Article

ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 12, pp. 1970-1984 © The Author(s) 2025. This article is an open access publication.

Russian Text © The Author(s), 2025, published in Biokhimiya, 2025, Vol. 90, No. 12, pp. 2077-2092.

1970

Progeroid Syndrome with Signs

of Autophagy Dysfunction

in the Naked Mole Rat (Heterocephalus glaber)

Vasiliy N. Manskikh

1,a

*, Eugene V. Sheval

, Maria V. Marey

Olga A. Averina

, and Mikhail Yu. Vyssokikh

1,2

A. N. Belozersky Research Institute of Physico-Chemical Biology, Lomonosov Moscow State University,

119992 Moscow, Russia

V. I. Kulakov National Medical Research Center for Obstetrics, Gynecology, and Perinatology,

Ministry of Health of the Russian Federation, 117997 Moscow, Russia

e-mail: manskikh@mail.ru

Received July 1, 2025

Revised November 27, 2025

Accepted November 27, 2025

Abstract— The naked mole rat is considered a unique non-aging mammalian species and is widely used in

laboratories to study the biology of longevity. Previously, our group was the first to describe a new fatal

disease in the naked mole rat, termed “idiopathic cachexia.” A detailed study of pathological changes in the

organs of affected animals, combined with the data on gene expression changes, allows us to interpret this

disease as a highly specific variant of accelerated aging (progeroid syndrome or progeria) in these animals.

Symptoms of the disease include cachexia, cataracts, lipofuscinosis, and appearance of amyloid bodies (corpora

amylacea) in the brain, severe degeneration of cardiomyocytes, fatty degeneration, and generalized lipofus-

cinosis of the liver and kidneys, with signs of autophagy dysfunction in these organs. Further research is

needed to elucidate the mechanism of this disease in animals with negligible aging, such as naked mole rats,

which may provide insights into the mechanisms of aging and lifespan extension.

DOI: 10.1134/S0006297925601960

Keywords: naked mole rat, autophagy, progeria, aging, lipofuscin

* To whom correspondence should be addressed.

INTRODUCTION

Since the publication of Buffenstein etal. [1], the

naked mole rat has been regarded as a mammalian

species with negligible or no aging. Indeed, this ani-

mal exhibits numerous unique features, including an

unusually long lifespan for a rodent (up to 40 years)

[1, 2], no increase in mortality risk with age [1-3],

resistance to spontaneous and induced carcinogenesis

[4-8], many neotenic traits [3], and other physiological

characteristics [9, 10]. Without delving into the debate

about how much the focus on studying these features

is tied to the fascination with a new research sub-

ject, and why similar traits are not studied in other

animals (for example, resistance to tumor growth in

guinea pigs [11]), it must be acknowledged that the

naked mole rat is truly a unique model organism for

studying gerontology. While physiology of this ani-

mal has been extensively studied, its pathology has

received relatively little attention – only a few studies

have broadly described the spontaneous pathology of

the naked mole rat [6, 10, 12-15]. Although several

potentially age-related diseases have been identified

(progressive rodent nephropathy [13, 16], malignant

tumors [6, 14], skin and organ mineralization [12]),

in general, the presence of aging-related pathologies

in this animal remains poorly studied and rarely

debated.

Previously, our research group described a new

disease in the naked mole rats, characterized by a

sharp decline in body weight, a distinctive exter-

nal appearance, ascites, neurological symptoms, and

PROGEROID SYNDROME 1971

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

death of the relatively young individuals (2-6 years

old). This disease was termed “idiopathic cachexia”

[17]. A detailed pathological examination of the de-

ceased and euthanized animals with signs of this

disease revealed a range of morphological and histo-

chemical changes traditionally associated with aging

at the cellular and tissue levels. This article describes

these changes. Since the preliminary data on the mi-

croRNA spectrum in these animals indicated altered

regulation of gene expression related to autophagy

[17], and based on the available morphological data

(lipofuscin accumulation), this study investigated

markers of this process.

MATERIALS AND METHODS

Animal care. A colony of naked mole rats at

the Belozersky Institute of Physico-Chemical Biology,

Lomonosov Moscow State University (comprising 54

individuals), was obtained from a core group import-

ed from the Leibniz Institute for Zoo and Wildlife

Research (IZW) in Berlin, Germany. All animals de-

scribed in this study were from the same colony and

were housed together in a system of cylindrical plas-

tic containers connected by plastic tubes, at 27  ±  1°C

and 50  ±  10% humidity, with a 12/12-hour light/dark

cycle (10:00-22:00 light) and atmospheric ventilation.

The diet consisted of apples, sweet potatoes, carrots,

and grains, provided daily. To enrich the habitat, a

rectangular container with high-density clay, mim-

icking the natural soil of their habitat, was installed.

Six months after the container was introduced, some

worker animals began to lose weight rapidly. The

container was immediately removed after signs of

cachexia were detected in 9 out of 54 animals (3 fe-

males and 6 males, aged 2-6 years). The animals were

then observed for 3 years. To monitor their condi-

tion, the body mass index was measured every 4-5

months in both cachexic and healthy control animals

of the same age (n  =  9; 4 females and 5 males) from

the same colony. Euthanasia was performed by de-

capitation after anesthesia with isoflurane inhalation

(5% at 0.4  L/min flow; Laboratorios Karizoo S.A.,

Spain) using an R500 system (RWD, China).

Necropsy and histopathological examination.

Spontaneously deceased (n  =  2) and euthanized (n = 7)

animals with signs of cachexia underwent patholog-

ical examination. The criteria for euthanasia were

as follows: 15% reduction in body weight and visual

signs of cachexia, ascites, and neurological symptoms

(stupor and ataxia). Additionally, 7 healthy control

animals without signs of cachexia, kept under the

same conditions, were euthanized and examined. All

animals underwent thorough macroscopic examina-

tion. Samples were taken from the heart, lungs, liver,

kidneys, pancreas, mesenteric lymph nodes, spleen,

brain, adrenal glands, stomach, large and small in-

testines, skin, skeletal muscles, thyroid gland, salivary

glands, eyes, and reproductive organs.

Organ samples were fixed in a 10% formalin (and

in some cases, zinc formalin, Champy’s, Carnoy’s, and

Bouin’s mixtures), dehydrated in a 99.7% isopropa-

nol (Biovitrum, Russia), and embedded in a paraffin

(Biovitrum), followed by staining with hematoxylin

and eosin using a routine protocol [18]. Microscopic

examination was performed using an AxioScope  A1

microscope (Carl Zeiss, Germany), and microphoto-

graphs were taken with an MRc.5 camera (Carl Zeiss).

Identified changes were classified according to

the criteria accepted in the pathology of laboratory

animals [19-22].

Histochemical examination. Paraffin sections

(3  µm) were examined unstained using a fluorescence

microscope with a FITC filter (excitation at 493  nm),

stained with Sudan IV, Schmorl’s method (for lipo-

fuscin), Giemsa, PAS, Warthin–Starry (for bacteria),

Van Gieson (for collagen), Altman (for mitochondria),

Lepehne–Pickworth (for hemoglobin), Landrum (for

intracellular protein granules), Stein, Fouchet (for

bilirubin), and Perl’s method (for hemosiderin) us-

ing routine protocols [18]. Additionally, immunohis-

tochemical examination of the brain was performed

using rabbit monoclonal antibodies against beta-amy-

loid (ab201060; Abcam, USA; dilution 1  :  1000), using

standard immunoperoxidase techniques on paraffin

sections after heat-induced epitope retrieval in a ci-

trate buffer (pH  6.0), with a detection system (Cell

Margue, USA) and appropriate positive and negative

controls.

For score assessment of changes, the following

criteria were used: hepatic lipofuscinosis (0 – none,

1 – pigment visible in individual hepatocytes, 2 – pig-

ment present in most hepatocytes in the perinuclear

zone, 3 – pigment present in all hepatocytes); fatty

degeneration (0 – none, 1 – fatty degeneration in indi-

vidual cells, 2 – involvement of up to 50% of hepato-

cytes, 3 – involvement of more than 50% of hepato-

cytes); myocardial degeneration (0 – none, 1 – single

foci, 2 – multiple foci, 3 – total involvement); cataract

(0 – none, 1 – single subcapsular foci, 2 – involve-

ment of less than 50% of the lens, 3 – involvement of

more than 50% of the lens); amyloid deposits in the

thalamus (0 – none, 1 – single deposits per section,

2 – single deposits in each 1000× microscope field, 3–

multiple deposits in each field); renal lipofuscinosis

(0 – none, 1 – present in individual tubules, 2 – in-

volvement of up to 50% of tubules, 3 – involvement

of more than 50% of tubules).

Electron microscopy. Samples of liver and

kidney tissues were taken for electron microsco-

py. Tissue samples (0.5×0.5×1  mm) were fixed in a

MANSKIKH et al.1972

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Table 1. Gene-specific primers for autophagy marker genes and the reference gene

Gene Forward primer; Tm (°C) Reverse primer; Tm (°C)

p62 GCTGTCTGCCCTGTTTTCAT; 58.75 GGCCCAAGTGCTATTCACAG; 58.90

LC3b AAGAGTGGAAGACGTTCGGC; 60.32 GGTTTTATCCAGGACGGGCA; 60.03

ATG14 AAGCAGAGAGGCAAACTCCC; 59.96 TGTGATCAGCTCTTGGGAACT; 59.02

ATG9a TGCATGCTCTACGAATCCCC; 59.89 GAAACAGAGAGCCAGGTCCC; 60.04

GAPDH TGGCAAGGTGGATATCGTGG; 59.82 CTTCTCGTGGTTCACACCCA; 59.89

Note. Tm, melting temperature.

2.5% glutaraldehyde (Sigma, USA) in a cacodylate

buffer, post-fixed in 1% OsO

(EMS, USA), dehydrat-

ed in ethanol and acetone, and embedded in SPI-Pon

812 (Structure Probe, Inc., USA). Ultrathin sec-

tions were made using a diamond knife (DiATOME,

USA) and mounted on copper slot grids (Ted Pella,

USA). Sections were stained with uranyl acetate and

lead nitrate and examined using a JEM 1400 elec-

tron microscope (JEOL, Japan) at accelerating voltage

of 80 kV.

Gene expression analysis of autophagy mark-

ers. Liver tissue samples obtained at necropsy (n = 6

for both cachexic and control animals) were mechan-

ically homogenized in liquid nitrogen and lysed in an

ExtractRNA reagent (Evrogen, Russia). Total RNA was

isolated using a standard method with a guanidine

thiocyanate/phenol/chloroform mixture. RNA con-

centration was determined using a NanoPhotometer

(Implen, Munich, Germany) at 260/240 nm. Reverse

transcription was performed using a RevertAid First

Strand cDNA Synthesis Kit (Thermo Scientific, USA).

Quantitative reverse transcription PCR (RT-qPCR)

was performed in real-time using a qPCRmix-HS

SYBR+LowROX (5X) kit (Evrogen) with gene-specific

primers (Evrogen) (Table 1). Primers were selected

using the Primer Blast service (https://www.ncbi.nlm.

nih.gov/tools/primer-blast/). Primer validation was

performed by matching melting temperature (Tm)

with the calculated value (provided in Table 1). For

negative control, RNA isolated from Escherichia coli

after reverse transcription was used as a template,

as described above. Amplification and detection were

performed using a DT Prime 4 amplifier (DNA-Tech-

nology, Russia). For all primers, absence of DNA

contamination in the isolated RNA samples was con-

firmed by performing amplification without reverse

transcription under the described conditions and

parameters. No DNA contamination was detected in

the samples. Gene expression analysis was performed

using the 2

−ΔΔCt

method, with GAPDH as the reference

gene. Results were normalized to the average expres-

sion level of GAPDH.

Electrophoresis and Western blot analysis.

Electrophoresis in 12% polyacrylamide gel was per-

formed using a routine method with minor modifica-

tions described previously [23]. Liver tissue fragments

obtained at necropsy (n = 3 for both cachexic and

control animals) were lysed in a buffer containing:

150 mM NaCl, 50 mM Tris-HCl (pH 8.0), 0.5% Nonidet

P-40, 1% sodium deoxycholate, 0.5% sodium dodecyl

sulfate, and protease inhibitors (Thermo Fisher Sci-

entific, USA). After separation (30 µg of protein per

lane), proteins were electrophoretically transferred to

a nitrocellulose membrane (Bio-Rad, USA) and incu-

bated with diluted antibodies using a routine meth-

od. Primary antibodies included rabbit monoclonal

antibodies against mouse proteins ATG14 (ab315009;

dilution 1  :  1000), ATG9a (ab108338; dilution 1  :  1000),

and rabbit polyclonal antibodies against mouse pro-

teins p62 (ab91526; concentration 1  µg/mL) [24, 25]

and housekeeping protein beta-actin (ab8227; dilution

1  :  2000) [26], obtained from Abcam; and antibodies

against LC3b (Cell Signaling, USA; #2775; dilution

1  :  1000) [25]. Dilution was performed as recom-

mended by the manufacturers in a buffer containing

150  mM NaCl, 50mM Tris-HCl (pH 7.5), 0.1% Tween  20,

and 1% bovine serum albumin. Secondary antibodies,

conjugated with horseradish peroxidase and specific

to rabbit antibodies, were diluted in the same buffer

at a ratio of 1  :  20,000 according to the manufactur-

er’s recommendations (ab6721; Abcam). Luminescent

signal was visualized using a Novex ECL kit (Invitro-

gen, USA) and a ChemiDoc scanner (Bio-Rad). Due to

the lack of commercially available antibodies against

Heterocephalus glaber proteins, validation of anti-

bodies against ATG14 and ATG9a, used for the first

time, was performed by aligning the peptide antigen

sequences used by the companies to produce antibod-

ies against the protein sequences of the naked mole

rat, obtained using the online services at https://

www.uniprot.org/ and the database at http://naked-

mole-rat.org/annotations/details/XP_004871135.1/

and http://naked-mole-rat.org/annotations/details/

XP_004864595.1/ for ATG14 and ATG9a, respectively.

PROGEROID SYNDROME 1973

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

In all cases, suitability of the antibodies for the naked

mole rat was established by the presence of a single

specifically stained band corresponding to the molec-

ular weight and mobility of the protein under study.

Protein concentration determination. Protein

concentration in the samples for Western blot analy-

sis was determined using bicinchoninic acid and

bovine serum albumin as a standard, following the

manufacturer’s recommendations (Pierce, USA).

Statistical analysis. Data analysis was performed

using GraphPad Prism 8. Data were first tested for

Gaussian distribution using the D’Agostino & Pearson

omnibus normality test, then analyzed using Student’s

t-test, Mann–Whitney test, or one-way ANOVA. Results

are presented as a mean ± standard deviation (SD).

Differences were considered significant at p < 0.05.

RESULTS

Clinical characteristics of the disease. Clinical

manifestations of the disease have been described in

detail previously [17]. In all cases, the affected ani-

mals were worker individuals. Visually, the animals

appeared severely emaciated, with sunken flanks

and a pointed snout, resembling appearance of the

30-year-old naked mole rats [9]. Objective examina-

tion of animals with signs of cachexia revealed a 15%

reduction in the body mass index compared to the

control animals from the same colony [17]. Despite

this, they exhibited the same feeding behavior as

other animals. Immediately before death, the animals

displayed neurological symptoms, including stupor or

ataxia with rolling onto their backs when attempting

to move.

All animals exhibited similar changes, although

to varying degrees. At necropsy, signs of cachexia and

complete absence of visible fat deposits were noted.

The liver was typically dark brown, and a light-yel-

low transparent fluid (ascites) had accumulated in

the abdominal cavity. The kidneys were pale yellow.

Other organs were proportionally reduced in size but

without visible pathological changes.

Histopathological analysis results. Microphoto-

graphs showing structure of the organs in the healthy

control naked mole rats, for comparison with the

pathologically altered organs, are provided in Fig.  1

due to the rarity of this animal.

Liver. The most severe changes in the affect-

ed animals were found in the liver and have been

partially described previously [17]. Despite the over-

all preservation of organ architecture (no signs of

lobule deformation or fibrosis), significant changes

were observed in hepatocytes and stromal cells. The

cytoplasm of hepatocytes contained a large number

of light-brown pigment granules that, when treated

with osmium tetroxide (Champy’s fixation), stained

intensely black-brown, green with Giemsa, exhibited

strong autofluorescence in paraffin sections, stained

weakly with Sudan IV and PAS, did not give a pos-

itive Perl’s reaction for iron or a reaction for bili-

rubin, but stained blue-green with Schmorl’s meth-

od (Fig. 2, a-d). These histochemical properties are

characteristic of the “aging pigment” (lipofuscin)[27].

Large amounts of this pigment accumulate in the peri-

nuclear region of cells, which become hypertrophied,

binucleated, and have markedly enlarged nucleoli.

Hypertrophy of the cells is always localized in the

periportal zone of the lobules. In the hypertrophied

cells, along with lipofuscin, numerous eosinophilic

granules are visible, which stain red with Altman’s

method (after Champy’s fixation), characteristic of mi-

tochondria; and both pigment and mitochondria are

concentrated in the perinuclear zone (Fig. 2d). When

stained with Lepehne–Pickworth and Landrum, the

phagocytosed erythrocytes were occasionally visible

in the cytoplasm of individual hypertrophied he-

patocytes (Fig. 2e). Some liver cells, on the contrary,

undergo atrophy and fatty degeneration with accu-

mulation of large lipid droplets (stained black after

fixation with Champy’s mixture with OsO

). Among

the hypertrophied hepatocytes, foci of extramedul-

lary hematopoiesis, unusual for the liver of the naked

mole rat, are sometimes observed. Kupffer cells (liv-

er macrophages) show strong accumulation of hemo-

siderin (giving a positive reaction for trivalent iron

with Perl’s method), reaching a degree characteristic

of hemochromatosis (Fig.  2f). These changes were not

observed in the animals without signs of cachexia; a

species-specific feature of hepatocytes in the healthy

naked mole rats is optically clear cytoplasm, due to

their high glycogen content (Fig.  1a).

Kidneys. In the kidneys, in addition to calcium

phosphate deposits characteristic of all naked mole

rats (including those without signs of disease), intra-

cellular deposits of lipofuscin, numerous small lipid

droplets in the cells of the proximal tubules, and he-

mosiderin in the individual tubules were found (Fig.  3,

a andb). The renal glomeruli were unchanged. These

changes were not found in the kidneys of healthy an-

imals (Fig. 1b).

Heart. Changes in the heart included severe vac-

uolar degeneration and atrophy of cardiomyocytes in

the walls of both ventricles (Fig.  3c), as well as ac-

cumulation of a small amount of brown pigment in

the individual cardiomyocytes, similar to that found

in hepatocytes. The myocardium of healthy animals

showed no changes (Fig. 1c).

Eyes. The examined animals exhibited previous-

ly undescribed eye lesions. These appeared as typi-

cal degeneration of peripheral lens fibers with swell-

ing, clearing, and formation of Morgagnian spheres,

MANSKIKH et al.1974

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Fig. 1. Histological appearance of internal organs in healthy naked mole rats. a) Liver; b) kidney; c) myocardium; d) eye

lens; e) cerebellum; f) thalamus. Staining methods: a-d) hematoxylin and eosin; e) PAS (with hematoxylin counterstain);

f)Immunoperoxidase reaction with antibodies against beta-amyloid with PAS and hematoxylin counterstain. Scale bars and

magnifications: a, b, e, f) 40 µm, 1000×; c, d) 100 µm, 400×.

characteristic of cataracts (Fig.3d), but not in the eyes

of intact naked mole rats (Fig.1d). The retina, choroid,

cornea, and other eye structures were unchanged.

Brain. Significant changes were found in the

brain. The PAS-positive pigment inclusions, similar to

those in hepatocytes, were detected in the neurons

PROGEROID SYNDROME 1975

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Fig. 2. Changes in the liver of naked mole rats with cachexia. a) A large number of dark brown pigment granules in the

cytoplasm of hepatocytes; b) autofluorescence of pigment granules (lipofuscin); c) positive dark blue staining of pigment

granules in hepatocytes with Schmorl’s method; d) dark brown pigment granules among numerous large mitochondria

(pink) concentrated in the perinuclear zone of hepatocytes, black deposits – lipid droplets; e) erythrocytes (pink, arrows)

in the cytoplasm of individual hepatocytes; f) intense accumulation of iron-containing pigment (hemosiderin) in Kupffer

cells (blue). Scale bars and magnifications: a-e)40µm, 1000×; f)200µm, 200×. Staining methods: a)Hematoxylin and eosin;

b) Unstained paraffin section, FITC filter, excitation at 493 nm; c) Schmorl’s reaction; d) Altman’s staining after Champy’s

fixation (with OsO

); e) Landrum’s staining; f) Perl’s reaction with nuclear fast red counterstain.

MANSKIKH et al.1976

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Fig. 3. Changes in various internal organs of naked mole rats with cachexia. a) Unchanged renal glomerulus; b) Numer-

ous granules of lipofuscin (brown) and lipid droplets (black) in the cytoplasm of tubules; c) Severe degenerative changes

in the myocardium without inflammatory reaction; d) Cataract, area of lens damage (asterisk) with Morgagnian spheres;

e) Degenerative changes in some Purkinje neurons of the cerebellum (arrows); f) PAS-positive deposits of lipofuscin in

some Purkinje neurons of the cerebellum (arrows); g)PAS-positive amyloid bodies (corpora amylacea) in the neuropil of the

thalamus; h)Positive reaction of intracellular deposits in neurons (white arrows) and amyloid bodies (black arrows) of the

thalamus with antibodies against human beta-amyloid. Staining methods: a, c, d, e)Hematoxylin and eosin; b)Hematoxylin

after fixation with Champy’s mixture (with OsO

); f, g) PAS reaction with hematoxylin counterstain; h) Immunoperoxi-

dase reaction with antibodies against beta-amyloid with PAS and hematoxylin counterstain. Scale bars and magnifications:

a-d) 100 µm, 400×; e-h) 40 µm, 1000×.

PROGEROID SYNDROME 1977

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Fig. 4. Ultrastructural changes in the kidney tubule cells and hepatocytes in the animals with cachexia. a, b) Kidney tu-

bule cells of a healthy naked mole rat; c, d) kidney tubule cells of a cachexic naked mole rat; e, f) liver cells of a healthy

naked mole rat; g, h) liver cells of a cachexic naked mole rat. N, nuclei; g, glycogen granules; m, mitochondria. Asterisks

indicate structures morphologically similar to autophagosomes; arrows indicate lipofuscin granules or their accumulations.

Scale bars: a, c, e, g) 2 µm; b, d, f, h) 1 µm.

MANSKIKH et al.1978

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Table 2. Results of the score assessment of the severity of the most important pathological changes in organs

Group

Hepatic

lipofuscinosis

Hepatic fatty

degeneration

Myocardial

degeneration

Cataract

Amyloid deposits

in the thalamus

Renal

lipofuscinosis

Control

(M ± SD, n = 7)

0000 (n = 5) 0 0

Cachexia

(M ± SD, n = 9)

2.3 ± 0.7 1.3 ± 0.5 1.6 ± 0.7 1.6 ± 0.8 (n = 5) 2.0 ± 0.9 1.3 ± 0.5

Note. In all cases, p < 0.01.

from various regions. Particularly numerous were

these inclusions in the Purkinje neurons in the

cerebellar cortex, which also showed signs of de-

generation, such as eosinophilic shrunken neurons

(Fig. 3, e-f). Additionally, vacuolar changes were ob-

served in the neuropil around the third ventricle,

and amyloid-like PAS-positive inclusions in the neu-

ropil (corpora amylacea) and PAS-positive granules

in the cytoplasm of neurons in various brain regions

(Fig.  3g). A particularly large number of amyloid

bodies were found in the thalamus and hypothala-

mus. Staining with antibodies against beta-amyloid

did not reveal plaques typical of Alzheimer’s disease,

but most PAS-positive granules in the cytoplasm of

neurons and in the neuropil gave a positive reaction

(Fig.3h). None of these changes were observed in the

brains of healthy naked mole rats of the same age

(Fig. 1, e-f).

Other organs. It is important to note that histo-

pathological changes in other organs (including skele-

tal muscles) were not constant and included minimal

deposits of brown pigments (lipofuscin, hemosiderin).

Bacteria and virus-like inclusions were not found in

any organ in any case.

The results of the score assessment of the sever-

ity of the most important pathological changes in the

organs and tissues are summarized in Table 2.

Electron microscopy examination. Liver. Ultra-

thin sections of the liver of a healthy naked mole rat

showed hepatocytes with one or two nuclei (Fig. 4a).

Cytoplasm of the cells contained numerous mito-

chondria and surrounding endoplasmic reticulum

components (Fig.  4b). No pathological changes were

observed in these organelles. The cytosol was filled

with numerous glycogen accumulations, visible only

in hepatocytes and absent, for example, in the near-

by endothelial cells. Due to the large amount of gly-

cogen, the cytoplasm of hepatocytes appeared dark,

and membrane organelles and nuclei appeared light-

ly stained against this background. In the hepatocytes

of cachexic naked mole rats, the same organelles

were observed, although the amount of glycogen was

visually lower (Fig.  4, c and d). The cells contained

single, sometimes quite large (up to 5  µm) lipid drop-

lets. Notably, hepatocytes contained large accumula-

tions of lipofuscin granules (Fig. 4, e and f). These

granules always occupied a localized area of the cy-

toplasm, usually closer to the nucleus. Viral particles

and areas of their assembly (viral inclusions) were

not detected.

Kidney. For analysis, transverse sections of prox-

imal and distal tubules were selected; for illustration,

only photographs of proximal tubules are provided.

Epithelial cells forming the walls of the tubules in

the kidney of a healthy naked mole rat contained

a large number of mitochondria, and no lipofuscin

granules were detected (Fig.  4, eand f). In the tubule

cells of the cachexic naked mole rats, severely dam-

aged swollen mitochondria were observed, in which

cristae were difficult to detect (Fig.  4, g and h). It is

important to note that mitochondrial damage in the

cells of different tubules varied from minimal to very

severe (Fig.  4h). However, in all cases within a single

tubule, mitochondria in different cells had approxi-

mately the same morphology, i.e., the same level of

damage. Large inclusions, possibly autophagosomes,

were found in the cells of the proximal tubules. Viral

particles and areas of their assembly (viral inclu-

sions) were not detected in either the nuclei or the

cytoplasm of the cells.

Expression of autophagy marker genes and

proteins. To study autophagy in the liver of the na-

ked mole rat, four marker proteins were selected:

ATG9a, ATG14, p62, and the LC3II/LC3I ratio. Classi-

cal markers for assessing autophagic flux activity are

decrease in p62 (degraded in autophagosomes) and

increase in the relative content of the lipidated form

of LC3 (LC3II), whose accumulation depends on for-

mation of autophagosomes. ATG14 and ATG9a are ad-

ditional marker proteins known to be involved in the

processes of initiation and elongation of phagophore

membranes, closure of autophagosome, and delivery

of endosomal material to lysosomes.

Analysis of the content of autophagy marker pro-

teins in the liver tissues by immunoblotting showed

a significant increase in the content of p62, ATG14,

and ATG9a proteins (Fig.  5) and decrease in the LC3II/

LC3I ratio.

PROGEROID SYNDROME 1979

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Fig. 5. Changes in the relative content of autophagy marker proteins ATG14, ATG9a, p62, and the LC3II/LC3I ratio in the

liver tissue of cachexic animals compared to the normal naked mole rats. a) Diagrams showing a significant (in all cases,

p<0.05) increase in the content of proteins (in arbitrary units, normalized to beta-actin) ATG14, ATG9a, p62, and a decrease

in the LC3II/LC3I ratio. b) Photographs of individual electropherograms of autophagy marker proteins ATG14, ATG9a, p62,

LC3II, LC3I, and housekeeping protein beta-actin from the liver of healthy and cachexic animals.

Fig. 6. Relative expression of mRNA of the ATG14, ATG9a, LC3b, and p62 genes in the liver tissue for cachexic and normal

animals. Data represent the mean value of 2

−ΔΔCt

in the group ± SD; ** p < 0.01; *** p < 0.001.

MANSKIKH et al.1980

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Using quantitative PCR, a significant increase in

the expression levels of the p62, ATG14, and ATG9a

genes and a significant decrease in the mRNA level

for LC3b in the liver tissue of cachexic animals com-

pared to the normal animals were revealed (Fig.  6).

DISCUSSION

From the detailed description of the pathologi-

cal changes found in the organs of naked mole rats

with signs of the disease, it is clear that this disease,

previously designated by us as “idiopathic cachexia,”

does not resemble any known disease of laborato-

ry rodents [19-22], including pathological conditions

known in the naked mole rat [12-15]. Recently, in

the study of brain samples from the naked mole rats

aged 5-27 years, changes similar to those observed in

our animals were described [28], but the authors did

not mention the results of examining other organs

in these animals or the symptoms observed during

life. The pathological changes we found explain clin-

ical picture of the disease well. Massive damage to

the kidneys, myocardium, and especially liver could

explain the weight loss (cachexia) and ascites found

during macroscopic examination. Damage to the cer-

ebellar neurons explains ataxia (inability to main-

tain posture) observed during the animals’ lifetime.

Damage to the myocardium and brain was severe

enough to lead to the animals’ death. No signs indi-

cating an infectious nature of the disease were found

during careful examination.

The study of molecular markers provided some

information about the processes that may be asso-

ciated with the morphological changes described in

this article. Previously, we showed that in the liver of

cachexic animals, the expression level of microRNA

nmr-miR-15b-5p, whose targets include mRNAs of

proteins such as ATG14 and ATG9a [17], significantly

decreases. These proteins are important components

of the autophagy cascade [29]. It has been estab-

lished that regulation of the expression of the ATG14

and ATG9a genes by small non-coding RNA of the

miR- 15-5p family is significant, particularly for the

age-related pathology such as non-alcoholic fatty liv-

er disease, in which a decrease in the level of this

microRNA is observed [30]. In this study, we analyzed

the content of protein products of the genes respon-

sible for autophagy and their mRNA in the liver of

sick naked mole rats. These data show that the ex-

pression levels of several genes increased, while the

expression level of the LC3b gene decreased sharply.

The product of this gene plays a key role in the nor-

mal autophagic flux, ensuring both capture of mate-

rial for degradation by the phagophore and closure

of the phagophore membranes and formation of the

autophagosome [31, 32]. Consequently, deficiency of

this protein should lead to autophagy dysfunction al-

ready at the stage of phagophore formation and ex-

pansion. Although we detected structures resembling

autophagosomes, a significant decrease in the LC3II/

LC3I ratio serves as a clear indication of the defect

in their formation and decrease in autophagic flux.

In this regard, increase in the content of the p62

protein in the cells, which is usually degraded in au-

tophagosomes along with its marked targets [31-33],

could be associated not so much with its hyperexpres-

sion as with the reduced degradation. It is important

to note that the increase in the p62 protein has al-

ready been described as a marker of autophagy

disorders during aging [34]. The increase in expres-

sion and content of other proteins responsible for

initiation and elongation of phagophore membranes

(ATG9a, ATG14) [31] could be a cellular compensatory

reaction to ineffective autophagy. Another evidence

of defective autophagy is accumulation of lipofuscin

in cells, which indicates inefficiency of another stage

of this process – lysosomal degradation. Thus, along

with the increase in factors responsible for the initi-

ation of autophagy, there are signs of its clear dys-

function and inefficiency at the subsequent stages.

Elucidating the causes of such complex dysfunction

requires additional research. However, it is important

to note that autophagy disorders (blockade of ATG9a–

Fam134b–LC3β and ATG9a–Sec62–LC3β interactions,

as well as impaired reticulophagy – autophagic pro-

cessing of the endoplasmic reticulum) have already

been described as a mechanism leading to the devel-

opment of a progeroid phenotype in mice [35].

In summary, the following conclusion could be

drawn about the nature of the disease we observed

in naked mole rats. The dominant changes in the his-

topathological picture of the disease are generalized

lipofuscinosis in the liver, kidneys, brain, and, to a

lesser extent, the myocardium, which is accompa-

nied by severe emaciation (making sick animals re-

semble 30-year-old naked mole rats), the appearance

of amyloid bodies (corpora amylacea) in the brain,

and the development of cataracts in the lens. All

such changes are classified as characteristic of aging,

and therefore, the disease we previously described

as “idiopathic cachexia” (the term “idiopathic” re-

fers to diseases of unclear etiology) could be clas-

sified as a type of progeria or progeroid syndrome.

The results of studying marker genes and proteins

LC3b, p62, ATG9a, ATG14, together with morpholog-

ical signs (detection of numerous lipofuscin gran-

ules and lipid droplets by light microscopy and au-

tophagosomes by electron microscopy), suggest that

in this case, there is a dysfunction of autophagy [36,

37] accompanied by the hyper-expression and hy-

per-activation of some of its factors and pathways

PROGEROID SYNDROME 1981

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

and deficiency of the others. Therefore, the discov-

ered disease could be called “progeroid syndrome

with signs of autophagy dysfunction.” In this case,

it should be noted that the disruption of autophagy

processes may be either the cause of fatal changes

in the organs and tissues of animals or only one of

the pathogenetic components, which, nevertheless, is

a significant feature of this disease. The cause of the

development of this progeroid state, as we previously

suggested [17], may be an inadequate activation of

metabolism (with a sharp excess of catabolism over

anabolism) when animals are under normoxic condi-

tions (21% oxygen, while the usual content for natu-

ral colonies is 8-16%). Possibly, this is associated with

the long-term effects of oxidative stress developed

under normoxia against the background of constant

heavy physical exertion (all cachexic animals belong

to the group of workers engaged in digging tunnels in

dense clay to obtain food delivered to other members

of the colony).

It is important to compare this disease with other

conditions in humans and animals that are consid-

ered progerias. Unfortunately, despite the availability

of a significant amount of information on the molec-

ular mechanisms of progeria in humans, morphologi-

cal changes in the organs of such patients have been

poorly studied – there are only few reports of such

studies [38, 39]. There is also little data on progeria

in the laboratory animals [40]. Analysis of informa-

tion on the changes in the Werner’s disease and espe-

cially Hutchinson–Gilford syndrome shows that these

genetic diseases have symptoms both coinciding with

the course of natural aging and sharply differing

from it. For example, the characteristic deformation

of the skull, agenesis of the clavicle, scleroderma-like

skin changes, and hypognathia in the Hutchinson–

Gilford progeria are not typical of normal aging, and

the spectrum of tumors in the Werner’s syndrome

is not similar to that known for the elderly [39].

Pathology of natural aging in the laboratory rodents,

and, in particular, in mice, differs radically from the

human aging. Mice do not develop type 2 diabetes,

atherosclerosis (and associated ischemic brain and

heart damage), or Alzheimer’s disease, but they do

exhibit emaciation, lipofuscinosis, hair loss, atrophy

of lymph nodes and spleen, cataracts, and cardiomy-

opathy [22]. Mouse lines with mutations considered

as genetic models of progeria have extremely diverse

and dissimilar phenotypes, often affecting some tis-

sues and not others [40]. For obvious reasons, we

cannot say to what extent the changes we observe

correspond to the pathology of “normal aging” in

an animal such as the naked mole rat, but they are

quite consistent with those by which mutant mice

are classified as models of progeria [40]. At the same

time, the age-related signs such as hair loss, atrophic

changes in the gonads, or atrophy of lymph nodes

and spleen cannot be registered in the naked mole

rat due to its anatomical features (lack of hair and

atrophic changes in the gonads and lymphoid tissue

in the normal young worker animals) [10]. The dif-

ference between the disease we described and clas-

sical progerias in humans is that their manifestation

depends only on the genotype, without provoking

factors, or rather, such factors are unknown. How-

ever, in the case of autophagic progeroid syndrome,

the genetic factor is obviously significant, since it was

noted only in a small part of the animals. It is pos-

sible that we are dealing with, conditionally speak-

ing, a “reverse mutation,” restoring the type and rate

of aging characteristic of all other rodents in the

naked mole rat.

CONCLUSION

Thus, in an animal with negligible aging – the

naked mole rat – a condition was discovered that,

based on a number of signs, could be attributed to

the phenomena of accelerated aging (progeroid syn-

dromes or progeria). The exact mechanism of this

process requires further study, but our data indicate

autophagy dysfunction as a possible pathogenetic

mechanism of this syndrome.

STUDY LIMITATIONS

The limitations of this study include the follow-

ing circumstances mainly associated with working

with such a unique animal as the naked mole rat: rel-

atively small size of the studied sample, inability to

definitively prove a causal relationship between the

identified autophagy disorders and all the described

morphological manifestations of the progeroid pheno-

type, and retrospective nature of the studies.

Contributions

V. N. Manskikh and M. Yu. Vyssokikh – concept and

supervision of the work; V. N. Manskikh, E. V. Sheval,

M. V. Marey, and O. A. Averina – conducting the study

(O. A. Averina – animal observation, V. N. Manskikh –

histopathological analysis, E. V. Sheval – electron mi-

croscopy, M. V. Marey – analysis of gene and protein

marker expression of autophagy); V. N. Manskikh –

writing the text; E. V. Sheval and M. Yu. Vyssokikh –

editing the text of the article.

Funding

This work was financially supported by the Ministry

of Science and Higher Education of the Russian Feder-

ation (Agreement no.075-15-2025-489).

MANSKIKH et al.1982

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Ethics approval and consent to participate

All applicable international, national, and/or insti-

tutional guidelines for the care and use of animals

were followed. The study protocol was approved by

the Ethics Committee of the Belozersky Institute of

Physico-Chemical Biology, Lomonosov Moscow State

University (Protocol 2/20 dated 16.11.2022).

Conflict of interest

The authors of this work declare that they have no

conflicts of interest.

Open access

This article is licensed under a Creative Commons At-

tribution 4.0 International License, which permits use,

sharing, adaptation, distribution, and reproduction

in any medium or format, as long as you give appro-

priate credit to the original author(s) and the source,

provide a link to the Creative Commons license, and

indicate if changes were made. The images or other

third party material in this article are included in the

article’s Creative Commons license, unless indicated

otherwise in a credit line to the material. If materi-

al is not included in the article’s Creative Commons

license and your intended use is not permitted by

statutory regulation or exceeds the permitted use,

you will need to obtain permission directly from the

http://creativecommons.org/licenses/by/4.0/.

REFERENCES

1. Buffenstein, R. (2005) The naked mole-rat: a new

long-living model for human aging research, J.Geron-

tol. A Biol. Sci. Med. Sci., 60, 1369-1377, https://

doi.org/10.1093/gerona/60.11.1369.

2. Buffenstein, R. (2008) Negligible senescence in the

longest living rodent. the naked mole rat: insights

from a successfully aging species, J.Comp. Physiol.,

178, 439-445, https://doi.org/10.1007/s00360-007-0237-5.

3. Skulachev, V.P., Holtze,S., Vyssokikh, M.Y., Bakeeva,

L. E., Skulachev, M. V., Markov, A. V., Hildebrandt,

T. B., and Sadovnichii, V. A. (2017) Neoteny, prolon-

gation of youth: from naked mole rats to “naked

apes” (humans), Physiol. Rev., 97, 699-720, https://

doi.org/10.1152/physrev.00040.2015.

4. Liang, S., Mele, J., Wu, Y., Buffenstein, R., and

Hornsby, P. J. (2010) Resistance to experimental tu-

morigenesis in cells of a long-lived mammal, the

naked mole-rat (Heterocephalus glaber), Aging

Cell, 9, 626-635, https://doi.org/10.1111/j.1474-9726.

2010.00588.x.

5. Miyawaki, S., Kawamura, Y., Oiwa, Y., Shimizu, A.,

Hachiya, T., Bono, H., Koya, I., Okada, Y., Kimura, T.,

Tsuchiya, Y., Suzuki, S., Onishi, N., Kuzumaki, N.,

Matsuzaki, Y., Narita, M., Ikeda, E., Okanoya, K.,

Seino, K., Saya, H., Okano, H., and Miura, K. (2016)

Tumour resistance in induced pluripotent stem cells

derived from naked mole-rats, Nat. Commun., 7,

11471, https://doi.org/10.1038/ncomms11471.

6. Delaney, M.A., Ward, J.M., Walsh, T.F., Chinnadurai,

S. K., Kerns, K., Kinsel, M. J., and Treuting, P. M.

(2016) Initial case reports of cancer in naked mole-

rats (Heterocephalus glaber), Vet. Pathol., 53, 691-696,

https://doi.org/10.1177/0300985816630796.

7. Gorbunova, V., Seluanov, A., Zhang, Z., Gladyshev,

V. N., and Vijg, J. (2014) Comparative genetics of lon-

gevity and cancer: insights from long-lived rodents,

Nat. Rev. Genet., 15, 531-540, https://doi.org/10.1038/

nrg3728.

8. Oka, K., Fujioka, S., Kawamura, Y., Komohara, Y.,

Chujo, T., Sekiguchi, K., Yamamura, Y., Oiwa, Y.,

Omamiuda-Ishikawa, N., Komaki, S., Sutoh, Y.,

Sakurai, S., Tomizawa, K., Bono, H., Shimizu, A.,

Araki, K., Yamamoto, T., Yamada, Y., Oshiumi, H.,

and Miura,K. (2022) Resistance to chemical carcino-

genesis induction via a dampened inflammatory re-

sponse in naked mole-rats, Commun. Biol., 5, 287,

https://doi.org/10.1038/s42003-022-03241-y.

9. Edrey, Y.H., Hanes,M., Pinto,M., Mele,J., and Buffen-

stein, R. (2011) Successful aging and sustained good

health in the naked mole rat: a long-lived mam-

malian model for biogerontology and biomedical

research, ILAR J., 52, 41-53, https://doi.org/10.1093/

ilar.52.1.41.

10. Buffenstein, R., Park, T., Hanes, M., and Artwohl,

J. E. (2012) Naked mole rat, In The Laboratory Rab-

bit Guinea Pig, Hamster, Other Rodents, Elsevier,

Amsterdam, pp. 1055-1074, https://doi.org/10.1016/

B978-0-12-380920-9.00045-6.

11. Manskikh, V. N. (2010) Resistance of guinea pigs to

tumor growth: the reality of the phenomenon and

its possible causes [in Russian], Vopr. Oncol., 56,

514-520.

12. Delaney, M. A., Nagy, L., Kinsel, M. J., and Treuting,

P. M. (2013) Spontaneous histologic lesions of the

adult naked mole rat (Heterocephalus glaber): a

retrospective survey of lesions in a zoo population,

Vet. Pathol., 50, 607-621, https://doi.org/10.1177/

0300985812471543.

13. Delaney, M. A., Kinsel, M. J., and Treuting, P. M.

(2016) Renal pathology in a nontraditional aging

model: the naked mole-rat (Heterocephalus glaber),

Vet. Pathol., 53, 493-503, https://doi.org/10.1177/

0300985815612557.

14. Manskikh, V. N., Averina, O. A., and Nikiforova, A. I.

(2017) Spontaneous and experimentally induced pa-

thologies in the naked mole rat (Heterocephalus gla-

ber), Biochemistry (Moscow), 82, 1504-1512, https://

doi.org/10.1134/S0006297917120094.

PROGEROID SYNDROME 1983

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

15. Delaney, M.A., Imai, D.M., and Buffenstein,R. (2021)

Spontaneous disease and pathology of naked mole-

rats, Adv. Exp. Med. Biol., 1319, 353-380, https://

doi.org/10.1007/978-3-030-65943-1_15.

16. Manskikh, V. N. (2015) Chronic progressive nephrop-

athy in rodents as a disease caused by an expanding

somatic mutant clone, Biochemistry (Moscow), 80,

582-585, https://doi.org/10.1134/S0006297915050090.

17. Adrianov, M.A., Bobrov,M., Mamedov,I., Manskikh,V.,

Sheval, E. V., Rachkova, A. A., Shelechova, A. M.,

Eldarov, C. M., Averina, O. A., and Vyssokikh, M. Y.

(2025) A set of microRNAs are differentially ex-

pressed in cachexic naked mole rat colony mem-

bers after chronic heavy burden under normoxia,

Biochimie, 232, 83-90, https://doi.org/10.1016/j.biochi.

2025.01.010.

18. Suvarna, K., Layton, C. and Bancroft, J. D. (2019)

Bancrofts Theory and Practice of Histological Tech-

niques, 9th Edn, Elsevier.

19. Tucker, M. J. (1997) Diseases of the Wistar Rat,

Taylor and Francis, London, https://doi.org/10.4324/

9780203211250.

20. Maronpot, R. R. (1999) Pathology of the Mouse, Cache

River Press, Vienna, IL.

21. Percy, D. H., Griffey, S. M., and Barthold, S. W. (2016)

Pathology of Laboratory Rodents and Rabbits, Wiley-

Blackwell.

22. Mohr, U. (1996) Pathobiology of Aging Mouse,

Vols. 1/2, ILSI Press.

23. Vyssokikh, M. Yu., Vigovskiy, M. A., Philippov, V. V.,

Boroday, Ya. R., Marey, M. V., Grigorieva, O. A.,

Vepkhvadze, T. F., Kurochkina, N. S., Manukhova,

L. A., Efimenko, A. Yu., Popov, D. V., and Skulachev,

V. P. (2024) Age-dependent changes in the produc-

tion of mitochondrial reactive oxygen species in

human skeletal muscle, Biochemistry (Moscow), 89,

299-312, https://doi.org/10.1134/S0006297924020093.

24. Du, J., Liu, W., Li, M., Li, Z., Li, X., Dai, Y., Liu, G.,

Wang, X., Zhu, P., Gladyshev, V. N., and Zhou, X.

(2024) Comparative time-series multi-omics analyses

suggest H1.2 involvement in anoxic adaptation and

cancer resistance, PLoS Biol., 22, e3002778, https://

doi.org/10.1371/journal.pbio.3002778.

25. Kim,J., Chee, W.-Y., Yabuta,N., Kajiwara,K., Nada,S.,

and Okada, M. (2020) Atg5-mediated autophagy con-

trols apoptosis/anoikis via p53/Rb pathway in naked

mole-rat fibroblasts, Biochem. Biophys. Res. Com-

mun., 528, 146-153, https://doi.org/10.1016/j.bbrc.

2020.05.083.

26. Zhao, S., Li, L., Wang, S., Yu, C., Xiao, B., Lin, L.,

Cong, W., Cheng, J., Yang, W., Sun, W., and Cui, S.

(2016) H

treatment or serum deprivation in-

duces autophagy and apoptosis in naked mole-rat

skin fibroblasts by inhibiting the PI3K/Akt signaling

pathway, Oncotarget, 7, 84839-84850, https://doi.org/

10.18632/oncotarget.13321.

27. Maranni, E., Usunoff, K. G., and Feirabend, N. K. P.

(2009) Lipofuscin and lipofuscinosis, Encyclope-

dia Neurosci., 2009, 481-486, https://doi.org/10.1016/

B978-008045046-9.00126-1.

28. Ward, J.M., Cartoceti, A.N., and Delaney, M.A. (2021)

Brain lesions in aging zoo-housed naked mole-rats

(Heterocephalus glaber), Vet Pathol., 58, 142-146,

https://doi.org/10.1177/0300985820969982.

29. Suzuki, K., Kubota, Y., Sekito, T., and Ohsumi, Y.

(2007) Hierarchy of Atg proteins in pre-autophagoso-

mal structure organization, Genes Cells, 12, 209-218,

https://doi.org/10.1111/j.1365-2443.2007.01050.x.

30. Orsi,A., Razi,M., Dooley, H.C., Robinson,D., Weston,

A.E., Collinson, L.M., and Tooze, S.A. (2012) Dynam-

ic and transient interactions of Atg9 with autophago-

somes, but not membrane integration, are required

for autophagy, Mol. Biol. Cell., 23, 1860-1873, https://

doi.org/10.1091/mbc.E11-09-0746.

31. Klionsky, D.J., Petroni,G., Amaravadi, R.K., Baehrecke,

E. H., Ballabio, A., Boya, P., Bravo San Pedro, J. M.,

Cadwell, K., Cecconi, F., Choi, A. M. K., Choi, M. E.,

Chu, C. T., Codogno, P., Colombo, M. I., Cuervo,

A. M., Deretic, V., Dikic, I., Elazar, Z., Eskelinen, E.-L.,

Fimia, G.M., Gewirtz, D.A., Green, D.R., Hansen,M.,

Jäättelä, M., Johansen, T., Juhász, G., Karantza, V.,

Kraft, C., Kroemer, G., Ktistakis, N. T., Kumar, S.,

Lopez-Otin,C., Macleod, K.F., Madeo, F., Martinez, J.,

Meléndez, A., Mizushima, N., Münz, C., Penninger,

J. M., Perera, R. M., et al. (2021) Autophagy in major

human diseases, EMBO J., 40, e108863, https://

doi.org/10.15252/embj.2021108863.

32. Klionsky, D. J., Abdel-Aziz, A. K., Abdelfatah, S.,

Abdellatif, M., Abdoli, A., Abel, S., Abeliovich, H.,

Abildgaard, M. H., et al. (2021) Guidelines for the

use and interpretation of assays for monitoring au-

tophagy (4

 edition), Autophagy, 17, 1-382, https://

doi.org/10.1080/15548627.2020.1797280.

33. Viiri, J., Amadio, M., Marchesi, N., Hyttinen, J. M. T.,

Kivinen, N., Sironenm, R., Rillam, K., Akhtar, S.,

Provenzani,A., D’Agostino, A.G., Govoni,S., Pascale,A.,

Agostini, H., Petrovski, G., Salminen, A., and Kaar-

niranta, K. (2013) Autophagy activation clears

ELAVL1/HuR-mediated accumulation of SQSTM1/

p62 during proteasomal inhibition in human retinal

pigment epithelial cells, PLoS One, 8, e69563, https://

doi.org/10.1371/journal.pone.0069563.

34. Sakuma,K., Kinoshita,M., Ito,Y., Aizawa,M., Aoi,W.,

and Yamaguchi, A. (2015) 3p62/SQSTM1 but not LC3

is accumulated in sarcopenic muscle of mice, J. Ca-

chexia Sarcopenia Muscle, 7, 204-212, https://doi.org/

10.1002/jcsm.12045.

35. Peng, Y., Shapiro, S. L., Banduseela, V. C., Dieterich,

I.A., Hewitt, K. J., Bresnick, E.H., Kong,G., Zhang, J.,

Schueler, K. L., Keller, M.P., Attie, A. D., Hacker, T. A.,

Sullivan, R., Kielar-Grevstad, E., Arriola Apelo, S. I.,

Lamming, D.W., Anderson, R.M., and Puglielli,L. (2018)

MANSKIKH et al.1984

BIOCHEMISTRY (Moscow) Vol. 90 No. 12 2025

Increased transport of acetyl-CoA into the endoplas-

mic reticulum causes a progeria-like phenotype, Ag-

ing Cell, 17, e12820, https://doi.org/10.1111/acel.12820.

36. Sulzer, D., Mosharov, E., Talloczy, Z., Zucca, F. A.,

Simon, J. D., and Zecca, L. (2008) Neuronal pigment-

ed autophagic vacuoles: lipofuscin, neuromelanin,

and ceroid as macroautophagic responses during

aging and disease, J. Neurochem., 106, 24-36, https://

doi.org/10.1111/j.1471-4159.2008.05385.x.

37. Song, S.B., Shim,W., and Hwang, E.S. (2023) Lipofus-

cin granule accumulation requires autophagy activa-

tion, Mol. Cells, 46, 486-495, https://doi.org/10.14348/

molcells.2023.0019.

38. Reichel, W., and Garcia-Bunuel, R. (1970) Pathologic

findings in progeria: myocardial fibrosis and lipofus-

cin pigment, Am. J. Clin. Pathol., 53, 243-253, https://

doi.org/10.1093/ajcp/53.2.243.

39. Burtner, C.R., and Kennedy, B.K. (2010) Progeria syn-

dromes and ageing: what is the connection? Nat. Rev.

Mol. Cell Biol., 11, 567-578, https://doi.org/10.1038/

nrm2944.

40. Harkema, L., Youssef, S. A., and de Bruin, A. (2016)

Pathology of mouse models of accelerated aging,

Vet. Pathol., 53, 366-389, https://doi.org/10.1177/

0300985815625169.

Publisher’s Note. Pleiades Publishing remains

neutral with regard to jurisdictional claims in published

maps and institutional affiliations. AI tools may have

been used in the translation or editing of this article.