnibus normality test, then analyzed using Student’s
t-test, Mann–Whitney test, or one-way ANOVA. Results
are presented as a mean ± standard deviation (SD).
Differences were considered significant at p < 0.05.
RESULTS
Clinical characteristics of the disease. Clinical
manifestations of the disease have been described in
detail previously [17]. In all cases, the affected ani-
mals were worker individuals. Visually, the animals
appeared severely emaciated, with sunken flanks
and a pointed snout, resembling appearance of the
30-year-old naked mole rats [9]. Objective examina-
tion of animals with signs of cachexia revealed a 15%
reduction in the body mass index compared to the
control animals from the same colony [17]. Despite
this, they exhibited the same feeding behavior as
other animals. Immediately before death, the animals
displayed neurological symptoms, including stupor or
ataxia with rolling onto their backs when attempting
to move.
All animals exhibited similar changes, although
to varying degrees. At necropsy, signs of cachexia and
complete absence of visible fat deposits were noted.
The liver was typically dark brown, and a light-yel-
low transparent fluid (ascites) had accumulated in
the abdominal cavity. The kidneys were pale yellow.
Other organs were proportionally reduced in size but
without visible pathological changes.
Histopathological analysis results. Microphoto-
graphs showing structure of the organs in the healthy
control naked mole rats, for comparison with the
pathologically altered organs, are provided in Fig.  1
due to the rarity of this animal.
Liver. The most severe changes in the affect-
ed animals were found in the liver and have been
partially described previously [17]. Despite the over-
all preservation of organ architecture (no signs of
lobule deformation or fibrosis), significant changes
were observed in hepatocytes and stromal cells. The
cytoplasm of hepatocytes contained a large number
of light-brown pigment granules that, when treated
with osmium tetroxide (Champy’s fixation), stained
intensely black-brown, green with Giemsa, exhibited
strong autofluorescence in paraffin sections, stained
weakly with Sudan IV and PAS, did not give a pos-
itive Perl’s reaction for iron or a reaction for bili-
rubin, but stained blue-green with Schmorl’s meth-
od (Fig. 2, a-d). These histochemical properties are
characteristic of the “aging pigment” (lipofuscin)[27].
Large amounts of this pigment accumulate in the peri-
nuclear region of cells, which become hypertrophied,
binucleated, and have markedly enlarged nucleoli.
Hypertrophy of the cells is always localized in the
periportal zone of the lobules. In the hypertrophied
cells, along with lipofuscin, numerous eosinophilic
granules are visible, which stain red with Altman’s
method (after Champy’s fixation), characteristic of mi-
tochondria; and both pigment and mitochondria are
concentrated in the perinuclear zone (Fig. 2d). When
stained with Lepehne–Pickworth and Landrum, the
phagocytosed erythrocytes were occasionally visible
in the cytoplasm of individual hypertrophied he-
patocytes (Fig. 2e). Some liver cells, on the contrary,
undergo atrophy and fatty degeneration with accu-
mulation of large lipid droplets (stained black after
fixation with Champy’s mixture with OsO
4
). Among
the hypertrophied hepatocytes, foci of extramedul-
lary hematopoiesis, unusual for the liver of the naked
mole rat, are sometimes observed. Kupffer cells (liv-
er macrophages) show strong accumulation of hemo-
siderin (giving a positive reaction for trivalent iron
with Perl’s method), reaching a degree characteristic
of hemochromatosis (Fig.  2f). These changes were not
observed in the animals without signs of cachexia; a
species-specific feature of hepatocytes in the healthy
naked mole rats is optically clear cytoplasm, due to
their high glycogen content (Fig.  1a).
Kidneys. In the kidneys, in addition to calcium
phosphate deposits characteristic of all naked mole
rats (including those without signs of disease), intra-
cellular deposits of lipofuscin, numerous small lipid
droplets in the cells of the proximal tubules, and he-
mosiderin in the individual tubules were found (Fig.  3,
a andb). The renal glomeruli were unchanged. These
changes were not found in the kidneys of healthy an-
imals (Fig. 1b).
Heart. Changes in the heart included severe vac-
uolar degeneration and atrophy of cardiomyocytes in
the walls of both ventricles (Fig.  3c), as well as ac-
cumulation of a small amount of brown pigment in
the individual cardiomyocytes, similar to that found
in hepatocytes. The myocardium of healthy animals
showed no changes (Fig. 1c).
Eyes. The examined animals exhibited previous-
ly undescribed eye lesions. These appeared as typi-
cal degeneration of peripheral lens fibers with swell-
ing, clearing, and formation of Morgagnian spheres,
MANSKIKH et al.1974
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
Fig. 1. Histological appearance of internal organs in healthy naked mole rats. a) Liver; b) kidney; c) myocardium; d) eye
lens; e) cerebellum; f) thalamus. Staining methods: a-d) hematoxylin and eosin; e) PAS (with hematoxylin counterstain);
f)Immunoperoxidase reaction with antibodies against beta-amyloid with PAS and hematoxylin counterstain. Scale bars and
magnifications: a, b, e, f) 40 µm, 1000×; c, d) 100 µm, 400×.
characteristic of cataracts (Fig.3d), but not in the eyes
of intact naked mole rats (Fig.1d). The retina, choroid,
cornea, and other eye structures were unchanged.
Brain. Significant changes were found in the
brain. The PAS-positive pigment inclusions, similar to
those in hepatocytes, were detected in the neurons
PROGEROID SYNDROME 1975
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
Fig. 2. Changes in the liver of naked mole rats with cachexia. a) A large number of dark brown pigment granules in the
cytoplasm of hepatocytes; b) autofluorescence of pigment granules (lipofuscin); c) positive dark blue staining of pigment
granules in hepatocytes with Schmorl’s method; d) dark brown pigment granules among numerous large mitochondria
(pink) concentrated in the perinuclear zone of hepatocytes, black deposits – lipid droplets; e) erythrocytes (pink, arrows)
in the cytoplasm of individual hepatocytes; f) intense accumulation of iron-containing pigment (hemosiderin) in Kupffer
cells (blue). Scale bars and magnifications: a-e)40µm, 1000×; f)200µm, 200×. Staining methods: a)Hematoxylin and eosin;
b) Unstained paraffin section, FITC filter, excitation at 493 nm; c) Schmorl’s reaction; d) Altman’s staining after Champy’s
fixation (with OsO
4
); e) Landrum’s staining; f) Perl’s reaction with nuclear fast red counterstain.
MANSKIKH et al.1976
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
Fig. 3. Changes in various internal organs of naked mole rats with cachexia. a) Unchanged renal glomerulus; b) Numer-
ous granules of lipofuscin (brown) and lipid droplets (black) in the cytoplasm of tubules; c) Severe degenerative changes
in the myocardium without inflammatory reaction; d) Cataract, area of lens damage (asterisk) with Morgagnian spheres;
e) Degenerative changes in some Purkinje neurons of the cerebellum (arrows); f) PAS-positive deposits of lipofuscin in
some Purkinje neurons of the cerebellum (arrows); g)PAS-positive amyloid bodies (corpora amylacea) in the neuropil of the
thalamus; h)Positive reaction of intracellular deposits in neurons (white arrows) and amyloid bodies (black arrows) of the
thalamus with antibodies against human beta-amyloid. Staining methods: a, c, d, e)Hematoxylin and eosin; b)Hematoxylin
after fixation with Champy’s mixture (with OsO
4
); f, g) PAS reaction with hematoxylin counterstain; h) Immunoperoxi-
dase reaction with antibodies against beta-amyloid with PAS and hematoxylin counterstain. Scale bars and magnifications:
a-d) 100 µm, 400×; e-h) 40 µm, 1000×.
PROGEROID SYNDROME 1977
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
Fig. 4. Ultrastructural changes in the kidney tubule cells and hepatocytes in the animals with cachexia. a, b) Kidney tu-
bule cells of a healthy naked mole rat; c, d) kidney tubule cells of a cachexic naked mole rat; e, f) liver cells of a healthy
naked mole rat; g, h) liver cells of a cachexic naked mole rat. N, nuclei; g, glycogen granules; m, mitochondria. Asterisks
indicate structures morphologically similar to autophagosomes; arrows indicate lipofuscin granules or their accumulations.
Scale bars: a, c, e, g) 2 µm; b, d, f, h) 1 µm.
MANSKIKH et al.1978
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
Table 2. Results of the score assessment of the severity of the most important pathological changes in organs
Group
Hepatic
lipofuscinosis
Hepatic fatty
degeneration
Myocardial
degeneration
Cataract
Amyloid deposits
in the thalamus
Renal
lipofuscinosis
Control
(M ± SD, n = 7)
0000 (n = 5) 0 0
Cachexia
(M ± SD, n = 9)
2.3 ± 0.7 1.3 ± 0.5 1.6 ± 0.7 1.6 ± 0.8 (n = 5) 2.0 ± 0.9 1.3 ± 0.5
Note. In all cases, p < 0.01.
from various regions. Particularly numerous were
these inclusions in the Purkinje neurons in the
cerebellar cortex, which also showed signs of de-
generation, such as eosinophilic shrunken neurons
(Fig. 3, e-f). Additionally, vacuolar changes were ob-
served in the neuropil around the third ventricle,
and amyloid-like PAS-positive inclusions in the neu-
ropil (corpora amylacea) and PAS-positive granules
in the cytoplasm of neurons in various brain regions
(Fig.  3g). A particularly large number of amyloid
bodies were found in the thalamus and hypothala-
mus. Staining with antibodies against beta-amyloid
did not reveal plaques typical of Alzheimer’s disease,
but most PAS-positive granules in the cytoplasm of
neurons and in the neuropil gave a positive reaction
(Fig.3h). None of these changes were observed in the
brains of healthy naked mole rats of the same age
(Fig. 1, e-f).
Other organs. It is important to note that histo-
pathological changes in other organs (including skele-
tal muscles) were not constant and included minimal
deposits of brown pigments (lipofuscin, hemosiderin).
Bacteria and virus-like inclusions were not found in
any organ in any case.
The results of the score assessment of the sever-
ity of the most important pathological changes in the
organs and tissues are summarized in Table 2.
Electron microscopy examination. Liver. Ultra-
thin sections of the liver of a healthy naked mole rat
showed hepatocytes with one or two nuclei (Fig. 4a).
Cytoplasm of the cells contained numerous mito-
chondria and surrounding endoplasmic reticulum
components (Fig.  4b). No pathological changes were
observed in these organelles. The cytosol was filled
with numerous glycogen accumulations, visible only
in hepatocytes and absent, for example, in the near-
by endothelial cells. Due to the large amount of gly-
cogen, the cytoplasm of hepatocytes appeared dark,
and membrane organelles and nuclei appeared light-
ly stained against this background. In the hepatocytes
of cachexic naked mole rats, the same organelles
were observed, although the amount of glycogen was
visually lower (Fig.  4, c and d). The cells contained
single, sometimes quite large (up to 5  µm) lipid drop-
lets. Notably, hepatocytes contained large accumula-
tions of lipofuscin granules (Fig. 4, e and f). These
granules always occupied a localized area of the cy-
toplasm, usually closer to the nucleus. Viral particles
and areas of their assembly (viral inclusions) were
not detected.
Kidney. For analysis, transverse sections of prox-
imal and distal tubules were selected; for illustration,
only photographs of proximal tubules are provided.
Epithelial cells forming the walls of the tubules in
the kidney of a healthy naked mole rat contained
a large number of mitochondria, and no lipofuscin
granules were detected (Fig.  4, eand f). In the tubule
cells of the cachexic naked mole rats, severely dam-
aged swollen mitochondria were observed, in which
cristae were difficult to detect (Fig.  4, g and h). It is
important to note that mitochondrial damage in the
cells of different tubules varied from minimal to very
severe (Fig.  4h). However, in all cases within a single
tubule, mitochondria in different cells had approxi-
mately the same morphology, i.e., the same level of
damage. Large inclusions, possibly autophagosomes,
were found in the cells of the proximal tubules. Viral
particles and areas of their assembly (viral inclu-
sions) were not detected in either the nuclei or the
cytoplasm of the cells.
Expression of autophagy marker genes and
proteins. To study autophagy in the liver of the na-
ked mole rat, four marker proteins were selected:
ATG9a, ATG14, p62, and the LC3II/LC3I ratio. Classi-
cal markers for assessing autophagic flux activity are
decrease in p62 (degraded in autophagosomes) and
increase in the relative content of the lipidated form
of LC3 (LC3II), whose accumulation depends on for-
mation of autophagosomes. ATG14 and ATG9a are ad-
ditional marker proteins known to be involved in the
processes of initiation and elongation of phagophore
membranes, closure of autophagosome, and delivery
of endosomal material to lysosomes.
Analysis of the content of autophagy marker pro-
teins in the liver tissues by immunoblotting showed
a significant increase in the content of p62, ATG14,
and ATG9a proteins (Fig.  5) and decrease in the LC3II/
LC3I ratio.
PROGEROID SYNDROME 1979
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
Fig. 5. Changes in the relative content of autophagy marker proteins ATG14, ATG9a, p62, and the LC3II/LC3I ratio in the
liver tissue of cachexic animals compared to the normal naked mole rats. a) Diagrams showing a significant (in all cases,
p<0.05) increase in the content of proteins (in arbitrary units, normalized to beta-actin) ATG14, ATG9a, p62, and a decrease
in the LC3II/LC3I ratio. b) Photographs of individual electropherograms of autophagy marker proteins ATG14, ATG9a, p62,
LC3II, LC3I, and housekeeping protein beta-actin from the liver of healthy and cachexic animals.
Fig. 6. Relative expression of mRNA of the ATG14, ATG9a, LC3b, and p62 genes in the liver tissue for cachexic and normal
animals. Data represent the mean value of 2
−ΔΔCt
in the group ± SD; ** p < 0.01; *** p < 0.001.
MANSKIKH et al.1980
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
Using quantitative PCR, a significant increase in
the expression levels of the p62, ATG14, and ATG9a
genes and a significant decrease in the mRNA level
for LC3b in the liver tissue of cachexic animals com-
pared to the normal animals were revealed (Fig.  6).
DISCUSSION
From the detailed description of the pathologi-
cal changes found in the organs of naked mole rats
with signs of the disease, it is clear that this disease,
previously designated by us as “idiopathic cachexia,”
does not resemble any known disease of laborato-
ry rodents [19-22], including pathological conditions
known in the naked mole rat [12-15]. Recently, in
the study of brain samples from the naked mole rats
aged 5-27 years, changes similar to those observed in
our animals were described [28], but the authors did
not mention the results of examining other organs
in these animals or the symptoms observed during
life. The pathological changes we found explain clin-
ical picture of the disease well. Massive damage to
the kidneys, myocardium, and especially liver could
explain the weight loss (cachexia) and ascites found
during macroscopic examination. Damage to the cer-
ebellar neurons explains ataxia (inability to main-
tain posture) observed during the animals’ lifetime.
Damage to the myocardium and brain was severe
enough to lead to the animals’ death. No signs indi-
cating an infectious nature of the disease were found
during careful examination.
The study of molecular markers provided some
information about the processes that may be asso-
ciated with the morphological changes described in
this article. Previously, we showed that in the liver of
cachexic animals, the expression level of microRNA
nmr-miR-15b-5p, whose targets include mRNAs of
proteins such as ATG14 and ATG9a [17], significantly
decreases. These proteins are important components
of the autophagy cascade [29]. It has been estab-
lished that regulation of the expression of the ATG14
and ATG9a genes by small non-coding RNA of the
miR- 15-5p family is significant, particularly for the
age-related pathology such as non-alcoholic fatty liv-
er disease, in which a decrease in the level of this
microRNA is observed [30]. In this study, we analyzed
the content of protein products of the genes respon-
sible for autophagy and their mRNA in the liver of
sick naked mole rats. These data show that the ex-
pression levels of several genes increased, while the
expression level of the LC3b gene decreased sharply.
The product of this gene plays a key role in the nor-
mal autophagic flux, ensuring both capture of mate-
rial for degradation by the phagophore and closure
of the phagophore membranes and formation of the
autophagosome [31, 32]. Consequently, deficiency of
this protein should lead to autophagy dysfunction al-
ready at the stage of phagophore formation and ex-
pansion. Although we detected structures resembling
autophagosomes, a significant decrease in the LC3II/
LC3I ratio serves as a clear indication of the defect
in their formation and decrease in autophagic flux.
In this regard, increase in the content of the p62
protein in the cells, which is usually degraded in au-
tophagosomes along with its marked targets [31-33],
could be associated not so much with its hyperexpres-
sion as with the reduced degradation. It is important
to note that the increase in the p62 protein has al-
ready been described as a marker of autophagy
disorders during aging [34]. The increase in expres-
sion and content of other proteins responsible for
initiation and elongation of phagophore membranes
(ATG9a, ATG14) [31] could be a cellular compensatory
reaction to ineffective autophagy. Another evidence
of defective autophagy is accumulation of lipofuscin
in cells, which indicates inefficiency of another stage
of this process – lysosomal degradation. Thus, along
with the increase in factors responsible for the initi-
ation of autophagy, there are signs of its clear dys-
function and inefficiency at the subsequent stages.
Elucidating the causes of such complex dysfunction
requires additional research. However, it is important
to note that autophagy disorders (blockade of ATG9a–
Fam134b–LC3β and ATG9a–Sec62–LC3β interactions,
as well as impaired reticulophagy – autophagic pro-
cessing of the endoplasmic reticulum) have already
been described as a mechanism leading to the devel-
opment of a progeroid phenotype in mice [35].
In summary, the following conclusion could be
drawn about the nature of the disease we observed
in naked mole rats. The dominant changes in the his-
topathological picture of the disease are generalized
lipofuscinosis in the liver, kidneys, brain, and, to a
lesser extent, the myocardium, which is accompa-
nied by severe emaciation (making sick animals re-
semble 30-year-old naked mole rats), the appearance
of amyloid bodies (corpora amylacea) in the brain,
and the development of cataracts in the lens. All
such changes are classified as characteristic of aging,
and therefore, the disease we previously described
as “idiopathic cachexia” (the term “idiopathic” re-
fers to diseases of unclear etiology) could be clas-
sified as a type of progeria or progeroid syndrome.
The results of studying marker genes and proteins
LC3b, p62, ATG9a, ATG14, together with morpholog-
ical signs (detection of numerous lipofuscin gran-
ules and lipid droplets by light microscopy and au-
tophagosomes by electron microscopy), suggest that
in this case, there is a dysfunction of autophagy [36,
37] accompanied by the hyper-expression and hy-
per-activation of some of its factors and pathways
PROGEROID SYNDROME 1981
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
and deficiency of the others. Therefore, the discov-
ered disease could be called “progeroid syndrome
with signs of autophagy dysfunction.” In this case,
it should be noted that the disruption of autophagy
processes may be either the cause of fatal changes
in the organs and tissues of animals or only one of
the pathogenetic components, which, nevertheless, is
a significant feature of this disease. The cause of the
development of this progeroid state, as we previously
suggested [17], may be an inadequate activation of
metabolism (with a sharp excess of catabolism over
anabolism) when animals are under normoxic condi-
tions (21% oxygen, while the usual content for natu-
ral colonies is 8-16%). Possibly, this is associated with
the long-term effects of oxidative stress developed
under normoxia against the background of constant
heavy physical exertion (all cachexic animals belong
to the group of workers engaged in digging tunnels in
dense clay to obtain food delivered to other members
of the colony).
It is important to compare this disease with other
conditions in humans and animals that are consid-
ered progerias. Unfortunately, despite the availability
of a significant amount of information on the molec-
ular mechanisms of progeria in humans, morphologi-
cal changes in the organs of such patients have been
poorly studied – there are only few reports of such
studies [38, 39]. There is also little data on progeria
in the laboratory animals [40]. Analysis of informa-
tion on the changes in the Werner’s disease and espe-
cially Hutchinson–Gilford syndrome shows that these
genetic diseases have symptoms both coinciding with
the course of natural aging and sharply differing
from it. For example, the characteristic deformation
of the skull, agenesis of the clavicle, scleroderma-like
skin changes, and hypognathia in the Hutchinson–
Gilford progeria are not typical of normal aging, and
the spectrum of tumors in the Werner’s syndrome
is not similar to that known for the elderly [39].
Pathology of natural aging in the laboratory rodents,
and, in particular, in mice, differs radically from the
human aging. Mice do not develop type 2 diabetes,
atherosclerosis (and associated ischemic brain and
heart damage), or Alzheimer’s disease, but they do
exhibit emaciation, lipofuscinosis, hair loss, atrophy
of lymph nodes and spleen, cataracts, and cardiomy-
opathy [22]. Mouse lines with mutations considered
as genetic models of progeria have extremely diverse
and dissimilar phenotypes, often affecting some tis-
sues and not others [40]. For obvious reasons, we
cannot say to what extent the changes we observe
correspond to the pathology of “normal aging” in
an animal such as the naked mole rat, but they are
quite consistent with those by which mutant mice
are classified as models of progeria [40]. At the same
time, the age-related signs such as hair loss, atrophic
changes in the gonads, or atrophy of lymph nodes
and spleen cannot be registered in the naked mole
rat due to its anatomical features (lack of hair and
atrophic changes in the gonads and lymphoid tissue
in the normal young worker animals) [10]. The dif-
ference between the disease we described and clas-
sical progerias in humans is that their manifestation
depends only on the genotype, without provoking
factors, or rather, such factors are unknown. How-
ever, in the case of autophagic progeroid syndrome,
the genetic factor is obviously significant, since it was
noted only in a small part of the animals. It is pos-
sible that we are dealing with, conditionally speak-
ing, a “reverse mutation,” restoring the type and rate
of aging characteristic of all other rodents in the
naked mole rat.
CONCLUSION
Thus, in an animal with negligible aging – the
naked mole rat – a condition was discovered that,
based on a number of signs, could be attributed to
the phenomena of accelerated aging (progeroid syn-
dromes or progeria). The exact mechanism of this
process requires further study, but our data indicate
autophagy dysfunction as a possible pathogenetic
mechanism of this syndrome.
STUDY LIMITATIONS
The limitations of this study include the follow-
ing circumstances mainly associated with working
with such a unique animal as the naked mole rat: rel-
atively small size of the studied sample, inability to
definitively prove a causal relationship between the
identified autophagy disorders and all the described
morphological manifestations of the progeroid pheno-
type, and retrospective nature of the studies.
Contributions
V. N. Manskikh and M. Yu. Vyssokikh – concept and
supervision of the work; V. N. Manskikh, E. V. Sheval,
M. V. Marey, and O. A. Averina – conducting the study
(O. A. Averina – animal observation, V. N. Manskikh –
histopathological analysis, E. V. Sheval – electron mi-
croscopy, M. V. Marey – analysis of gene and protein
marker expression of autophagy); V. N. Manskikh –
writing the text; E. V. Sheval and M. Yu. Vyssokikh –
editing the text of the article.
Funding
This work was financially supported by the Ministry
of Science and Higher Education of the Russian Feder-
ation (Agreement no.075-15-2025-489).
MANSKIKH et al.1982
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
Ethics approval and consent to participate
All applicable international, national, and/or insti-
tutional guidelines for the care and use of animals
were followed. The study protocol was approved by
the Ethics Committee of the Belozersky Institute of
Physico-Chemical Biology, Lomonosov Moscow State
University (Protocol 2/20 dated 16.11.2022).
Conflict of interest
The authors of this work declare that they have no
conflicts of interest.
Open access
This article is licensed under a Creative Commons At-
tribution 4.0 International License, which permits use,
sharing, adaptation, distribution, and reproduction
in any medium or format, as long as you give appro-
priate credit to the original author(s) and the source,
provide a link to the Creative Commons license, and
indicate if changes were made. The images or other
third party material in this article are included in the
article’s Creative Commons license, unless indicated
otherwise in a credit line to the material. If materi-
al is not included in the article’s Creative Commons
license and your intended use is not permitted by
statutory regulation or exceeds the permitted use,
you will need to obtain permission directly from the
copyright holder. To view a copy of this license, visit
http://creativecommons.org/licenses/by/4.0/.
REFERENCES
1. Buffenstein, R. (2005) The naked mole-rat: a new
long-living model for human aging research, J.Geron-
tol. A Biol. Sci. Med. Sci., 60, 1369-1377, https://
doi.org/10.1093/gerona/60.11.1369.
2. Buffenstein, R. (2008) Negligible senescence in the
longest living rodent. the naked mole rat: insights
from a successfully aging species, J.Comp. Physiol.,
178, 439-445, https://doi.org/10.1007/s00360-007-0237-5.
3. Skulachev, V.P., Holtze,S., Vyssokikh, M.Y., Bakeeva,
L. E., Skulachev, M. V., Markov, A. V., Hildebrandt,
T. B., and Sadovnichii, V. A. (2017) Neoteny, prolon-
gation of youth: from naked mole rats to “naked
apes” (humans), Physiol. Rev., 97, 699-720, https://
doi.org/10.1152/physrev.00040.2015.
4. Liang, S., Mele, J., Wu, Y., Buffenstein, R., and
Hornsby, P. J. (2010) Resistance to experimental tu-
morigenesis in cells of a long-lived mammal, the
naked mole-rat (Heterocephalus glaber), Aging
Cell, 9, 626-635, https://doi.org/10.1111/j.1474-9726.
2010.00588.x.
5. Miyawaki, S., Kawamura, Y., Oiwa, Y., Shimizu, A.,
Hachiya, T., Bono, H., Koya, I., Okada, Y., Kimura, T.,
Tsuchiya, Y., Suzuki, S., Onishi, N., Kuzumaki, N.,
Matsuzaki, Y., Narita, M., Ikeda, E., Okanoya, K.,
Seino, K., Saya, H., Okano, H., and Miura, K. (2016)
Tumour resistance in induced pluripotent stem cells
derived from naked mole-rats, Nat. Commun., 7,
11471, https://doi.org/10.1038/ncomms11471.
6. Delaney, M.A., Ward, J.M., Walsh, T.F., Chinnadurai,
S. K., Kerns, K., Kinsel, M. J., and Treuting, P. M.
(2016) Initial case reports of cancer in naked mole-
rats (Heterocephalus glaber), Vet. Pathol., 53, 691-696,
https://doi.org/10.1177/0300985816630796.
7. Gorbunova, V., Seluanov, A., Zhang, Z., Gladyshev,
V. N., and Vijg, J. (2014) Comparative genetics of lon-
gevity and cancer: insights from long-lived rodents,
Nat. Rev. Genet., 15, 531-540, https://doi.org/10.1038/
nrg3728.
8. Oka, K., Fujioka, S., Kawamura, Y., Komohara, Y.,
Chujo, T., Sekiguchi, K., Yamamura, Y., Oiwa, Y.,
Omamiuda-Ishikawa, N., Komaki, S., Sutoh, Y.,
Sakurai, S., Tomizawa, K., Bono, H., Shimizu, A.,
Araki, K., Yamamoto, T., Yamada, Y., Oshiumi, H.,
and Miura,K. (2022) Resistance to chemical carcino-
genesis induction via a dampened inflammatory re-
sponse in naked mole-rats, Commun. Biol., 5, 287,
https://doi.org/10.1038/s42003-022-03241-y.
9. Edrey, Y.H., Hanes,M., Pinto,M., Mele,J., and Buffen-
stein, R. (2011) Successful aging and sustained good
health in the naked mole rat: a long-lived mam-
malian model for biogerontology and biomedical
research, ILAR J., 52, 41-53, https://doi.org/10.1093/
ilar.52.1.41.
10. Buffenstein, R., Park, T., Hanes, M., and Artwohl,
J. E. (2012) Naked mole rat, In The Laboratory Rab-
bit Guinea Pig, Hamster, Other Rodents, Elsevier,
Amsterdam, pp. 1055-1074, https://doi.org/10.1016/
B978-0-12-380920-9.00045-6.
11. Manskikh, V. N. (2010) Resistance of guinea pigs to
tumor growth: the reality of the phenomenon and
its possible causes [in Russian], Vopr. Oncol., 56,
514-520.
12. Delaney, M. A., Nagy, L., Kinsel, M. J., and Treuting,
P. M. (2013) Spontaneous histologic lesions of the
adult naked mole rat (Heterocephalus glaber): a
retrospective survey of lesions in a zoo population,
Vet. Pathol., 50, 607-621, https://doi.org/10.1177/
0300985812471543.
13. Delaney, M. A., Kinsel, M. J., and Treuting, P. M.
(2016) Renal pathology in a nontraditional aging
model: the naked mole-rat (Heterocephalus glaber),
Vet. Pathol., 53, 493-503, https://doi.org/10.1177/
0300985815612557.
14. Manskikh, V. N., Averina, O. A., and Nikiforova, A. I.
(2017) Spontaneous and experimentally induced pa-
thologies in the naked mole rat (Heterocephalus gla-
ber), Biochemistry (Moscow), 82, 1504-1512, https://
doi.org/10.1134/S0006297917120094.
PROGEROID SYNDROME 1983
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
15. Delaney, M.A., Imai, D.M., and Buffenstein,R. (2021)
Spontaneous disease and pathology of naked mole-
rats, Adv. Exp. Med. Biol., 1319, 353-380, https://
doi.org/10.1007/978-3-030-65943-1_15.
16. Manskikh, V. N. (2015) Chronic progressive nephrop-
athy in rodents as a disease caused by an expanding
somatic mutant clone, Biochemistry (Moscow), 80,
582-585, https://doi.org/10.1134/S0006297915050090.
17. Adrianov, M.A., Bobrov,M., Mamedov,I., Manskikh,V.,
Sheval, E. V., Rachkova, A. A., Shelechova, A. M.,
Eldarov, C. M., Averina, O. A., and Vyssokikh, M. Y.
(2025) A set of microRNAs are differentially ex-
pressed in cachexic naked mole rat colony mem-
bers after chronic heavy burden under normoxia,
Biochimie, 232, 83-90, https://doi.org/10.1016/j.biochi.
2025.01.010.
18. Suvarna, K., Layton, C. and Bancroft, J. D. (2019)
Bancrofts Theory and Practice of Histological Tech-
niques, 9th Edn, Elsevier.
19. Tucker, M. J. (1997) Diseases of the Wistar Rat,
Taylor and Francis, London, https://doi.org/10.4324/
9780203211250.
20. Maronpot, R. R. (1999) Pathology of the Mouse, Cache
River Press, Vienna, IL.
21. Percy, D. H., Griffey, S. M., and Barthold, S. W. (2016)
Pathology of Laboratory Rodents and Rabbits, Wiley-
Blackwell.
22. Mohr, U. (1996) Pathobiology of Aging Mouse,
Vols. 1/2, ILSI Press.
23. Vyssokikh, M. Yu., Vigovskiy, M. A., Philippov, V. V.,
Boroday, Ya. R., Marey, M. V., Grigorieva, O. A.,
Vepkhvadze, T. F., Kurochkina, N. S., Manukhova,
L. A., Efimenko, A. Yu., Popov, D. V., and Skulachev,
V. P. (2024) Age-dependent changes in the produc-
tion of mitochondrial reactive oxygen species in
human skeletal muscle, Biochemistry (Moscow), 89,
299-312, https://doi.org/10.1134/S0006297924020093.
24. Du, J., Liu, W., Li, M., Li, Z., Li, X., Dai, Y., Liu, G.,
Wang, X., Zhu, P., Gladyshev, V. N., and Zhou, X.
(2024) Comparative time-series multi-omics analyses
suggest H1.2 involvement in anoxic adaptation and
cancer resistance, PLoS Biol., 22, e3002778, https://
doi.org/10.1371/journal.pbio.3002778.
25. Kim,J., Chee, W.-Y., Yabuta,N., Kajiwara,K., Nada,S.,
and Okada, M. (2020) Atg5-mediated autophagy con-
trols apoptosis/anoikis via p53/Rb pathway in naked
mole-rat fibroblasts, Biochem. Biophys. Res. Com-
mun., 528, 146-153, https://doi.org/10.1016/j.bbrc.
2020.05.083.
26. Zhao, S., Li, L., Wang, S., Yu, C., Xiao, B., Lin, L.,
Cong, W., Cheng, J., Yang, W., Sun, W., and Cui, S.
(2016) H
2
O
2
treatment or serum deprivation in-
duces autophagy and apoptosis in naked mole-rat
skin fibroblasts by inhibiting the PI3K/Akt signaling
pathway, Oncotarget, 7, 84839-84850, https://doi.org/
10.18632/oncotarget.13321.
27. Maranni, E., Usunoff, K. G., and Feirabend, N. K. P.
(2009) Lipofuscin and lipofuscinosis, Encyclope-
dia Neurosci., 2009, 481-486, https://doi.org/10.1016/
B978-008045046-9.00126-1.
28. Ward, J.M., Cartoceti, A.N., and Delaney, M.A. (2021)
Brain lesions in aging zoo-housed naked mole-rats
(Heterocephalus glaber), Vet Pathol., 58, 142-146,
https://doi.org/10.1177/0300985820969982.
29. Suzuki, K., Kubota, Y., Sekito, T., and Ohsumi, Y.
(2007) Hierarchy of Atg proteins in pre-autophagoso-
mal structure organization, Genes Cells, 12, 209-218,
https://doi.org/10.1111/j.1365-2443.2007.01050.x.
30. Orsi,A., Razi,M., Dooley, H.C., Robinson,D., Weston,
A.E., Collinson, L.M., and Tooze, S.A. (2012) Dynam-
ic and transient interactions of Atg9 with autophago-
somes, but not membrane integration, are required
for autophagy, Mol. Biol. Cell., 23, 1860-1873, https://
doi.org/10.1091/mbc.E11-09-0746.
31. Klionsky, D.J., Petroni,G., Amaravadi, R.K., Baehrecke,
E. H., Ballabio, A., Boya, P., Bravo San Pedro, J. M.,
Cadwell, K., Cecconi, F., Choi, A. M. K., Choi, M. E.,
Chu, C. T., Codogno, P., Colombo, M. I., Cuervo,
A. M., Deretic, V., Dikic, I., Elazar, Z., Eskelinen, E.-L.,
Fimia, G.M., Gewirtz, D.A., Green, D.R., Hansen,M.,
Jäättelä, M., Johansen, T., Juhász, G., Karantza, V.,
Kraft, C., Kroemer, G., Ktistakis, N. T., Kumar, S.,
Lopez-Otin,C., Macleod, K.F., Madeo, F., Martinez, J.,
Meléndez, A., Mizushima, N., Münz, C., Penninger,
J. M., Perera, R. M., et al. (2021) Autophagy in major
human diseases, EMBO J., 40, e108863, https://
doi.org/10.15252/embj.2021108863.
32. Klionsky, D. J., Abdel-Aziz, A. K., Abdelfatah, S.,
Abdellatif, M., Abdoli, A., Abel, S., Abeliovich, H.,
Abildgaard, M. H., et al. (2021) Guidelines for the
use and interpretation of assays for monitoring au-
tophagy (4
th
edition), Autophagy, 17, 1-382, https://
doi.org/10.1080/15548627.2020.1797280.
33. Viiri, J., Amadio, M., Marchesi, N., Hyttinen, J. M. T.,
Kivinen, N., Sironenm, R., Rillam, K., Akhtar, S.,
Provenzani,A., D’Agostino, A.G., Govoni,S., Pascale,A.,
Agostini, H., Petrovski, G., Salminen, A., and Kaar-
niranta, K. (2013) Autophagy activation clears
ELAVL1/HuR-mediated accumulation of SQSTM1/
p62 during proteasomal inhibition in human retinal
pigment epithelial cells, PLoS One, 8, e69563, https://
doi.org/10.1371/journal.pone.0069563.
34. Sakuma,K., Kinoshita,M., Ito,Y., Aizawa,M., Aoi,W.,
and Yamaguchi, A. (2015) 3p62/SQSTM1 but not LC3
is accumulated in sarcopenic muscle of mice, J. Ca-
chexia Sarcopenia Muscle, 7, 204-212, https://doi.org/
10.1002/jcsm.12045.
35. Peng, Y., Shapiro, S. L., Banduseela, V. C., Dieterich,
I.A., Hewitt, K. J., Bresnick, E.H., Kong,G., Zhang, J.,
Schueler, K. L., Keller, M.P., Attie, A. D., Hacker, T. A.,
Sullivan, R., Kielar-Grevstad, E., Arriola Apelo, S. I.,
Lamming, D.W., Anderson, R.M., and Puglielli,L. (2018)
MANSKIKH et al.1984
BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025
Increased transport of acetyl-CoA into the endoplas-
mic reticulum causes a progeria-like phenotype, Ag-
ing Cell, 17, e12820, https://doi.org/10.1111/acel.12820.
36. Sulzer, D., Mosharov, E., Talloczy, Z., Zucca, F. A.,
Simon, J. D., and Zecca, L. (2008) Neuronal pigment-
ed autophagic vacuoles: lipofuscin, neuromelanin,
and ceroid as macroautophagic responses during
aging and disease, J. Neurochem., 106, 24-36, https://
doi.org/10.1111/j.1471-4159.2008.05385.x.
37. Song, S.B., Shim,W., and Hwang, E.S. (2023) Lipofus-
cin granule accumulation requires autophagy activa-
tion, Mol. Cells, 46, 486-495, https://doi.org/10.14348/
molcells.2023.0019.
38. Reichel, W., and Garcia-Bunuel, R. (1970) Pathologic
findings in progeria: myocardial fibrosis and lipofus-
cin pigment, Am. J. Clin. Pathol., 53, 243-253, https://
doi.org/10.1093/ajcp/53.2.243.
39. Burtner, C.R., and Kennedy, B.K. (2010) Progeria syn-
dromes and ageing: what is the connection? Nat. Rev.
Mol. Cell Biol., 11, 567-578, https://doi.org/10.1038/
nrm2944.
40. Harkema, L., Youssef, S. A., and de Bruin, A. (2016)
Pathology of mouse models of accelerated aging,
Vet. Pathol., 53, 366-389, https://doi.org/10.1177/
0300985815625169.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in published
maps and institutional affiliations. AI tools may have
been used in the translation or editing of this article.