Article

ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 11, pp. 1652-1666 © The Author(s) 2025. This article is an open access publication.

Russian Text © The Author(s), 2025, published in Biokhimiya, 2025, Vol. 90, No. 11, pp. 1765-1780.

1652

Reporter System for Detection of G-Quadruplexes

in the Human Telomerase Reverse Transcriptase

Gene Promoter Region

Iuliia V. Iakushkina

, Elena A. Kubareva

, Liudmila A. Nikiforova

Alexander M. Arutyunyan

, Maria I.Zvereva

, and Mayya V. Monakhova

1,a

Belozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University,

119992 Moscow, Russia

Faculty of Chemistry, Lomonosov Moscow State University, 119991 Moscow, Russia

e-mail: monakhovamv@gmail.com

Received June 15, 2025

Revised September 23, 2025

Accepted September 24, 2025

Abstract— In 80-100% of cases, transformation of human somatic cells into tumor cells is associated with

the increased expression of the catalytic subunit of telomerase reverse transcriptase (hTERT). The hTERT

gene transcription inhibition in tumor cells may become one of the approaches to antitumor therapy. The

hTERT promoter contains a G-rich region with length of 68 nucleotides, which is capable of forming G-qua-

druplexes (G4) under certain conditions in vitro. It is known that G4s interfere with activity of the human

RNA polymerases. Thus, the G4 structure stabilization in the promoter could be considered as a possible

strategy to reduce hTERT expression. To prove G4 formation in the hTERT promoter G-rich sequence in

the double-stranded supercoiling DNA, plasmid constructs based on the pRFPCER plasmid were obtained.

The plasmids contained genes of fluorescent proteins (RFP and Cerulean) and sequence of the central G4 in

the hTERT promoter region. G4 formation in the central hTERT promoter region in the obtained constructs

was demonstrated with the DNA polymerase stop assay. The influence of G228A and G250A substitutions on

G4 stability under physiological conditions was investigated. It was established that the low-molecular weight

ligands BRACO19 and TMPyP4, the well-studied stabilizers of the G4 structure, can effectively interact with

the hTERT promotor central G4 in the range of concentrations 5-25 μM.

DOI: 10.1134/S0006297925601753

Keywords: hTERT promoter, human telomerase reverse transcriptase, G-quadruplex, G4-stabilizing ligands,

“driver” mutations

* To whom correspondence should be addressed.

INTRODUCTION

Telomerase comprises a ribonucleoprotein com-

plex responsible for maintenance of the length of

telomers, and it is considered vitally important for

the cell. Human telomerase reverse transcriptase

(hTERT) is usually inactive in somatic cells (with

stem cells being an exception), and its overexpres-

sion is observed in 85-90% of malignant tumors [1].

Under normal conditions, hTERT gene expression is

controlled by the transcription factors SP1, c-Myc,

BRCA1/2. In the case of driver mutations G228A or

G250A (positions1295228 and 1295250 of the human

chromosome  5, respectively) additional binding sites

for the ETS (Erythroblast Transformation Specific) or

TCF (ternary complex factors) factors appear in the

hTERT gene promoter region, which results in the

hTERT expression increase [2, 3].

The hTERT promoter contains a GC-rich region

with a length of 68 nucleotides. Presence of 12 tracts

of three or more 2′-deoxyguanosine residues in the

G-rich strand creates prerequisite for three tandems

parallel G4 formation under certain in vitro condi-

tions [4-6] (Fig. 1). It is considered that G4 structures

formation in the promoter region prevents human

DNA- and RNA-polymerases binding, and, likely, plays

SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1653

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

an important role in the hTERT gene expression regu-

lation [4,5]. According to one of the hypotheses, G228A

or G250A substitutions appearance in the central G4

results in G4 structure destabilization, which makes

this sequence more accessible for binding to vari-

ous enzymes and transcription factors [2, 3]. Hence,

G4-structure stabilization in the promoter could be

considered as a possible way to reduce expression of

the hTERT gene and tumor growth.

To investigate formation of G4 under physiolog-

ical conditions plasmid constructs that contain a re-

porter gene (such as systems based on luciferase or

GFP) and a sequence potentially capable of forming

G4 are often used. Such constructs serve as conve-

nient tools in investigation of G4 structures and their

effects on gene expression, because they allow to ex-

amine structures of any topology and varying ther-

modynamic stability [7, 8]. Considering that G4-struc-

tures are of interest from the point of view of disease

therapy, these reporter constructs could also be used

as a tool for selecting most effective low-molecular

weight ligands that affect G4 stability under physio-

logical conditions.

A large number of G4 stabilizing ligands has

been suggested so far. One of the best-investigated

G4 ligands is BRACO19 (3,6,9-trisubstituted derivative

of acridine – N,N′-(9-(4-(dimethylamine)phenylamino)

acrydin-3,6-diyl)bis(3-(pyrrolidine-1-yl)propane amide)

hydrochloride), which exhibits high affinity to telo-

meric G4 and is able to suppressing telomerase tran-

scription [9]. TMPyP4 (5,10,15,20-tetrakis-(N-methyl-4-

pyridyl)porphin) is also often used as a G4-stabilizing

ligand capable of inhibiting telomerase activity [10].

However, the exact mechanism of its action is not

known yet. PhenDC3 (3,3′-[1,10-phenantroline-2,9-diyl-

bis(carbonylamino)]bis[1-methylquinoline] 1,1,1-triflu-

oromethane sulfonate) also can bind telomeric G-rich

repeats and it is widely used invivo for G4 detection

[11, 12].

The goal of this study was development of re-

porter constructs containing genes of two fluorescent

proteins (RFP and Cerulean) and a sequence of the

central G4 in the promoter region of the wild type

hTERT or of the gene with driver mutations; as well

as analysis of the effect of G4 on reporter protein

gene expression. In the course of the study, it was

necessary to design the reporter construct and con-

struct of the double strand sequences inserts required

by the type of analysis, to evaluate the possibility of

formation and thermodynamic stability of the inves-

tigated G4 using single-stand models, and to test the

G4 formation possibility in the plasmid DNAs using

polymerase stop assay. One other goal was investiga-

tion of the effects of G4-stabilizing ligands (BRACO19,

TMPyP4, PhenDC3) on reporter gene expression in

bacterial system in order to examine the possibility

of the produced constructs application in the primary

screening of G4-stabilizing compounds, which could

be promising in treatment of various human diseases.

MATERIALS AND METHODS

Oligonucleotides and plasmid DNAs. Oligonu-

cleotides and primers used in the study are present-

ed in Table 1. Oligonucleotides were produced using

a standard phosphoramidite technique and purified

with electrophoresis in polyacrylamide gel (Evrogen,

Russia). Prior to conducting experiments, oligonu-

cleotides were additionally precipitated in ethanol

Fig. 1. Structural organization of the G-rich promoter region of the hTERT gene. Location of driver mutations in the central

G4 at positions -124 and -146 from the start codon (ATG) (positions 1295228 and 1295250 of the human chromosome  5,

respectively) are marked. TSS, transcription start site.

IAKUSHKINA et al.1654

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Table 1. Oligonucleotides used in the study

Name Oligonucleotide sequence (5′→3′)

41-WT pGGATCCCGGGTCCCCGGCCCAGCCCCCTCCAGGAGATATCA

41-C228T

pGGATCCCGGGTCCCCGGCCCAGCCCCTTCCAGGAGATATCA

41-C250T

pGGATTCCGGGTCCCCGGCCCAGCCCCCTCCAGGAGATATCA

41-C228T/C250T

pGGATTCCGGGTCCCCGGCCCAGCCCCTTCCAGGAGATATCA

41-c-Myc pGGATCCTTCCCCACCCTCCCCACCCTCCCCAGGAGATATCA

45-WT pTATGATATCTCCTGGAGGGGGCTGGGCCGGGGACCCGGGATCCGC

45-G228A

pTATGATATCTCCTGGAAGGGGCTGGGCCGGGGACCCGGGATCCGC

45-G250A

pTATGATATCTCCTGGAGGGGGCTGGGCCGGGGACCCGGAATCCGC

45-G228A/G250A

pTATGATATCTCCTGGAAGGGGCTGGGCCGGGGACCCGGAATCCGC

45-c-Myc pTATGATATCTCCTGGGGAGGGTGGGGAGGGTGGGGAAGGATCCGC

Stop_assay_primer (TAMRA)-TGCAGGTCGACAAGCTTGG

Cer_fw TGAGCAAGGGCGAGGAGC

Cer_rev TGGTGCAGATGAACTTCAGG

RFP_fw GCTGATCAAGGAGAACATGC

RFP_rev AGGATGTCGAAGGCGAAGG

Note. G-rich sequences potentially capable of forming G4 are highlighted with semi-bold italic font. Positions with nucleotide

substitutions are marked with gray.

according to the standard technique [13]. Concentra-

tion was determined with a NanoDrop ND-1000 spec-

trophotometer (Thermo Fisher Scientific, USA). Molar

extinction coefficients for DNA oligonucleotides were

calculated with the help of on-line service OligoAna-

lyzerTM Tool (https://www.idtdna.com/calc/analyzer).

A pRFPCER plasmid with a size of 3796base pairs

(bp) was provided by I.  A.  Osterman (Faculty of Chem-

istry, Lomonosov Moscow State University). It has

been successfully used for analysis of low-molecular

antibacterial compounds action mechanisms [14-16].

In the initial pRFPCER ampicillin resistance gene was

replaced with the kanamycin resistance genes using

the standard protocol and a NEBuilder® HiFi DNA

Assembly kit (NEB, United Kingdom).

Determination of the formation possibility and

thermodynamic stability of G4 using circular di-

chroism (CD) method. Samples (1  ml) of oligonucle-

otides 45-WT, 45-G228A, 45-G250A, 45-G228A/G250A,

45-c-Myc with absorption 0.5-0.6 were incubated at

95°C for 15  min in an 8  mM potassium phosphate

buffer (5.7  mM  K

HPO

; 2.2  mM  KH

; pH  7.1) con-

taining 100  mM  KCl followed by graduate cooling

for 16-18  h to room temperature. Circular dichroism

spectra were recorded in a quartz cuvette (Hellma

Analytics, Germany) with optical path length of 1  cm

in a temperature range from 20 to 85°C with 5°C-step

at average heating rate 1°C/min with a Chirascan

spectrophotometer (Applied Photophysics Ltd., Unit-

ed Kingdom). Spectra were recorded in the range

220-340  nm at scanning rate 30  nm/min and time of

signal averaging of 2  s under conditions of continous

flow of dry nitrogen. The obtained spectra were

smoothed with the Savitzky–Golay filter. Melting tem-

perature(T

) was defined as a temperature at which

50% of the sample was denatured. Errors in T

de-

termination were calculated based on the standard

deviations of the thermoregulator temperature [17].

Preparation of plasmid constructs containing

GC-rich inserts. A plasmid vector pRFPCER (200  ng)

was hydrolyzed in 50  µl of reaction medium including

5  µl of 10× buffer rCutSmart

for restriction (New

England BioLabs, USA) and restriction endonuclease

(RE) SacII (10  units/µl, 5  µl) and RE NdeI (10 units/µl,

5  µl) (Thermo Fisher Scientific) for 3  h at 37°C. Re-

action product was purified in a 1% agarose gel and

isolated from the gel with phenol-chloroform ex-

traction [18].

SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1655

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

DNA duplex insert was formed from synthetic

5′-phosphorylated oligonucleotides with length 41 and

45 nucleotide residues (nt) (Table  1). For this purpose,

a mixture of 41- and 45-mer oligonucleotides with

concentration 0.4  µM in water was incubated for

10  min at 95°C followed by gradual cooling to room

temperature for 3  h. The otained DNA duplex had

sticky ends required for insertion into a linearized

vector. Next, 50  ng of a linearized vector and 100-fold

excess of DNA duplexes were ligated with T4 DNA-

ligase (5 units; Thermo Fisher Scientific) in a corre-

sponding buffer solution (Thermo Fisher Scientific)

and incubated for 1 h at 37°C. After ligation the mix-

ture (5µl) was used for transformation of Escherichia

coli XL1-Blue cells using heat-shock method [19].

Plasmid DNA was isolated from cell colonies with

a MiniPrep BC021S kit for DNA isolation (Evrogen).

Accuracy of the construct sequence was confirmed by

sequencing in the Center for Collective Use ‘Genom’

(Russia). E.  coli JW5503 cells were transformed with

the obtained plasmid constructs.

Analysis of G4 formation in the plasmid con-

structs using polymerase stop assay. A PCR-mix

(10  µl) was prepared for each construct containing

1  µl of 10× buffer for Taq-polymerase with 50  mM

KCl (Thermo Fisher Scientific), 0.2  µl of 10  mM solu-

tion of deoxynucleotide triphosphates, 4  mM MgCl

Taq-polymerase (0.1  µl; final activity – 0.5  units;

Thermo Fisher Scientific), 1  µl of 10  µM Stop_assay_

primer solution, and 50  ng of plasmid DNA solution.

KCl concentration was increased to 100  mM to facili-

tate G4 formation. PCR conditions: initial denaturation

3  min at 95°C followed by 35 cycles (denaturation 30  s

at 90°C, primer annealing 1  min at 53°C, extension

1  min at 72°C); final extension 5  min at 72°C. Reac-

tion products were separated using electrophoresis in

10% polyacrylamide gel with 7  M urea. A standard

1× TBE-buffer was used for electrophoresis. Visual-

ization of fluorescent regions was carried out with

a Typhoon FLA 9500 imager (GE Healthcare Bio-Sci-

ences AB, Japan).

Determination of the reporter gene transcrip-

tion efficiency in E.  coli JW5503 cells containing

plasmid constructs. Cellular RNA was isolated with

an ExtractRNA solution (Evrogen) according to the

manufacturer’s instructions. Concentration of obtained

RNAs was determined with a spectrophotometer.

An aliquot (1  µl) from each sample was treated

in 20  µl of a reaction mixture with addition of 2  µl

of 10× buffer for DNAse and 1  µl of DNAse  I (Thermo

Fisher Scientific) at 37°C for 10  min. Next, reverse

transcription reaction was carried out. Reaction mix-

ture (20µl) contained 8µl of 2.5× mixture for reverse

transcription (Sintol, Russia), 1  µl of random hexam-

er primer mix, 2  µl of 20  mM DTT, 1.5  µl of MMLV

revertase solution (Moloney murine leukemia virus

reverse transcriptase) (50  U/µl; Sintol), 0.5  µl of Ribo-

lock RNAse inhibitor (40  U/µl; Thermo Fisher Scientif-

ic), and 7  µl of solution of RNA treated with DNAse.

PCR mix (20  µl) contained 4  µl of 5× qPCRmix-HS

SYBR (Evrogen), 0.8  µl of 10  µM mixture of the prim-

ers to the gene encoding either Cerulean protein or

RFP (Cer_fw/Cer_rev or RFP_fw/RFP_rev, respectively),

13.2  µl of water, and 2  µl of cDNA. PCR conditions:

initial denaturation 5  min at 95°C followed by 40 cy-

cles (denaturation for 30  s at 95°C, primer annealing

for 30  s at 60°C, extension 30  s at 72°C). For each

ligand experiment was conducted in two biological

replicates, within one biological replicate four tech-

nical replicates were performed. PCR data processing

was carried out with Excel software package. Signifi-

cance of differences between the amount of mRNA in

the cells with genetic constructs was evaluated with

ANOVA [20].

Analysis of reporter proteins expression in

E.  coli JW5503 cells containing reporter constructs

depending on concentration of G4 stabilizing li-

gands. Overnight cultures of E.  coli JW5503 cells

containing reporter constructs pContr, pWT, pG228A,

pG250A, pG228A/G250A, or pc-Myc, were diluted to

optical density of ~0.01 at 600 nm. G4-Stabilizing li-

gands BRACO19, TMPyP4, PhenDC3 (Sigma-Aldrich,

USA) were dissolved in DMSO to concentrations 200,

400, 1000  µM and 5-µl aliquots were placed into wells

of 96-well plates (Medpolimer, Russia). Volume in each

well was adjusted to 200  µl with diluted cull culture.

Microplates with cells were incubated for 24  h at

37°C and shaking at 220  rpm. Next, plates with cells

were centrifuged at 4°C (4200 rpm; Eppendorf, Ger-

many), washed with 0.9%  NaCl solution followed by

measuring optical density at 600  nm and fluorescence

of proteins Cerulean (excitation/emission wavelengths

430/491nm) and RFP (545/595 nm) with a SynergyH1

plate reader (BioTek Instruments (Agilent), USA).

To evaluate relative fluorescence of the Cerulean pro-

tein, fluorescence intensity of Cerulean was divided

by the intensity of fluorescence of RFP. Fluorescence

of 0.9% NaCl solution was not taken into consider-

ation in calculations, because it was significantly low-

er than the standard deviation for the protein fluo-

rescence. For each ligand experiment was carried out

in two biological replicates, and within one biological

replicate four technical replicates were performed.

RESULTS

To confirm G4 formation in the hTERT gene pro-

moter region in supercoiled genomic DNA in the cells

and to determine effect of the G4 stability on the re-

porter protein gene expression, reporter systems were

developed containing fragment of the hTERT gene

IAKUSHKINA et al.1656

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Fig. 2. Schematic representation of the reporter construct used for G4 structures detection. The inserted fragment contained

the hTERT gene promoter region central G4 (underlined); positions 228 and 250 are highlighted with semi-bold font.

promoter region as an insert to the 5′-untranslated

region (UTR) of the reporter gene (Fig. 2). Advantage

of using prokaryotic systems in the case of the hTERT

gene promoter region is in the fact of exclusion of

the effects of the human transcription factors on the

protein synthesis.

The pRFPCER plasmid DNA containing genes of

two fluorescent proteins, RFP and Cerulean, was used

as a basis [14,15]. In this construct, RFP and Cerulean

transcription is under control of two identical, but

individual T5 promoters (Fig.2). Hence, one of the flu-

orescent proteins, RFP, plays a role of internal control,

and facilitates monitoring of the certain process by

eliminating effects of other intracellular factors; while

the second protein, Cerulean, facilitates monitoring of

G4 formation. The ratio of the Cerulian fluorescence

to RFP fluorescence served as an analytical signal.

Two issues were considered during design of the

reporter constructs. 1)  Considering that the G-rich

region of the hTERT-promoter usually forms a mul-

ticomponent G4 structure, it would be extremely

difficult to differentiate the effect of a single nucle-

otide substitution on the particular G4. 2)  Insertion

of the long G-rich region of the hTERT-promoter to

the plasmid DNA could change significantly the pro-

tein transcription level independent on G4 formation.

In addition, we attempted to minimize the length of

the insert, in order to eliminate any effects on mRNA

stability and transcription factors recognition sites

formation. Based on these considerations, it was de-

cided to use the 41/45-mer insert containing fragment

of the hTERT promoter region only with the central

G4 with native structure and with substitutions G228A

and G250A. Despite the fact that the double substitu-

tion G228A/G250A has not been observed in nature,

we also used oligonucleotide with both substitutions,

because we expected more significant destabilization

of the G4 structure in this case. The G4 sequence from

the c-Myc promoter that had been investigated in de-

tail both in  vitro and in  vivo [21, 22] was used as a

reference.

It is believed that location of the G4 structure

in the 5′-UTR of the gene decreases the transcrip-

tion level and, hence, the protein synthesis level [7].

We hypothesized that the synthesis of Cerulean pro-

tein would be dependent on stability of the G4 formed

in the G-rich insert comprising the hTERT-promoter

fragment. In other words, the more stable is G4 in

front of the Cerulean gene, the lower is the synthesis

of the protein and, correspondingly, the lower Ceru-

lean fluorescence signal is observed.

Before the production of reporter constructs, it

was necessary to confirm that G4 indeed could be

formed in the 45-mer oligonucleotides. The used

oligonucleotides comprised non-modified sequenc-

es, and contained substitutions at positions 228 and

250 (G>A). To solve this problem, we used circular

dichroism method.

Secondary structures that differ from the canoni-

cal B-form of DNA, such as G4 and hairpins, could be

formed also in the plasmids with negative supercoil-

ing [23, 24]. G4-structures are considered less stable

thermodynamically and more labile in comparison

with double helix. That is why it was important to

demonstrate that G4 indeed could be present in the

context of double helix in these plasmids. To confirm

G4 formation in the plasmid constructs, polymerase

stop assay was used.

SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1657

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Fig. 3. CD spectra of the 45-mer oligonucleotides. Curves: 1)45-c-Myc, 2)45-WT, 3)45-G250A, 4)45-G228A, 5)45-G228A/G250A.

In our plasmid constructs the G4 of the promot-

er region of the hTERT gene is located in the sense

strand, hence, effect of the G4 structure on transcrip-

tion of the reporter Cerulean gene could be expected.

Effect of G4 stability on the mRNA synthesis of the

Cerulean protein was demonstrated using reverse-

transcription quantitative PCR.

In order to evaluate the possibility of using

G4-stabilizing ligands for reducing efficiency of the

hTERT expression in the case of presence of driver

mutations, fluorescent properties of the cells with

produced reporter constructs in the presence of BRA-

CO19, TMPyP4, and PhenDC3 were investigated.

Design of the reporter constructs. Use of DNA

duplexes with length 41/45 bp containing the hTERT

gene promoter region central G4 sequences with

G228A, G250A substitutions and without them were

suggested as fragments of the 5′-UTR of the report-

er gene (Fig.  2). In addition to the hTERT gene pro-

moter region the DNA duplexes contained the Shine-

Dalgarno sequence, which is cut out from the DNA

of the pRFPCER plasmid by the REs SacII and NdeI.

The initial plasmid pRFPCER (pContr) was used in

the experiments as a control to evaluate effect of in-

troduction of the 41/45-mer insert on the process of

Cerulean protein synthesis.

Prior to reporter constructs production, it was

necessary to confirm that G4 could indeed be formed

in the 45-mer oligonucleotides. It was shown that

the hTERT gene promoter region central G4 could be

formed already in the 30-mer models [25]. Howev-

er, the oligonucleotides used in our study contained

flanking regions, which could affect negatively the

G4 stability.

Determination of G4 thermodynamic stability

in 45-mer single-strand models. To evaluate the pos-

sibility of G4 structure formation and effect of G228A

and G250A substitutions on the G4 stability with CD

spectroscopy, the 45-mer models of single-strand

DNAs containing sequence of the hTERT gene pro-

moter region central G4 were investigated (Table 1).

Theobtained CD spectra of 45-WT, 45-G228A, 45-G250A,

45-G228A/G250A, and 45-c-Myc have characteristic

maximum at 265nm and minimum at 245nm, which

indicate formation of a parallel G4 (Fig.3). In general,

the values of circular dichroism of the 45-c-Myc are

1.5-2.0-fold higher than for oligonucleotides of hTERT

promoter region G4.

Melting curves for the structures are presented in

Fig. 4a from which their T

were calculated (Fig.  4b).

As expected, the G4 structure of 45-WT exhibits high-

er T

, than the G4 formed from oligonucleotides with

G-A substitutions. Presence of one substitution, either

G228A or G250A, only insignificantly affects stability

of the G4 structure, T

differ by 1-2°C. At the same

time, T

of the G4 with two substitutions 45-G228A/

G250A differs from the T

of the 45-WT by 8°C, this

means that introduction of the second nucleotide

substitution results in additional destabilization of

G4. It was not possible to evaluate accurately T

the G4-structure formed from 45-c-Myc, since this

structure remained stable at 80°C. Hence, the 45-mer

G-rich oligonucleotides 45-WT, 45-G228A, 45-G250A,

45-G228A/G250A, 45-c-Myc form sufficiently stable G4

in the presence of 100 mM KCl under the used exper-

imental conditions at 37°C.

Analysis of G4 formation in plasmid con-

structs. To confirm formation of G4 in the plasmid

constructs the polymerase stop assay was used. The

method is based on the fact that G4 is an obstacle for

Taq- polymerase, which inhibits the DNA strand elon-

gation on the template during the enzymatic reaction.

As a result, a shorter product is formed, which could

be detected using electrophoresis in polyacrylamide

gel. In order to increase stability of G4 under condi-

tions of PCR, KCl was added to the reaction mixture

IAKUSHKINA et al.1658

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Fig. 4. Melting curves obtained using CD spectroscopy at 265 nm (a); T

of G4-structures formed from the used oligonu-

cleotides (b). Designations on the panel (a), curves: 1) 45-WT, 2) 45-G228A, 3) 45-G250A, 4) 45-G228A/G250A, 5) 45-c-Myc.

Fig. 5. Products of the DNA strand elongation by Taq-polymerase. pContr, pG228A/G250A, pWT, pG228A, pG250A, pc-Myc

were used as templates in the presence of KCl (lanes 3-8, respectively). Lanes 1 and 2) markers with length 76  nt and

60  +  41  nt, respectively.

SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1659

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Fig. 6. Ratio of fluorescence of the Cerulean/RFP proteins in the E.coli cells containing constructs obtained in this study(a);

transcription efficiency of the Cerulean gene in these constructs (b). To evaluate significance of differences between

the amounts of mRNA in the cells with different genetic constructs ANOVA (one-way analysis of variance) was used.

p-values are shown.

up to concentration 100 mM. A product with length

around 76 nt was expected to be formed. It can be

seen in Fig.5 that the ‘stop’ of Taq-polymerase occurs

in the plasmids pWT, pG228A, pG250A, and pc-Myc.

Evaluation of reporter gene expression in the

E.  coli cells with plasmid constructs containing se-

quence of the hTERT gene promoter region cen-

tral G4. Analysis of the reporter constructs with two

fluorescent proteins in the E.coli JW5503 cells demon-

strated significant difference in the fluorescence sig-

nal between the cells transformed with pContr, pWT,

pG228A, pG250A, pG228A/G250A, and pc-Myc (Fig.6a).

The pContr plasmid was used as a control for reporter

protein fluorescence, the pc-Myc construct was used

as a reporter gene repression efficiency control due

to formation of G4, because this construct contains in-

sert of the same length as the hTERT promoter region

G4, but it forms a more stable G4 in comparison with

the former (Fig. 4b). In can be seen in Fig. 6 that the

cells with pContr and pG228A/G250A exhibited higher

ratio between the fluorescent signals of Cerulean and

RFP, and the cells with pWT and pc-Myc exhibited the

lowest ratio. In the case of the cells with pWT plasmid

the 3.2-fold decrease of the relative fluorescent signal

of the Cerulean protein was observed in comparison

with the pContr and the 1.6-fold increase in compar-

ison with the pc-Myc. The decrease of the Cerulean

protein fluorescence in the case of the pG250A plas-

mid was comparable with the case of pWT. Regarding

of pG228A and pG228A/G250A the fluorescence sig-

nal of Cerulean protein differed from the instance of

pContr approximately by 1.7- and 1.4-fold, respectively.

Analysis of the effect of G4 on reporter gene

mRNA synthesis. Effect of the G4 stability on the

mRNA synthesis was demonstrated using reverse-tran-

scription quantitative PCR. It can be seen in Fig.  6b

that the amount of mRNA for each construct correlates

with the Cerulean/RFP relative fluorescence level. The

highest amount of mRNA was observed in the case

of the cells with the pContr construct, the amount of

mRNA in the cells with the pG228A/G250A construct

was almost 2-fold lower. In all other cases the amount

of mRNA was significantly lower: ~6-12-fold lower in

comparison with the mRNA from pContr and ~3-6-fold

lower in comparison with pG228A/G250A. The mRNA

levels in the cells with pWT, pG228A, pG250A, pc-Myc

differ not so much, but the differences are statistically

significant (significance level α  =  0.05).

Effect of low-molecular weight ligands stabi-

lizing G-quadruplexes on synthesis of reporter

protein. Fluorescent properties of the cells with the

obtained reporter constructs were investigated in the

presence of G4-stabilizing ligands. For this purpose,

the most popular and well-characterized G4-stabiliz-

ing ligands were used: BRACO19, TMPyP4, PhenDC3

[26-28]. The histograms presented in Fig.  7 show rel-

ative fluorescence signal of the Cerulean/RFP proteins

in the presence of different ligand concentrations nor-

malized to the signal observed without addition of

any ligand.

IAKUSHKINA et al.1660

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Fig. 7. Histograms of dependence of Cerulean/RFP relative fluorescence in the cells with different reporter constructs (a)

normalized to fluorescence of the cells without ligand present on the concentration of the BRACO19, TMPyP4, PhenDC3

ligands in the concentration range 0-25 µM. Number of measurements: n = 6, confidence level: P = 0.95. Accurate values

of the normalized relative fluorescence of the Cerulean/RFP proteins are shown (b).

SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1661

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Using of relatively low concentration of BRA-

CO19 (5 µM) results in significant (20%) decrease of

the Cerulean expression in the cases of pWT, pG228A,

pG250A, and pc-Myc. No significant differences be-

tween the signals were observed in the calls with

pContr and pG228A/G250A. Using BRACO19 at con-

centration 25  µM resulted in almost 2-fold decrease

of the Cerulean fluorescence in the cells with all used

constructs, except pContr and pG228A/G250A.

Addition of TMPyP4 did not decrease expres-

sion of the Cerulean protein in the case of pContr

and pG228A/G250A. In the instance of pWT and pc-

Myc constructs, addition of even 25  µM resulted only

in insignificant decrease of the signal. At the same

time, synthesis efficiency of the Cerulean protein in

the cells with the constructs pG228A and pG250A de-

creased significantly at concentration of 5  µM, and at

25  µM it decreased more than 2-fold.

Addition of PhenDC3 does not result in notice-

able changes of the fluorescence signal in the cells.

Decrease of the Cerulean protein synthesis by 20%

is observed in the cells with the pc-Myc construct at

concentrations 10-25  µM.

DISCUSSION

G-quadruplex (G4) is an element of secondary

structure in nucleic acids formed from the sequences

enriched with 2′-deoxyguanosine residues. G4s could

form structures of different topologies differing in

directions of the strands and length and composition

of the loops [29]. Numerous evidence reported in the

literature indicates a key role of G4s in important bio-

logical processes, in humans in particular [30]. G4-Mo-

tifs were found in human protooncogenes including

the best-known c-Myc [31], VEGF [32], c-kit [33], and

BCL2 [34].

Stabilization or destabilization of G4 structures

could affect functioning of the G4-binding transcrip-

tion factors, polymerases, and other enzymes, and, as

a consequence, affect efficiency of the gene transcrip-

tion [35]. Hence, development of therapeutic agents

facilitating formation or unfolding of the specific G4

structures could be a promising direction for devel-

opment of novel types of anti-tumor preparations.

At present, ligands have been identified that are ca-

pable of specific binding to the G4 structure of par-

ticular topology, however, the attempts to bind the G4

structure in the vicinity of a particular gene so far

failed. To improve selectivity of G4 ligands action, use

of their conjugates with oligodeoxyribonucleotides en-

suring binding of the ligand to the G4 structure only

at the genome sites capable of complementary inter-

actions with the guide DNA has been suggested [36].

Formation of G4 structure is potentially possible in

the hTERT gene promotor region. This region could

contain nucleotide substitutions found in tumor cells

(G228A and G250A) [37, 38].

To test the hypothesis that hTERT overexpression

could be due to G4 destabilization, we developed a

reporter system containing the fragment of the hTERT

gene promotor region that forms the central G4, as

the 5′-UTR reporter gene. The system was based on

the pRFPCER plasmid DNA containing genes of two

fluorescent proteins, RFP and Cerulean. The similar

constructs were successfully used for assessment of

the effect of the loop length in G4 located in the re-

porter proteins promoter regions on transcription and

translation in E.  coli [8]. Previously, the luciferase sys-

tem [39-41] and the system based on GFP [42] were

successfully used for evaluation of the effects of nu-

cleotide substitutions on the synthesis of the hTERT

protein. The luciferase system was also used for eval-

uation of the effect of G4-stabilizing ligands on tran-

scription of c-Myc[43], BCL-2[44], c-kit[45], and telo-

merase activity [46]. However, it should be noted that

luciferase system demonstrates indirect response via

oxidation of luciferin. The pRFPCER reporter system

suggested in this study does not have this drawback:

it provides direct response of the fluorescent proteins,

which makes this system faster and easier to use.

To evaluate the possibility of formation of G4

structures and effect of G228A and G250A substitu-

tions on G4 stability, CD spectroscopy was used. The

obtained CD spectra for the 45-WT indicated formation

of the parallel G4 (Fig.  3). It was shown that the G-rich

45-mer oligonucleotides (Table  1) 45-WT, 45-G228A,

45-G250A, 45-G228A/G250A, and 45-c-Myc form rela-

tively stable G4 in the presence of 100  mM  KCl under

common experimental conditions (at 37°C).

The melting curves obtained with CD spectrosco-

py with detection at 265  nm demonstrated that the G4

structure formed from 45-WT has a higher T

than

the G4 structures formed from the sequences with

single substitutions, and introduction of the second

substitution resulted in the further destabilization of

the G4 structure. It was important to show that G4s

indeed could be present in the double helix context in

the obtained plasmids. To confirm the G4 formation

in the plasmid structure, the polymerase stop assay

was used. The polymerase ‘stop’ in the pc-Myc plas-

mid was found to be more significant in comparison

with the plasmids containing sequence of the hTERT

gene promotor region central G4 (Fig.  5). Such a sig-

nificant ‘stop’ was expected for the pc-Myc based on

the ‘melting’ data in the single-strand model.

Two ‘stops’ occur on the pWT and pG228A plas-

mid DNA: one before the G4 structure providing the

76-nt product and on the loop, providing the longer

products. Interestingly, in the plasmid with G250A

substitution there is a third ‘stop’ of Taq-polymerase.

IAKUSHKINA et al.1662

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Testing of the 96-mer single-stranded oligonucleotides

containing all three G4s of the hTERT promoter re-

gion using dimethyl sulfate probing method in our

research group revealed that the G250A substitution

causes destabilization not only in this G-tract, but also

in the next one [47]. The same, likely, occurs in the

plasmid. The double substitution G228A/G250A in the

case of G4 from the hTERT gene promoter results in

complete destruction of G4. As one could expect, no

polymerase ‘stop’ was observed in the pG228A/G250A

construct, same as in the case of pContr. Hence, the

central G4 of the hTERT gene promoter region can be

formed in the plasmid construct in the double helix

context and under conditions of supercoiling. Despite

the fact that the extension temperature in PCR (72°C)

is higher than T

of the structures in the single-strand

models 45-WT, 45-G228A, 45-G250A (Fig.  4b), super-

coiling of the plasmid DNA makes existence of G4 in

the plasmid DNA possible.

Two bands in the gel were also observed in the

case of pc-Myc. Considering that G4 from the c-Myc

promoter contains 5 G-tetrads, it potentially could

form structures with different topology [22,  48].

Hence, it could be hypothesized that emergence of the

band with weaker intensity is associated with forma-

tion of the structure, in which the first G-tetrad does

not participate [49].

Analysis of relative Cerulean/RFP fluorescence of

the E. coli cells transformed with the constructs ob-

tained in this study demonstrated that the change in

fluorescence correlates with the ability of inserted se-

quences to form G4: the more stable is G4, the lower

is the Cerulean fluorescence. Relative increase of the

Cerulean/RFP fluorescence signal could be explained

by the destruction (or absence) of the G4 structure

in the cell, which interferes with the process of Ce-

rulean gene transcription. Indeed, the highest rela-

tive fluorescence is observed for the cells containing

constructs pContr and pG228A/G250A, and the low-

est – for the cells with pWT and pc-Myc (Fig.  6a).

It is known that introduction of G228A and G250A

substitutions locally disrupt the G4 structure [47]

and, consequently, should increase efficiency of the

Cerulean protein synthesis in comparison with the

wild type hTERT gene. It was found that the G228A

substitution destabilizes G4 to a larger degree than

the G250A substitution; and the double substitution

significantly disrupts the G4 structure. As expected,

the double substitution destabilizes the G4 structure

more significantly than the single substitutions. Cer-

tain decrease of the relative fluorescence of the cells

containing the pG228A/G250A construct in comparison

with the pContr could be explained by both presence

of a longer sequence before the Cerulean gene, and by

partial formation of G4 at 37°C. Although destruction

of this structure was shown under conditions of PCR,

one should take into account that PCR occurs at high

temperatures (extension at 72°C), which facilitates

destruction of the hTERT gene promoter region G4

containing two substitutions, while effect of the steric

factor associated with supercoiling seems to be insuf-

ficient to maintain the structure.

The method of reverse transcription quantitative

PCR was used to demonstrate the effect of G4 stability

on synthesis of the Cerulean protein mRNA. It was

found out that the amount of mRNA for each con-

struct correlates with the level of relative Cerulean/

RFP fluorescence. The lowest amount of the Cerule-

an mRNA was synthesized in the cells with pWT and

pc-Myc, which increased in the cells with pG250A and

pG228A. Hence, the effect of G4 stability is observed

at the level of transcription, which is manifested by

the amount of mRNA of the Cerulean reporter gene.

With the goal to evaluate the possibility of using

G4-stabilizing ligands for decreasing hTERT expression

efficiency in the case of appearance of driver muta-

tions, fluorescent properties of the cells containing

the obtained reporter constructs were investigated in

the presence of BRACO19, TMPyP4, PhenDC3 (Fig.  7).

The selected ligands differ in efficiency of binding

to G4. Dissociation constant values obtained using

fluoresence titration method [50] and surface plas-

mon resonance technique [51] for the complexes

with parallel G4s are in the range for BRACO19:

6  ×  10

−8

–7  ×  10

−7

  M, for TMPyP4: 2  ×  10

−7

–2  ×  10

−6

for PhenDC3: 2  ×  10

−11

–2  ×  10

−6

  M. According to these

data PhenDC3 exhibits the most pronounced ability

to bind G4 in comparison with BRACO19 and TMPyP4,

however, it causes only minor stabilization of the G4

from pc-Myc, the most stable among the G4s investi-

gated in this study.

Based on our results, from the point of view

of stabilization of the hTERT gene promoter region

central G4, the best ligand is BRACO19 (decrease of

expression of the Cerulean protein in the case of

pWT, pG228A, pG250A, and pc-Myc by 20% at 5  µM

concentration of BRACO19), because it is capable to

produce a significant decrease of the Cerulean protein

synthesis even in the cells containing constructs with

stable G4 (pWT and pc-Myc). However, this compound

is rather toxic, which limits its application [52].

In our experiments addition of TMPyP4 did not

cause death of the E.  coli cells containing reporter

constructs at the ligand concentrations up to 80  µM

(data not shown). Hence, unlike the BRACO19, TMPyP4

is not toxic for the cells, but its addition causes only

the minor difference in the level of the Cerulean pro-

tein synthesis in the cells with the constructs contain-

ing stable G4 (~20% for the pWT and pc-Myc at 25  µM

of TMPyP4). TMPyP4 preferably binds to the destabi-

lized G4-structures, because the decrease in the Ce-

rulean fluorescence in the cells containing constructs

SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1663

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

pG228A and pG250A is much more pronounced. This

observation is of fundamental importance, and sets

the stage for the development of G4 ligands distin-

guishing stable and unstable structures.

Hence, the reporter system developed in this

study could be used for evaluating stability of G4,

including on addition of low-molecular ligands of

various structures.

CONCLUSIONS

Reporter constructs were generated in this study

that contain genes of two fluorescent proteins, RFP

and Cerulean, and fragment of the sequence of the

hTERT gene promotor region containing sequence of

the central G4 of either the wild type or with driver

mutations. Effect of the driver substitutions G228A

and G250A on stability of G4 was investigated invitro

and under physiological conditions. It was shown that

the 45-mer G-rich oligonucleotides 45-WT, 45-G228A,

45-G250A, 45-G228A/G250A, 45-c-Myc form relatively

stable G4 in  vitro. The most stable G4 were shown to

exist in the context of double helix in the obtained

plasmids and even under conditions of PCR (primer

extension was carried out at 72°C). Effect of G4 stabili-

ty on synthesis of mRNA of the Cerulean reporter gene

was demonstrated. It was shown that the synthesis of

mRNA of the Cerulean gene in the cells with stable G4

in the genetic construct is reduced. It was found that

the amount of mRNA for each construct correlated

with the level of relative Cerulean/RFP fluorescence.

It was established that the level of relative Ce-

rulean/RFP fluorescence in the cells decreases with

increase of stability of G4 in the insert. It was shown

that the low-molecular weight ligands, BRACO19 and

TMPyP4, are capable of stabilizing the central G4 from

the hTERT gene promoter region in the concentration

range 5-25  µM. This is manifested by the decrease

of the relative Cerulean/RFP fluorescence. Among

the considered G4-stabilizing ligands, the highest at-

tention from the point of view of drug development

should be paid to TMPyP4 due to its higher specific-

ity towards destabilized quadruplex structure. Hence,

the reporter system suggested in this study could be

used for evaluation of G4 stability, including in the

cases with addition of G4-ligands of various structures

and primary screening of stabilizers in the bacterial

system.

Abbreviations

CD circular dichroism

BRACO19 N,N′-(9-(4-(dimethylamine)phenylamino)

acrydin-3,6-diyl)bis(3-(pyrrolidine-1-yl)

propane amide) hydrochloride

G4 G-quadruplex

hTERT human telomerase reverse transcrip-

tase

PhenDC3 3,3′-[1,10- phenanthroline-2,9-

diylbis(carbonylamino)]bis[1-methyl-

quinoline] 1,1,1-trifluoromethane

sulfonate

RE restriction endonuclease

melting temperature

TMPyP4 5,10,15,20-tetrakis-(N-methyl-4-pyridyl)

porphin

Acknowledgments

The authors of this work express their gratitude to

the Russian Science Foundations for supporting the

preliminary experiments (project no. 21-14-00161).

The authors are grateful to the leading scientist

N. G. Dolinnaya (Faculty of Chemistry, Lomonosov

Moscow State University) for valuable critical com-

ments and recommendations.

Contributions

E. A. Kubareva and M. E. Zvereva – concept and super-

vision of the study; Yu. V. Iakushkina, M. V. Monakho-

va, and A. M. Arutyunyan – conducting experiments;

Yu. V. Iakushkina, M. V. Monakhova, E. A. Kubareva,

M. E. Zvereva, and L. A. Nikiforova – discussion of the

results of the study; Yu. V. Iakushkina and L. A. Niki-

forova – writing of the manuscript; M. V. Monakhova

and E. A. Kubareva – editing text of the paper.

Funding

This work was financially supported by the Russian

Science Foundation (grant no.25-24-00161).

Ethics approval and consent to participate

This work does not contain any studies involving hu-

man and animal subjects.

Conflict of interest

The authors of this work declare that they have

noconflicts of interest.

Open access

This article is licensed under a Creative Commons

Attribution 4.0 International License, which permits

use, sharing, adaptation, distribution, and reproduc-

tion in any medium or format, as long as you give

appropriate credit to the original author(s) and the

source, provide a link to the Creative Commons li-

cense, and indicate if changes were made. The images

or other third party material in this article are includ-

ed in the article’s Creative Commons license, unless

indicated otherwise in a credit line to the material.

If material is not included in the article’s Creative

Commons license and your intended use is not permit-

ted by statutory regulation or exceeds the permitted

IAKUSHKINA et al.1664

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

use, you will need to obtain permission directly from

the copyright holder. To view a copy of this license,

visit http://creativecommons.org/licenses/by/4.0/.

REFERENCES

1. Cong, Y.S., Wen,J., and Bacchetti,S. (1999) Thehuman

telomerase catalytic subunit hTERT: organization of the

gene and characterization of the promoter, Hum. Mol.

Genet., 8, 137-142, https://doi.org/10.1093/hmg/8.1.137.

2. Xu,D., Dwyer,J., Li,H., Duan,W., and Liu, J.-P. (2008)

Ets2 maintains hTERT gene expression and breast

cancer cell proliferation by interacting with c-Myc,

J.Biol. Chem., 283, 23567-23580, https://doi.org/10.1074/

jbc.M800790200.

3. Li,H., Lee, T.-H., and Avraham,H. (2002) A novel tri-

complex of BRCA1, Nmi, and c-Myc inhibits c-Myc-in-

duced human telomerase reverse transcriptase gene

(hTERT) promoter activity in breast cancer, J. Biol.

Chem., 277, 20965-20973, https://doi.org/10.1074/

jbc.M112231200.

4. Monsen, R. C., DeLeeuw, L., Dean, W. L., Gray, R. D.,

Sabo, T.M., Chakravarthy,S., Chaires, J.B., and Trent,

J. O. (2020) The hTERT core promoter forms three

parallel G-quadruplexes, Nucleic Acids Res., 48, 5720-

5734, https://doi.org/10.1093/nar/gkaa107.

5. Bochman, M.L., Paeschke,K., and Zakian, V.A. (2012)

DNA secondary structures: stability and function of

G-quadruplex structures, Nat. Rev. Genet., 13, 770-780,

https://doi.org/10.1038/nrg3296.

6. Verma, A., Yadav, V. K., Basundra, R., Kumar, A.,

and Chowdhury, S. (2009) Evidence of genome-wide

G4 DNA-mediated gene expression in human can-

cer cells, Nucleic Acids Res., 37, 4194-4204, https://

doi.org/10.1093/nar/gkn1076.

7. Holder, I. T., and Hartig, J. S. (2014) A matter of loca-

tion: influence of G-quadruplexes on Escherichia coli

gene expression, Chem. Biol., 21, 1511-1521, https://

doi.org/10.1016/j.chembiol.2014.09.014.

8. Lee, C.-Y., Joshi, M., Wang, A., and Myong, S. (2024)

5′UTR G-quadruplex structure enhances translation

in size dependent manner, Nat. Commun., 15, 3963,

https://doi.org/10.1038/s41467-024-48247-8.

9. Burger, A. M., Dai, F., Schultes, C. M., Reszka, A. P.,

Moore, M. J., Double, J. A., and Neidle, S. (2005)

The G-quadruplex-interactive molecule BRACO-19

inhibits tumor growth, consistent with telomere tar-

geting and interference with telomerase function,

Cancer Res., 65, 1489-1496, https://doi.org/10.1158/

0008-5472.CAN-04-2910.

10. Han, F. X., Wheelhouse, R. T., and Hurley, L. (1999)

Interactions of TMPyP4 and TMPyP2 with quadru-

plex DNA. Structural basis for the differential effects

on telomerase inhibition, J.Am. Chem. Soc., 121,

3561-3570, https://doi.org/10.1021/ja984153m.

11. Piazza, A., Boulé, J. B., Lopes, J., Mingo, K., Largy, E.,

Teulade-Fichou, M.-P., and Nicolas, A. (2010) Genet-

ic instability triggered by G-quadruplex interacting

Phen-DC compounds in Saccharomyces cerevisiae, Nu-

cleic Acids Res., 38, 4337-4348, https://doi.org/10.1093/

nar/gkq136.

12. Obi, I., Rentoft, M., Singh, V., Jamroskovic, J.,

Chand,K., Chorell,E., Westerlund,F., and Sabouri,N.

(2020) Stabilization of G-quadruplex DNA structures

in Schizosaccharomyces pombe causes single-strand

DNA lesions and impedes DNA replication, Nucleic

Acids Res., 48, 10998-11015, https://doi.org/10.1093/

nar/gkaa820.

13. Green, M. R., and Sambrook, J. (2016) Precipitation

of DNA with ethanol, Cold Spring Harb. Protoc., 12,

https://doi.org/10.1101/pdb.prot093377.

14. Osterman, I. A., Prokhorova, I. V., Sysoev, V. O.,

Boykova, Y.V., Efremenkova, O.V., Svetlov, M.S., Kolb,

V. A., Bogdanov, A. A., Sergiev, P. V., and Dontsova,

O. A. (2012) Attenuation-based dual-fluorescent-

protein reporter for screening translation inhibitors,

Antimicrob. Agents Chemother., 56, 1774-1783, https://

doi.org/10.1128/AAC.05395-11.

15. Osterman, I. A., Evfratov, S. A., Sergiev, P. V., and

Dontsova, O.A. (2013) Comparison of mRNA features

affecting translation initiation and reinitiation, Nu-

cleic Acids Res., 41, 474-486, https://doi.org/10.1093/

nar/gks989.

16. Polikanov, Y. S., Osterman, I. A., Szal, T., Tashlitsky,

V. N., Serebryakova, M. V., Kusochek, P., Bulkley, D.,

Malanicheva, I.A., Efimenko, T.A., Efremenkova, O.V.,

Konevega, A.L., Shaw, K.J., Bogdanov, A.A., Rodnina,

M.V., Dontsova, O.A., Mankin, A.S., Steitz, T.A., and

Sergiev, P. V. (2014) Amicoumacin a inhibits transla-

tion by stabilizing mRNA interaction with the ribo-

some, Mol. Cell., 56, 531-540, https://doi.org/10.1016/

j.molcel.2014.09.020.

17. Vorlíčková, M., Kejnovská, I., Sagi, J., Renčiuk, D.,

Bednářová, K., Motlová, J., and Kypr, J. (2012) Circu-

lar dichroism and guanine quadruplexes, Methods,

57, 64-75, https://doi.org/10.1016/j.ymeth.2012.03.011.

18. Sambrook,J., and Russell, D.W. (2006) Purification of

nucleic acids by extraction with phenol:chloroform,

Cold Spring Harb. Protoc., 1, https://doi.org/10.1101/

pdb.prot4455.

19. Froger, A., and Hall, J. E. (2007) Transformation of

plasmid DNA into E.coli using the heat shock meth-

od, J.Vis. Exp., 6, 253, https://doi.org/10.3791/253.

20. Mishra, P., Singh, U., Pandey, C. M., Mishra, P., and

Pandey,G. (2019) Application of student’s t-test, analy-

sis of variance, and covariance, Ann. Card. Anaesth.,

22, 407-411, https://doi.org/10.4103/aca.ACA_94_19.

21. Yang,D., and Hurley, L.H. (2006) Structure of the bio-

logically relevant G-quadruplex in the c-Myc promot-

er, Nucleosides Nucleotides Nucleic Acids, 25, 951-968,

https://doi.org/10.1080/15257770600809913.

SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1665

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

22. Siddiqui-Jain,A., Grand, C.L., Bearss, D.J., and Hurley,

L. H. (2002) Direct evidence for a G-quadruplex in a

promoter region and its targeting with a small mole-

cule to repress c-Myc transcription, Proc. Natl. Acad.

Sci. USA, 99, 11593-11598, https://doi.org/10.1073/

pnas.182256799.

23. Kouzine,F., Sanford,S., Elisha-Feil,Z., and Levens,D.

(2008) The functional response of upstream DNA to

dynamic supercoiling invivo, Nat. Struct. Mol. Biol.,

15, 146-154, https://doi.org/10.1038/nsmb.1372.

24. Sekibo, D. A. T., and Fox, K. R. (2017) The effects of

DNA supercoiling on G-quadruplex formation, Nucle-

ic Acids Res., 45, 12069-12079, https://doi.org/10.1093/

nar/gkx856.

25. Savitskaya, V. Y., Novoselov, K. A., Dolinnaya, N. G.,

Monakhova, M. V., Snyga, V. G., Diatlova, E. A.,

Peskovatskova, E. S., Golyshev, V. M., Kitaeva, M. I.,

Eroshenko, D. A., Zvereva, M. I., Zharkov, D. O., and

Kubareva, E. A. (2025) Position-dependent effects of

AP sites within an hTERT promoter G-quadruplex

scaffold on quadruplex stability and repair activity

of the APE1 enzyme, Int.J. Mol. Sci., 26, 337, https://

doi.org/10.3390/ijms26010337.

26. Campbell, N. H., Parkinson, G. N., Reszka, A. P., and

Neidle, S. (2008) Structural basis of DNA quadruplex

recognition by an acridine drug, J.Am. Chem. Soc.,

130, 6722-6724, https://doi.org/10.1021/ja8016973.

27. Wheelhouse, R. T., Sun, D., and Hurley, L. H. (1998)

Cationic porphyrins as telomerase inhibitors: the in-

teraction of tetra-(N-methyl-4-pyridyl)porphine with

quadruplex DNA, J.Am. Chem. Soc., 120, 3261-3262,

https://doi.org/10.1021/ja973792e.

28. De Cian,A., Delemos,E., Mergny, J.-L., Teulade-Fichou,

M.-P., and Monchaud, D. (2007) Highly efficient

G-quadruplex recognition by bisquinolinium com-

pounds, J.Am. Chem. Soc., 129, 1856-1857, https://

doi.org/10.1021/ja067352b.

29. Parkinson, G. N., and Collie, G. W. (2019) X-Ray crys-

tallographic studies of G-quadruplex structures, Meth-

ods Mol. Biol., 2035, 131-155, https://doi.org/10.1007/

978-1-4939-9666-7_8.

30. Dolinnaya, N.G., Ogloblina, A.M., and Yakubovskaya,

M. G. (2016) Structure, properties, and biological rel-

evance of the DNA and RNA G-quadruplexes: over-

view 50 years after their discovery, Biochemistry

(Moscow), 81, 1602-1649, https://doi.org/10.1134/

S0006297916130034.

31. Simonsson,T., Pecinka,P., and Kubista,M. (1998) DNA

tetraplex formation in the control region of c-myc,

Nucleic Acids Res., 26, 1167-1172, https://doi.org/

10.1093/nar/26.5.1167.

32. Sun,D., Guo,K., Rusche, J.J., and Hurley, L.H. (2005)

Facilitation of a structural transition in the polypu-

rine/polypyrimidine tract within the proximal pro-

moter region of the human VEGF gene by the presence

of potassium and G-quadruplex-interactive agents,

Nucleic Acids Res., 33, 6070-6080, https://doi.org/

10.1093/nar/gki917.

33. Rankin, S., Reszka, A. P., Huppert, J., Zloh, M.,

Parkinson, G. N., Todd, A. K., Ladame, S., Balasu-

bramanian, S., and Neidle, S. (2005) Putative DNA

quadruplex formation within the human c-kit on-

cogene, J.Am. Chem. Soc., 127, 10584-10589, https://

doi.org/10.1021/ja050823u.

34. Dai, J., Dexheimer, T. S., Chen, D., Carver, M.,

Ambrus,A., Jones, R.A., and Yang,D. (2006) Anintra-

molecular G-quadruplex structure with mixed paral-

lel/antiparallel G-strands formed in the human BCL-2

promoter region in solution, J.Am. Chem. Soc., 128,

1096-1098, https://doi.org/10.1021/ja055636a.

35. Eddy, J., and Maizels, N. (2006) Gene function cor-

relates with potential for G4 DNA formation in the

human genome, Nucleic Acids Res., 34, 3887-3896,

https://doi.org/10.1093/nar/gkl529.

36. Berner, A., Das, R. N., Bhuma, N., Golebiewska, J.,

Abrahamsson, A., Andréasson, M., Chaudhari, N.,

Doimo, M., Bose, P. P., Chand, K., Strömberg, R.,

Wanrooij, S., and Chorell, E. (2024) G4-ligand-conju-

gated oligonucleotides mediate selective binding and

stabilization of individual G4 DNA structures, J. Am.

Chem. Soc., 146, 6926-6935, https://doi.org/10.1021/

jacs.3c14408.

37. De Cian,A., Lacroix,L., Douarre,C., Temime- Smaali,N.,

Trentesaux,C., Riou, J.F., and Mergny, J.L. (2008) Tar-

geting telomeres and telomerase, Biochimie, 90, 131-

155, https://doi.org/10.1016/j.biochi.2007.07.011.

38. Asamitsu, S., Obata, S., Yu, Z., Bando, T., and

Sugiyama, H. (2019) Recent progress of targeted

G-quadruplex-preferred ligands toward cancer ther-

apy, Molecules, 24, 429, https://doi.org/10.3390/mole-

cules24030429.

39. Panebianco, F., Nikitski, A. V., Nikiforova, M. N.,

and Nikiforov, Y. E. (2019) Spectrum of TERT pro-

moter m utations and mechanisms of activation in

thyroid cancer, Cancer Med., 8, 5831-5839, https://

doi.org/10.1002/cam4.2467.

40. Vinagre, J., Nabais, J., Pinheiro, J., Batista, R.,

Oliveira, R. C., Gonçalves, A. P., Pestana, A., Reis, M.,

Mesquita, B., Pinto, V., Lyra, J., Cipriano, M. A.,

Ferreira, M.G., Lopes, J.M., Sobrinho-Simões,M., and

Soares,P. (2016) TERT promoter mutations in pancre-

atic endocrine tumours are rare and mainly found

in tumours from patients with hereditary syndromes,

Sci. Rep., 6, 29714, https://doi.org/10.1038/srep29714.

41. Huang, D.-S., Wang,Z., He, X.-J., Diplas, B.H., Yang,R.,

Killela, P. J., Meng, Q., Ye, Z.-Y., Wang, W., Jiang, X.-T.,

Xu,L., He, X.-L., Zhao, Z.-S., Xu, W.-J., Wang, H.-J., Ma,

Y.-Y., Xia, Y.-J., Li, L., Zhang, R.-X., Jin, T., Zhao, Z.-K.,

Xu,J., Yu,S., Wu,F., Liang,J., Wang,S., Jiao,Y., Yan,H.,

and Tao, H.-Q. (2015) Recurrent TERT promoter mu-

tations identified in a large-scale study of multiple

tumour types are associated with increased TERT

IAKUSHKINA et al.1666

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

expression and telomerase activation, Eur. J. Cancer,

51, 969-976, https://doi.org/10.1016/j.ejca.2015.03.010.

42. Shanmugam, R., Ozturk, M. B., Low, J.-L., Akincilar,

S. C., Chua, J. Y. H., Thangavelu, M., Periyasamy, G.,

DasGupta,R., and Tergaonkar,V. (2022) Genome-wide

screens identify specific drivers of mutant hTERT pro-

moters, Proc. Natl. Acad. Sci. USA, 119, e2105171119,

https://doi.org/10.1073/pnas.2105171119.

43. Morgan, R. K., and Brooks, T. A. (2018) Targeting pro-

moter G-quadruplexes for transcriptional control, in

Small-molecule Transcription Factor Inhibitors in

Oncology (Rahman, K. M., and Thurston, D. E., eds)

The Royal Society of Chemistry, Chapt. 7, p. 169-193,

https://doi.org/10.1039/9781782624011-00169.

44. Onel, B., Carver, M., Wu, G., Timonina, D., Kalarn, S.,

Larriva,M., and Yang,D. (2016) Anew G-quadruplex

with hairpin loop immediately upstream of the human

BCL2 P1 promoter modulates transcription, J. Am.

Chem. Soc., 138, 2563-2570, https://doi.org/10.1021/

jacs.5b08596.

45. McLuckie, K. I. E., Waller, Z. A. E., Sanders, D. A.,

Alves, D., Rodriguez, R., Dash, J., McKenzie, G. J.,

Venkitaraman, A. R., and Balasubramanian, S.

(2011) G-quadruplex-binding benzo[a]phenoxazines

down-regulate c-kit expression in human gastric

carcinoma cells, J.Am. Chem. Soc., 133, 2658-2663,

https://doi.org/10.1021/ja109474c.

46. Kang, H.-J., Cui, Y., Yin, H., Scheid, A., Hendricks,

W.P.D., Schmidt,J., Sekulic,A., Kong,D., Trent, J.M.,

Gokhale,V., Mao,H., and Hurley, L.H. (2016) Aphar-

macological chaperone molecule induces cancer cell

death by restoring tertiary DNA structures in mutant

hTERT promoters, J.Am. Chem. Soc., 138, 13673-

13692, https://doi.org/10.1021/jacs.6b07598.

47. Pavlova, A. V., Dolinnaya, N. G., Zvereva, M. I.,

Kubareva, E. A., and Monakhova, M. V. (2023) New

DNA plasmid model for studying DNA mismatch re-

pair response to the G4 structure, Int.J. Mol. Sci., 24,

1061, https://doi.org/10.3390/ijms24021061.

48. Jana,J., and Weisz, K.A. (2020) Thermodynamic per-

spective on potential G-quadruplex structures as si-

lencer elements in the MYC promoter, Chemistry, 26,

17242-17251, https://doi.org/10.1002/chem.202002985.

49. Phan, A. T., Modi, Y. S., and Patel, D. J. (2004) Pro-

peller-type parallel-stranded G-quadruplexes in the

human c-myc promoter, J.Am. Chem. Soc., 126, 8710-

8716, https://doi.org/10.1021/ja048805k.

50. Santos,T., Lopes-Nunes,J., Alexandre,D., Miranda,A.,

Figueiredo, J., Silva, M. S., Mergny, J.-L., and Cruz, C.

(2022) Stabilization of a DNA aptamer by ligand

binding, Biochimie, 200, 8-18, https://doi.org/10.1016/

j.biochi.2022.05.002.

51. Laigre, E., Bonnet, H., Beauvineau, C., Lavergne, T.,

Verga, D., Defrancq,E., Dejeu,J., and Teulade-Fichou,

M.-P. (2024) Systematic evaluation of benchmark G4

probes and G4 clinical drugs using three biophysical

methods: a guideline to evaluate rapidly G4-bind-

ing affinity, Chembiochem, 25, e202400210, https://

doi.org/10.1002/cbic.202400210.

52. Guimaraes, A. F. R., and de Oliveira, D. M. (2017) Ef-

fect of long term treatment with BRACO 19 on HeLa

proliferation and senescence, Cancer Res., 77, 3476,

https://doi.org/10.1158/1538-7445.AM2017-3476.

Publisher’s Note. Pleiades Publishing remains

neutral with regard to jurisdictional claims in published

maps and institutional affiliations. AI tools may have

been used in the translation or editing of this article.