ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 11, pp. 1652-1666 © The Author(s) 2025. This article is an open access publication.
Russian Text © The Author(s), 2025, published in Biokhimiya, 2025, Vol. 90, No. 11, pp. 1765-1780.
1652
Reporter System for Detection of G-Quadruplexes
in the Human Telomerase Reverse Transcriptase
Gene Promoter Region
Iuliia V. Iakushkina
1
, Elena A. Kubareva
1
, Liudmila A. Nikiforova
2
,
Alexander M. Arutyunyan
1
, Maria I.Zvereva
2
, and Mayya V. Monakhova
1,a
*
1
Belozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University,
119992 Moscow, Russia
2
Faculty of Chemistry, Lomonosov Moscow State University, 119991 Moscow, Russia
a
e-mail: monakhovamv@gmail.com
Received June 15, 2025
Revised September 23, 2025
Accepted September 24, 2025
Abstract— In 80-100% of cases, transformation of human somatic cells into tumor cells is associated with
the increased expression of the catalytic subunit of telomerase reverse transcriptase (hTERT). The hTERT
gene transcription inhibition in tumor cells may become one of the approaches to antitumor therapy. The
hTERT promoter contains a G-rich region with length of 68 nucleotides, which is capable of forming G-qua-
druplexes (G4) under certain conditions in vitro. It is known that G4s interfere with activity of the human
RNA polymerases. Thus, the G4 structure stabilization in the promoter could be considered as a possible
strategy to reduce hTERT expression. To prove G4 formation in the hTERT promoter G-rich sequence in
the double-stranded supercoiling DNA, plasmid constructs based on the pRFPCER plasmid were obtained.
The plasmids contained genes of fluorescent proteins (RFP and Cerulean) and sequence of the central G4 in
the hTERT promoter region. G4 formation in the central hTERT promoter region in the obtained constructs
was demonstrated with the DNA polymerase stop assay. The influence of G228A and G250A substitutions on
G4 stability under physiological conditions was investigated. It was established that the low-molecular weight
ligands BRACO19 and TMPyP4, the well-studied stabilizers of the G4 structure, can effectively interact with
the hTERT promotor central G4 in the range of concentrations 5-25 μM.
DOI: 10.1134/S0006297925601753
Keywords: hTERT promoter, human telomerase reverse transcriptase, G-quadruplex, G4-stabilizing ligands,
“driver” mutations
* To whom correspondence should be addressed.
INTRODUCTION
Telomerase comprises a ribonucleoprotein com-
plex responsible for maintenance of the length of
telomers, and it is considered vitally important for
the cell. Human telomerase reverse transcriptase
(hTERT) is usually inactive in somatic cells (with
stem cells being an exception), and its overexpres-
sion is observed in 85-90% of malignant tumors [1].
Under normal conditions, hTERT gene expression is
controlled by the transcription factors SP1, c-Myc,
BRCA1/2. In the case of driver mutations G228A or
G250A (positions1295228 and 1295250 of the human
chromosome  5, respectively) additional binding sites
for the ETS (Erythroblast Transformation Specific) or
TCF (ternary complex factors) factors appear in the
hTERT gene promoter region, which results in the
hTERT expression increase [2, 3].
The hTERT promoter contains a GC-rich region
with a length of 68 nucleotides. Presence of 12 tracts
of three or more 2′-deoxyguanosine residues in the
G-rich strand creates prerequisite for three tandems
parallel G4 formation under certain in vitro condi-
tions [4-6] (Fig. 1). It is considered that G4 structures
formation in the promoter region prevents human
DNA- and RNA-polymerases binding, and, likely, plays
SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1653
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
an important role in the hTERT gene expression regu-
lation [4,5]. According to one of the hypotheses, G228A
or G250A substitutions appearance in the central G4
results in G4 structure destabilization, which makes
this sequence more accessible for binding to vari-
ous enzymes and transcription factors [2, 3]. Hence,
G4-structure stabilization in the promoter could be
considered as a possible way to reduce expression of
the hTERT gene and tumor growth.
To investigate formation of G4 under physiolog-
ical conditions plasmid constructs that contain a re-
porter gene (such as systems based on luciferase or
GFP) and a sequence potentially capable of forming
G4 are often used. Such constructs serve as conve-
nient tools in investigation of G4 structures and their
effects on gene expression, because they allow to ex-
amine structures of any topology and varying ther-
modynamic stability [7, 8]. Considering that G4-struc-
tures are of interest from the point of view of disease
therapy, these reporter constructs could also be used
as a tool for selecting most effective low-molecular
weight ligands that affect G4 stability under physio-
logical conditions.
A large number of G4 stabilizing ligands has
been suggested so far. One of the best-investigated
G4 ligands is BRACO19 (3,6,9-trisubstituted derivative
of acridine – N,N′-(9-(4-(dimethylamine)phenylamino)
acrydin-3,6-diyl)bis(3-(pyrrolidine-1-yl)propane amide)
hydrochloride), which exhibits high affinity to telo-
meric G4 and is able to suppressing telomerase tran-
scription [9]. TMPyP4 (5,10,15,20-tetrakis-(N-methyl-4-
pyridyl)porphin) is also often used as a G4-stabilizing
ligand capable of inhibiting telomerase activity [10].
However, the exact mechanism of its action is not
known yet. PhenDC3 (3,3′-[1,10-phenantroline-2,9-diyl-
bis(carbonylamino)]bis[1-methylquinoline] 1,1,1-triflu-
oromethane sulfonate) also can bind telomeric G-rich
repeats and it is widely used invivo for G4 detection
[11, 12].
The goal of this study was development of re-
porter constructs containing genes of two fluorescent
proteins (RFP and Cerulean) and a sequence of the
central G4 in the promoter region of the wild type
hTERT or of the gene with driver mutations; as well
as analysis of the effect of G4 on reporter protein
gene expression. In the course of the study, it was
necessary to design the reporter construct and con-
struct of the double strand sequences inserts required
by the type of analysis, to evaluate the possibility of
formation and thermodynamic stability of the inves-
tigated G4 using single-stand models, and to test the
G4 formation possibility in the plasmid DNAs using
polymerase stop assay. One other goal was investiga-
tion of the effects of G4-stabilizing ligands (BRACO19,
TMPyP4, PhenDC3) on reporter gene expression in
bacterial system in order to examine the possibility
of the produced constructs application in the primary
screening of G4-stabilizing compounds, which could
be promising in treatment of various human diseases.
MATERIALS AND METHODS
Oligonucleotides and plasmid DNAs. Oligonu-
cleotides and primers used in the study are present-
ed in Table 1. Oligonucleotides were produced using
a standard phosphoramidite technique and purified
with electrophoresis in polyacrylamide gel (Evrogen,
Russia). Prior to conducting experiments, oligonu-
cleotides were additionally precipitated in ethanol
Fig. 1. Structural organization of the G-rich promoter region of the hTERT gene. Location of driver mutations in the central
G4 at positions -124 and -146 from the start codon (ATG) (positions 1295228 and 1295250 of the human chromosome  5,
respectively) are marked. TSS, transcription start site.
IAKUSHKINA et al.1654
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Table 1. Oligonucleotides used in the study
Name Oligonucleotide sequence (5′→3′)
41-WT pGGATCCCGGGTCCCCGGCCCAGCCCCCTCCAGGAGATATCA
41-C228T
pGGATCCCGGGTCCCCGGCCCAGCCCCTTCCAGGAGATATCA
41-C250T
pGGATTCCGGGTCCCCGGCCCAGCCCCCTCCAGGAGATATCA
41-C228T/C250T
pGGATTCCGGGTCCCCGGCCCAGCCCCTTCCAGGAGATATCA
41-c-Myc pGGATCCTTCCCCACCCTCCCCACCCTCCCCAGGAGATATCA
45-WT pTATGATATCTCCTGGAGGGGGCTGGGCCGGGGACCCGGGATCCGC
45-G228A
pTATGATATCTCCTGGAAGGGGCTGGGCCGGGGACCCGGGATCCGC
45-G250A
pTATGATATCTCCTGGAGGGGGCTGGGCCGGGGACCCGGAATCCGC
45-G228A/G250A
pTATGATATCTCCTGGAAGGGGCTGGGCCGGGGACCCGGAATCCGC
45-c-Myc pTATGATATCTCCTGGGGAGGGTGGGGAGGGTGGGGAAGGATCCGC
Stop_assay_primer (TAMRA)-TGCAGGTCGACAAGCTTGG
Cer_fw TGAGCAAGGGCGAGGAGC
Cer_rev TGGTGCAGATGAACTTCAGG
RFP_fw GCTGATCAAGGAGAACATGC
RFP_rev AGGATGTCGAAGGCGAAGG
Note. G-rich sequences potentially capable of forming G4 are highlighted with semi-bold italic font. Positions with nucleotide
substitutions are marked with gray.
according to the standard technique [13]. Concentra-
tion was determined with a NanoDrop ND-1000 spec-
trophotometer (Thermo Fisher Scientific, USA). Molar
extinction coefficients for DNA oligonucleotides were
calculated with the help of on-line service OligoAna-
lyzerTM Tool (https://www.idtdna.com/calc/analyzer).
A pRFPCER plasmid with a size of 3796base pairs
(bp) was provided by I.  A.  Osterman (Faculty of Chem-
istry, Lomonosov Moscow State University). It has
been successfully used for analysis of low-molecular
antibacterial compounds action mechanisms [14-16].
In the initial pRFPCER ampicillin resistance gene was
replaced with the kanamycin resistance genes using
the standard protocol and a NEBuilder® HiFi DNA
Assembly kit (NEB, United Kingdom).
Determination of the formation possibility and
thermodynamic stability of G4 using circular di-
chroism (CD) method. Samples (1  ml) of oligonucle-
otides 45-WT, 45-G228A, 45-G250A, 45-G228A/G250A,
45-c-Myc with absorption 0.5-0.6 were incubated at
95°C for 15  min in an 8  mM potassium phosphate
buffer (5.7  mM  K
2
HPO
4
; 2.2  mM  KH
2
PO
4
; pH  7.1) con-
taining 100  mM  KCl followed by graduate cooling
for 16-18  h to room temperature. Circular dichroism
spectra were recorded in a quartz cuvette (Hellma
Analytics, Germany) with optical path length of 1  cm
in a temperature range from 20 to 85°C with 5°C-step
at average heating rate 1°C/min with a Chirascan
spectrophotometer (Applied Photophysics Ltd., Unit-
ed Kingdom). Spectra were recorded in the range
220-340  nm at scanning rate 30  nm/min and time of
signal averaging of 2  s under conditions of continous
flow of dry nitrogen. The obtained spectra were
smoothed with the Savitzky–Golay filter. Melting tem-
perature(T
m
) was defined as a temperature at which
50% of the sample was denatured. Errors in T
m
de-
termination were calculated based on the standard
deviations of the thermoregulator temperature [17].
Preparation of plasmid constructs containing
GC-rich inserts. A plasmid vector pRFPCER (200  ng)
was hydrolyzed in 50  µl of reaction medium including
5  µl of 10× buffer rCutSmart
TM
for restriction (New
England BioLabs, USA) and restriction endonuclease
(RE) SacII (10  units/µl, 5  µl) and RE NdeI (10 units/µl,
5  µl) (Thermo Fisher Scientific) for 3  h at 37°C. Re-
action product was purified in a 1% agarose gel and
isolated from the gel with phenol-chloroform ex-
traction [18].
SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1655
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
DNA duplex insert was formed from synthetic
5′-phosphorylated oligonucleotides with length 41 and
45 nucleotide residues (nt) (Table  1). For this purpose,
a mixture of 41- and 45-mer oligonucleotides with
concentration 0.4  µM in water was incubated for
10  min at 95°C followed by gradual cooling to room
temperature for 3  h. The otained DNA duplex had
sticky ends required for insertion into a linearized
vector. Next, 50  ng of a linearized vector and 100-fold
excess of DNA duplexes were ligated with T4 DNA-
ligase (5 units; Thermo Fisher Scientific) in a corre-
sponding buffer solution (Thermo Fisher Scientific)
and incubated for 1 h at 37°C. After ligation the mix-
ture (5µl) was used for transformation of Escherichia
coli XL1-Blue cells using heat-shock method [19].
Plasmid DNA was isolated from cell colonies with
a MiniPrep BC021S kit for DNA isolation (Evrogen).
Accuracy of the construct sequence was confirmed by
sequencing in the Center for Collective Use ‘Genom’
(Russia). E.  coli JW5503 cells were transformed with
the obtained plasmid constructs.
Analysis of G4 formation in the plasmid con-
structs using polymerase stop assay. A PCR-mix
(10  µl) was prepared for each construct containing
1  µl of 10× buffer for Taq-polymerase with 50  mM
KCl (Thermo Fisher Scientific), 0.2  µl of 10  mM solu-
tion of deoxynucleotide triphosphates, 4  mM MgCl
2
,
Taq-polymerase (0.1  µl; final activity – 0.5  units;
Thermo Fisher Scientific), 1  µl of 10  µM Stop_assay_
primer solution, and 50  ng of plasmid DNA solution.
KCl concentration was increased to 100  mM to facili-
tate G4 formation. PCR conditions: initial denaturation
3  min at 95°C followed by 35 cycles (denaturation 30  s
at 90°C, primer annealing 1  min at 53°C, extension
1  min at 72°C); final extension 5  min at 72°C. Reac-
tion products were separated using electrophoresis in
10% polyacrylamide gel with 7  M urea. A standard
1× TBE-buffer was used for electrophoresis. Visual-
ization of fluorescent regions was carried out with
a Typhoon FLA 9500 imager (GE Healthcare Bio-Sci-
ences AB, Japan).
Determination of the reporter gene transcrip-
tion efficiency in E.  coli JW5503 cells containing
plasmid constructs. Cellular RNA was isolated with
an ExtractRNA solution (Evrogen) according to the
manufacturer’s instructions. Concentration of obtained
RNAs was determined with a spectrophotometer.
An aliquot (1  µl) from each sample was treated
in 20  µl of a reaction mixture with addition of 2  µl
of 10× buffer for DNAse and 1  µl of DNAse  I (Thermo
Fisher Scientific) at 37°C for 10  min. Next, reverse
transcription reaction was carried out. Reaction mix-
ture (20µl) contained 8µl of 2.5× mixture for reverse
transcription (Sintol, Russia), 1  µl of random hexam-
er primer mix, 2  µl of 20  mM DTT, 1.5  µl of MMLV
revertase solution (Moloney murine leukemia virus
reverse transcriptase) (50  U/µl; Sintol), 0.5  µl of Ribo-
lock RNAse inhibitor (40  U/µl; Thermo Fisher Scientif-
ic), and 7  µl of solution of RNA treated with DNAse.
PCR mix (20  µl) contained 4  µl of 5× qPCRmix-HS
SYBR (Evrogen), 0.8  µl of 10  µM mixture of the prim-
ers to the gene encoding either Cerulean protein or
RFP (Cer_fw/Cer_rev or RFP_fw/RFP_rev, respectively),
13.2  µl of water, and 2  µl of cDNA. PCR conditions:
initial denaturation 5  min at 95°C followed by 40 cy-
cles (denaturation for 30  s at 95°C, primer annealing
for 30  s at 60°C, extension 30  s at 72°C). For each
ligand experiment was conducted in two biological
replicates, within one biological replicate four tech-
nical replicates were performed. PCR data processing
was carried out with Excel software package. Signifi-
cance of differences between the amount of mRNA in
the cells with genetic constructs was evaluated with
ANOVA [20].
Analysis of reporter proteins expression in
E.  coli JW5503 cells containing reporter constructs
depending on concentration of G4 stabilizing li-
gands. Overnight cultures of E.  coli JW5503 cells
containing reporter constructs pContr, pWT, pG228A,
pG250A, pG228A/G250A, or pc-Myc, were diluted to
optical density of ~0.01 at 600 nm. G4-Stabilizing li-
gands BRACO19, TMPyP4, PhenDC3 (Sigma-Aldrich,
USA) were dissolved in DMSO to concentrations 200,
400, 1000  µM and 5-µl aliquots were placed into wells
of 96-well plates (Medpolimer, Russia). Volume in each
well was adjusted to 200  µl with diluted cull culture.
Microplates with cells were incubated for 24  h at
37°C and shaking at 220  rpm. Next, plates with cells
were centrifuged at 4°C (4200 rpm; Eppendorf, Ger-
many), washed with 0.9%  NaCl solution followed by
measuring optical density at 600  nm and fluorescence
of proteins Cerulean (excitation/emission wavelengths
430/491nm) and RFP (545/595 nm) with a SynergyH1
plate reader (BioTek Instruments (Agilent), USA).
To evaluate relative fluorescence of the Cerulean pro-
tein, fluorescence intensity of Cerulean was divided
by the intensity of fluorescence of RFP. Fluorescence
of 0.9% NaCl solution was not taken into consider-
ation in calculations, because it was significantly low-
er than the standard deviation for the protein fluo-
rescence. For each ligand experiment was carried out
in two biological replicates, and within one biological
replicate four technical replicates were performed.
RESULTS
To confirm G4 formation in the hTERT gene pro-
moter region in supercoiled genomic DNA in the cells
and to determine effect of the G4 stability on the re-
porter protein gene expression, reporter systems were
developed containing fragment of the hTERT gene
IAKUSHKINA et al.1656
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Fig. 2. Schematic representation of the reporter construct used for G4 structures detection. The inserted fragment contained
the hTERT gene promoter region central G4 (underlined); positions 228 and 250 are highlighted with semi-bold font.
promoter region as an insert to the 5′-untranslated
region (UTR) of the reporter gene (Fig. 2). Advantage
of using prokaryotic systems in the case of the hTERT
gene promoter region is in the fact of exclusion of
the effects of the human transcription factors on the
protein synthesis.
The pRFPCER plasmid DNA containing genes of
two fluorescent proteins, RFP and Cerulean, was used
as a basis [14,15]. In this construct, RFP and Cerulean
transcription is under control of two identical, but
individual T5 promoters (Fig.2). Hence, one of the flu-
orescent proteins, RFP, plays a role of internal control,
and facilitates monitoring of the certain process by
eliminating effects of other intracellular factors; while
the second protein, Cerulean, facilitates monitoring of
G4 formation. The ratio of the Cerulian fluorescence
to RFP fluorescence served as an analytical signal.
Two issues were considered during design of the
reporter constructs. 1)  Considering that the G-rich
region of the hTERT-promoter usually forms a mul-
ticomponent G4 structure, it would be extremely
difficult to differentiate the effect of a single nucle-
otide substitution on the particular G4. 2)  Insertion
of the long G-rich region of the hTERT-promoter to
the plasmid DNA could change significantly the pro-
tein transcription level independent on G4 formation.
In addition, we attempted to minimize the length of
the insert, in order to eliminate any effects on mRNA
stability and transcription factors recognition sites
formation. Based on these considerations, it was de-
cided to use the 41/45-mer insert containing fragment
of the hTERT promoter region only with the central
G4 with native structure and with substitutions G228A
and G250A. Despite the fact that the double substitu-
tion G228A/G250A has not been observed in nature,
we also used oligonucleotide with both substitutions,
because we expected more significant destabilization
of the G4 structure in this case. The G4 sequence from
the c-Myc promoter that had been investigated in de-
tail both in  vitro and in  vivo [21, 22] was used as a
reference.
It is believed that location of the G4 structure
in the 5′-UTR of the gene decreases the transcrip-
tion level and, hence, the protein synthesis level [7].
We hypothesized that the synthesis of Cerulean pro-
tein would be dependent on stability of the G4 formed
in the G-rich insert comprising the hTERT-promoter
fragment. In other words, the more stable is G4 in
front of the Cerulean gene, the lower is the synthesis
of the protein and, correspondingly, the lower Ceru-
lean fluorescence signal is observed.
Before the production of reporter constructs, it
was necessary to confirm that G4 indeed could be
formed in the 45-mer oligonucleotides. The used
oligonucleotides comprised non-modified sequenc-
es, and contained substitutions at positions 228 and
250 (G>A). To solve this problem, we used circular
dichroism method.
Secondary structures that differ from the canoni-
cal B-form of DNA, such as G4 and hairpins, could be
formed also in the plasmids with negative supercoil-
ing [23, 24]. G4-structures are considered less stable
thermodynamically and more labile in comparison
with double helix. That is why it was important to
demonstrate that G4 indeed could be present in the
context of double helix in these plasmids. To confirm
G4 formation in the plasmid constructs, polymerase
stop assay was used.
SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1657
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Fig. 3. CD spectra of the 45-mer oligonucleotides. Curves: 1)45-c-Myc, 2)45-WT, 3)45-G250A, 4)45-G228A, 5)45-G228A/G250A.
In our plasmid constructs the G4 of the promot-
er region of the hTERT gene is located in the sense
strand, hence, effect of the G4 structure on transcrip-
tion of the reporter Cerulean gene could be expected.
Effect of G4 stability on the mRNA synthesis of the
Cerulean protein was demonstrated using reverse-
transcription quantitative PCR.
In order to evaluate the possibility of using
G4-stabilizing ligands for reducing efficiency of the
hTERT expression in the case of presence of driver
mutations, fluorescent properties of the cells with
produced reporter constructs in the presence of BRA-
CO19, TMPyP4, and PhenDC3 were investigated.
Design of the reporter constructs. Use of DNA
duplexes with length 41/45 bp containing the hTERT
gene promoter region central G4 sequences with
G228A, G250A substitutions and without them were
suggested as fragments of the 5′-UTR of the report-
er gene (Fig.  2). In addition to the hTERT gene pro-
moter region the DNA duplexes contained the Shine-
Dalgarno sequence, which is cut out from the DNA
of the pRFPCER plasmid by the REs SacII and NdeI.
The initial plasmid pRFPCER (pContr) was used in
the experiments as a control to evaluate effect of in-
troduction of the 41/45-mer insert on the process of
Cerulean protein synthesis.
Prior to reporter constructs production, it was
necessary to confirm that G4 could indeed be formed
in the 45-mer oligonucleotides. It was shown that
the hTERT gene promoter region central G4 could be
formed already in the 30-mer models [25]. Howev-
er, the oligonucleotides used in our study contained
flanking regions, which could affect negatively the
G4 stability.
Determination of G4 thermodynamic stability
in 45-mer single-strand models. To evaluate the pos-
sibility of G4 structure formation and effect of G228A
and G250A substitutions on the G4 stability with CD
spectroscopy, the 45-mer models of single-strand
DNAs containing sequence of the hTERT gene pro-
moter region central G4 were investigated (Table 1).
Theobtained CD spectra of 45-WT, 45-G228A, 45-G250A,
45-G228A/G250A, and 45-c-Myc have characteristic
maximum at 265nm and minimum at 245nm, which
indicate formation of a parallel G4 (Fig.3). In general,
the values of circular dichroism of the 45-c-Myc are
1.5-2.0-fold higher than for oligonucleotides of hTERT
promoter region G4.
Melting curves for the structures are presented in
Fig. 4a from which their T
m
were calculated (Fig.  4b).
As expected, the G4 structure of 45-WT exhibits high-
er T
m
, than the G4 formed from oligonucleotides with
G-A substitutions. Presence of one substitution, either
G228A or G250A, only insignificantly affects stability
of the G4 structure, T
m
differ by 1-2°C. At the same
time, T
m
of the G4 with two substitutions 45-G228A/
G250A differs from the T
m
of the 45-WT by 8°C, this
means that introduction of the second nucleotide
substitution results in additional destabilization of
G4. It was not possible to evaluate accurately T
m
of
the G4-structure formed from 45-c-Myc, since this
structure remained stable at 80°C. Hence, the 45-mer
G-rich oligonucleotides 45-WT, 45-G228A, 45-G250A,
45-G228A/G250A, 45-c-Myc form sufficiently stable G4
in the presence of 100 mM KCl under the used exper-
imental conditions at 37°C.
Analysis of G4 formation in plasmid con-
structs. To confirm formation of G4 in the plasmid
constructs the polymerase stop assay was used. The
method is based on the fact that G4 is an obstacle for
Taq- polymerase, which inhibits the DNA strand elon-
gation on the template during the enzymatic reaction.
As a result, a shorter product is formed, which could
be detected using electrophoresis in polyacrylamide
gel. In order to increase stability of G4 under condi-
tions of PCR, KCl was added to the reaction mixture
IAKUSHKINA et al.1658
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Fig. 4. Melting curves obtained using CD spectroscopy at 265 nm (a); T
m
of G4-structures formed from the used oligonu-
cleotides (b). Designations on the panel (a), curves: 1) 45-WT, 2) 45-G228A, 3) 45-G250A, 4) 45-G228A/G250A, 5) 45-c-Myc.
Fig. 5. Products of the DNA strand elongation by Taq-polymerase. pContr, pG228A/G250A, pWT, pG228A, pG250A, pc-Myc
were used as templates in the presence of KCl (lanes 3-8, respectively). Lanes 1 and 2) markers with length 76  nt and
60  +  41  nt, respectively.
SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1659
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Fig. 6. Ratio of fluorescence of the Cerulean/RFP proteins in the E.coli cells containing constructs obtained in this study(a);
transcription efficiency of the Cerulean gene in these constructs (b). To evaluate significance of differences between
the amounts of mRNA in the cells with different genetic constructs ANOVA (one-way analysis of variance) was used.
p-values are shown.
up to concentration 100 mM. A product with length
around 76 nt was expected to be formed. It can be
seen in Fig.5 that the ‘stop’ of Taq-polymerase occurs
in the plasmids pWT, pG228A, pG250A, and pc-Myc.
Evaluation of reporter gene expression in the
E.  coli cells with plasmid constructs containing se-
quence of the hTERT gene promoter region cen-
tral G4. Analysis of the reporter constructs with two
fluorescent proteins in the E.coli JW5503 cells demon-
strated significant difference in the fluorescence sig-
nal between the cells transformed with pContr, pWT,
pG228A, pG250A, pG228A/G250A, and pc-Myc (Fig.6a).
The pContr plasmid was used as a control for reporter
protein fluorescence, the pc-Myc construct was used
as a reporter gene repression efficiency control due
to formation of G4, because this construct contains in-
sert of the same length as the hTERT promoter region
G4, but it forms a more stable G4 in comparison with
the former (Fig. 4b). In can be seen in Fig. 6 that the
cells with pContr and pG228A/G250A exhibited higher
ratio between the fluorescent signals of Cerulean and
RFP, and the cells with pWT and pc-Myc exhibited the
lowest ratio. In the case of the cells with pWT plasmid
the 3.2-fold decrease of the relative fluorescent signal
of the Cerulean protein was observed in comparison
with the pContr and the 1.6-fold increase in compar-
ison with the pc-Myc. The decrease of the Cerulean
protein fluorescence in the case of the pG250A plas-
mid was comparable with the case of pWT. Regarding
of pG228A and pG228A/G250A the fluorescence sig-
nal of Cerulean protein differed from the instance of
pContr approximately by 1.7- and 1.4-fold, respectively.
Analysis of the effect of G4 on reporter gene
mRNA synthesis. Effect of the G4 stability on the
mRNA synthesis was demonstrated using reverse-tran-
scription quantitative PCR. It can be seen in Fig.  6b
that the amount of mRNA for each construct correlates
with the Cerulean/RFP relative fluorescence level. The
highest amount of mRNA was observed in the case
of the cells with the pContr construct, the amount of
mRNA in the cells with the pG228A/G250A construct
was almost 2-fold lower. In all other cases the amount
of mRNA was significantly lower: ~6-12-fold lower in
comparison with the mRNA from pContr and ~3-6-fold
lower in comparison with pG228A/G250A. The mRNA
levels in the cells with pWT, pG228A, pG250A, pc-Myc
differ not so much, but the differences are statistically
significant (significance level α  =  0.05).
Effect of low-molecular weight ligands stabi-
lizing G-quadruplexes on synthesis of reporter
protein. Fluorescent properties of the cells with the
obtained reporter constructs were investigated in the
presence of G4-stabilizing ligands. For this purpose,
the most popular and well-characterized G4-stabiliz-
ing ligands were used: BRACO19, TMPyP4, PhenDC3
[26-28]. The histograms presented in Fig.  7 show rel-
ative fluorescence signal of the Cerulean/RFP proteins
in the presence of different ligand concentrations nor-
malized to the signal observed without addition of
any ligand.
IAKUSHKINA et al.1660
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Fig. 7. Histograms of dependence of Cerulean/RFP relative fluorescence in the cells with different reporter constructs (a)
normalized to fluorescence of the cells without ligand present on the concentration of the BRACO19, TMPyP4, PhenDC3
ligands in the concentration range 0-25 µM. Number of measurements: n = 6, confidence level: P = 0.95. Accurate values
of the normalized relative fluorescence of the Cerulean/RFP proteins are shown (b).
SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1661
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Using of relatively low concentration of BRA-
CO19 (5 µM) results in significant (20%) decrease of
the Cerulean expression in the cases of pWT, pG228A,
pG250A, and pc-Myc. No significant differences be-
tween the signals were observed in the calls with
pContr and pG228A/G250A. Using BRACO19 at con-
centration 25  µM resulted in almost 2-fold decrease
of the Cerulean fluorescence in the cells with all used
constructs, except pContr and pG228A/G250A.
Addition of TMPyP4 did not decrease expres-
sion of the Cerulean protein in the case of pContr
and pG228A/G250A. In the instance of pWT and pc-
Myc constructs, addition of even 25  µM resulted only
in insignificant decrease of the signal. At the same
time, synthesis efficiency of the Cerulean protein in
the cells with the constructs pG228A and pG250A de-
creased significantly at concentration of 5  µM, and at
25  µM it decreased more than 2-fold.
Addition of PhenDC3 does not result in notice-
able changes of the fluorescence signal in the cells.
Decrease of the Cerulean protein synthesis by 20%
is observed in the cells with the pc-Myc construct at
concentrations 10-25  µM.
DISCUSSION
G-quadruplex (G4) is an element of secondary
structure in nucleic acids formed from the sequences
enriched with 2′-deoxyguanosine residues. G4s could
form structures of different topologies differing in
directions of the strands and length and composition
of the loops [29]. Numerous evidence reported in the
literature indicates a key role of G4s in important bio-
logical processes, in humans in particular [30]. G4-Mo-
tifs were found in human protooncogenes including
the best-known c-Myc [31], VEGF [32], c-kit [33], and
BCL2 [34].
Stabilization or destabilization of G4 structures
could affect functioning of the G4-binding transcrip-
tion factors, polymerases, and other enzymes, and, as
a consequence, affect efficiency of the gene transcrip-
tion [35]. Hence, development of therapeutic agents
facilitating formation or unfolding of the specific G4
structures could be a promising direction for devel-
opment of novel types of anti-tumor preparations.
At present, ligands have been identified that are ca-
pable of specific binding to the G4 structure of par-
ticular topology, however, the attempts to bind the G4
structure in the vicinity of a particular gene so far
failed. To improve selectivity of G4 ligands action, use
of their conjugates with oligodeoxyribonucleotides en-
suring binding of the ligand to the G4 structure only
at the genome sites capable of complementary inter-
actions with the guide DNA has been suggested [36].
Formation of G4 structure is potentially possible in
the hTERT gene promotor region. This region could
contain nucleotide substitutions found in tumor cells
(G228A and G250A) [37, 38].
To test the hypothesis that hTERT overexpression
could be due to G4 destabilization, we developed a
reporter system containing the fragment of the hTERT
gene promotor region that forms the central G4, as
the 5′-UTR reporter gene. The system was based on
the pRFPCER plasmid DNA containing genes of two
fluorescent proteins, RFP and Cerulean. The similar
constructs were successfully used for assessment of
the effect of the loop length in G4 located in the re-
porter proteins promoter regions on transcription and
translation in E.  coli [8]. Previously, the luciferase sys-
tem [39-41] and the system based on GFP [42] were
successfully used for evaluation of the effects of nu-
cleotide substitutions on the synthesis of the hTERT
protein. The luciferase system was also used for eval-
uation of the effect of G4-stabilizing ligands on tran-
scription of c-Myc[43], BCL-2[44], c-kit[45], and telo-
merase activity [46]. However, it should be noted that
luciferase system demonstrates indirect response via
oxidation of luciferin. The pRFPCER reporter system
suggested in this study does not have this drawback:
it provides direct response of the fluorescent proteins,
which makes this system faster and easier to use.
To evaluate the possibility of formation of G4
structures and effect of G228A and G250A substitu-
tions on G4 stability, CD spectroscopy was used. The
obtained CD spectra for the 45-WT indicated formation
of the parallel G4 (Fig.  3). It was shown that the G-rich
45-mer oligonucleotides (Table  1) 45-WT, 45-G228A,
45-G250A, 45-G228A/G250A, and 45-c-Myc form rela-
tively stable G4 in the presence of 100  mM  KCl under
common experimental conditions (at 37°C).
The melting curves obtained with CD spectrosco-
py with detection at 265  nm demonstrated that the G4
structure formed from 45-WT has a higher T
m
than
the G4 structures formed from the sequences with
single substitutions, and introduction of the second
substitution resulted in the further destabilization of
the G4 structure. It was important to show that G4s
indeed could be present in the double helix context in
the obtained plasmids. To confirm the G4 formation
in the plasmid structure, the polymerase stop assay
was used. The polymerase ‘stop’ in the pc-Myc plas-
mid was found to be more significant in comparison
with the plasmids containing sequence of the hTERT
gene promotor region central G4 (Fig.  5). Such a sig-
nificant ‘stop’ was expected for the pc-Myc based on
the ‘melting’ data in the single-strand model.
Two ‘stops’ occur on the pWT and pG228A plas-
mid DNA: one before the G4 structure providing the
76-nt product and on the loop, providing the longer
products. Interestingly, in the plasmid with G250A
substitution there is a third ‘stop’ of Taq-polymerase.
IAKUSHKINA et al.1662
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Testing of the 96-mer single-stranded oligonucleotides
containing all three G4s of the hTERT promoter re-
gion using dimethyl sulfate probing method in our
research group revealed that the G250A substitution
causes destabilization not only in this G-tract, but also
in the next one [47]. The same, likely, occurs in the
plasmid. The double substitution G228A/G250A in the
case of G4 from the hTERT gene promoter results in
complete destruction of G4. As one could expect, no
polymerase ‘stop’ was observed in the pG228A/G250A
construct, same as in the case of pContr. Hence, the
central G4 of the hTERT gene promoter region can be
formed in the plasmid construct in the double helix
context and under conditions of supercoiling. Despite
the fact that the extension temperature in PCR (72°C)
is higher than T
m
of the structures in the single-strand
models 45-WT, 45-G228A, 45-G250A (Fig.  4b), super-
coiling of the plasmid DNA makes existence of G4 in
the plasmid DNA possible.
Two bands in the gel were also observed in the
case of pc-Myc. Considering that G4 from the c-Myc
promoter contains 5 G-tetrads, it potentially could
form structures with different topology [22,  48].
Hence, it could be hypothesized that emergence of the
band with weaker intensity is associated with forma-
tion of the structure, in which the first G-tetrad does
not participate [49].
Analysis of relative Cerulean/RFP fluorescence of
the E. coli cells transformed with the constructs ob-
tained in this study demonstrated that the change in
fluorescence correlates with the ability of inserted se-
quences to form G4: the more stable is G4, the lower
is the Cerulean fluorescence. Relative increase of the
Cerulean/RFP fluorescence signal could be explained
by the destruction (or absence) of the G4 structure
in the cell, which interferes with the process of Ce-
rulean gene transcription. Indeed, the highest rela-
tive fluorescence is observed for the cells containing
constructs pContr and pG228A/G250A, and the low-
est – for the cells with pWT and pc-Myc (Fig.  6a).
It is known that introduction of G228A and G250A
substitutions locally disrupt the G4 structure [47]
and, consequently, should increase efficiency of the
Cerulean protein synthesis in comparison with the
wild type hTERT gene. It was found that the G228A
substitution destabilizes G4 to a larger degree than
the G250A substitution; and the double substitution
significantly disrupts the G4 structure. As expected,
the double substitution destabilizes the G4 structure
more significantly than the single substitutions. Cer-
tain decrease of the relative fluorescence of the cells
containing the pG228A/G250A construct in comparison
with the pContr could be explained by both presence
of a longer sequence before the Cerulean gene, and by
partial formation of G4 at 37°C. Although destruction
of this structure was shown under conditions of PCR,
one should take into account that PCR occurs at high
temperatures (extension at 72°C), which facilitates
destruction of the hTERT gene promoter region G4
containing two substitutions, while effect of the steric
factor associated with supercoiling seems to be insuf-
ficient to maintain the structure.
The method of reverse transcription quantitative
PCR was used to demonstrate the effect of G4 stability
on synthesis of the Cerulean protein mRNA. It was
found out that the amount of mRNA for each con-
struct correlates with the level of relative Cerulean/
RFP fluorescence. The lowest amount of the Cerule-
an mRNA was synthesized in the cells with pWT and
pc-Myc, which increased in the cells with pG250A and
pG228A. Hence, the effect of G4 stability is observed
at the level of transcription, which is manifested by
the amount of mRNA of the Cerulean reporter gene.
With the goal to evaluate the possibility of using
G4-stabilizing ligands for decreasing hTERT expression
efficiency in the case of appearance of driver muta-
tions, fluorescent properties of the cells containing
the obtained reporter constructs were investigated in
the presence of BRACO19, TMPyP4, PhenDC3 (Fig.  7).
The selected ligands differ in efficiency of binding
to G4. Dissociation constant values obtained using
fluoresence titration method [50] and surface plas-
mon resonance technique [51] for the complexes
with parallel G4s are in the range for BRACO19:
6  ×  10
−8
–7  ×  10
−7
  M, for TMPyP4: 2  ×  10
−7
–2  ×  10
−6
 M,
for PhenDC3: 2  ×  10
−11
–2  ×  10
−6
  M. According to these
data PhenDC3 exhibits the most pronounced ability
to bind G4 in comparison with BRACO19 and TMPyP4,
however, it causes only minor stabilization of the G4
from pc-Myc, the most stable among the G4s investi-
gated in this study.
Based on our results, from the point of view
of stabilization of the hTERT gene promoter region
central G4, the best ligand is BRACO19 (decrease of
expression of the Cerulean protein in the case of
pWT, pG228A, pG250A, and pc-Myc by 20% at 5  µM
concentration of BRACO19), because it is capable to
produce a significant decrease of the Cerulean protein
synthesis even in the cells containing constructs with
stable G4 (pWT and pc-Myc). However, this compound
is rather toxic, which limits its application [52].
In our experiments addition of TMPyP4 did not
cause death of the E.  coli cells containing reporter
constructs at the ligand concentrations up to 80  µM
(data not shown). Hence, unlike the BRACO19, TMPyP4
is not toxic for the cells, but its addition causes only
the minor difference in the level of the Cerulean pro-
tein synthesis in the cells with the constructs contain-
ing stable G4 (~20% for the pWT and pc-Myc at 25  µM
of TMPyP4). TMPyP4 preferably binds to the destabi-
lized G4-structures, because the decrease in the Ce-
rulean fluorescence in the cells containing constructs
SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1663
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
pG228A and pG250A is much more pronounced. This
observation is of fundamental importance, and sets
the stage for the development of G4 ligands distin-
guishing stable and unstable structures.
Hence, the reporter system developed in this
study could be used for evaluating stability of G4,
including on addition of low-molecular ligands of
various structures.
CONCLUSIONS
Reporter constructs were generated in this study
that contain genes of two fluorescent proteins, RFP
and Cerulean, and fragment of the sequence of the
hTERT gene promotor region containing sequence of
the central G4 of either the wild type or with driver
mutations. Effect of the driver substitutions G228A
and G250A on stability of G4 was investigated invitro
and under physiological conditions. It was shown that
the 45-mer G-rich oligonucleotides 45-WT, 45-G228A,
45-G250A, 45-G228A/G250A, 45-c-Myc form relatively
stable G4 in  vitro. The most stable G4 were shown to
exist in the context of double helix in the obtained
plasmids and even under conditions of PCR (primer
extension was carried out at 72°C). Effect of G4 stabili-
ty on synthesis of mRNA of the Cerulean reporter gene
was demonstrated. It was shown that the synthesis of
mRNA of the Cerulean gene in the cells with stable G4
in the genetic construct is reduced. It was found that
the amount of mRNA for each construct correlated
with the level of relative Cerulean/RFP fluorescence.
It was established that the level of relative Ce-
rulean/RFP fluorescence in the cells decreases with
increase of stability of G4 in the insert. It was shown
that the low-molecular weight ligands, BRACO19 and
TMPyP4, are capable of stabilizing the central G4 from
the hTERT gene promoter region in the concentration
range 5-25  µM. This is manifested by the decrease
of the relative Cerulean/RFP fluorescence. Among
the considered G4-stabilizing ligands, the highest at-
tention from the point of view of drug development
should be paid to TMPyP4 due to its higher specific-
ity towards destabilized quadruplex structure. Hence,
the reporter system suggested in this study could be
used for evaluation of G4 stability, including in the
cases with addition of G4-ligands of various structures
and primary screening of stabilizers in the bacterial
system.
Abbreviations
CD circular dichroism
BRACO19 N,N′-(9-(4-(dimethylamine)phenylamino)
acrydin-3,6-diyl)bis(3-(pyrrolidine-1-yl)
propane amide) hydrochloride
G4 G-quadruplex
hTERT human telomerase reverse transcrip-
tase
PhenDC3 3,3′-[1,10- phenanthroline-2,9-
diylbis(carbonylamino)]bis[1-methyl-
quinoline] 1,1,1-trifluoromethane
sulfonate
RE restriction endonuclease
T
m
melting temperature
TMPyP4 5,10,15,20-tetrakis-(N-methyl-4-pyridyl)
porphin
Acknowledgments
The authors of this work express their gratitude to
the Russian Science Foundations for supporting the
preliminary experiments (project no. 21-14-00161).
The authors are grateful to the leading scientist
N. G. Dolinnaya (Faculty of Chemistry, Lomonosov
Moscow State University) for valuable critical com-
ments and recommendations.
Contributions
E. A. Kubareva and M. E. Zvereva – concept and super-
vision of the study; Yu. V. Iakushkina, M. V. Monakho-
va, and A. M. Arutyunyan – conducting experiments;
Yu. V. Iakushkina, M. V. Monakhova, E. A. Kubareva,
M. E. Zvereva, and L. A. Nikiforova – discussion of the
results of the study; Yu. V. Iakushkina and L. A. Niki-
forova – writing of the manuscript; M. V. Monakhova
and E. A. Kubareva – editing text of the paper.
Funding
This work was financially supported by the Russian
Science Foundation (grant no.25-24-00161).
Ethics approval and consent to participate
This work does not contain any studies involving hu-
man and animal subjects.
Conflict of interest
The authors of this work declare that they have
noconflicts of interest.
Open access
This article is licensed under a Creative Commons
Attribution 4.0 International License, which permits
use, sharing, adaptation, distribution, and reproduc-
tion in any medium or format, as long as you give
appropriate credit to the original author(s) and the
source, provide a link to the Creative Commons li-
cense, and indicate if changes were made. The images
or other third party material in this article are includ-
ed in the article’s Creative Commons license, unless
indicated otherwise in a credit line to the material.
If material is not included in the article’s Creative
Commons license and your intended use is not permit-
ted by statutory regulation or exceeds the permitted
IAKUSHKINA et al.1664
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
use, you will need to obtain permission directly from
the copyright holder. To view a copy of this license,
visit http://creativecommons.org/licenses/by/4.0/.
REFERENCES
1. Cong, Y.S., Wen,J., and Bacchetti,S. (1999) Thehuman
telomerase catalytic subunit hTERT: organization of the
gene and characterization of the promoter, Hum. Mol.
Genet., 8, 137-142, https://doi.org/10.1093/hmg/8.1.137.
2. Xu,D., Dwyer,J., Li,H., Duan,W., and Liu, J.-P. (2008)
Ets2 maintains hTERT gene expression and breast
cancer cell proliferation by interacting with c-Myc,
J.Biol. Chem., 283, 23567-23580, https://doi.org/10.1074/
jbc.M800790200.
3. Li,H., Lee, T.-H., and Avraham,H. (2002) A novel tri-
complex of BRCA1, Nmi, and c-Myc inhibits c-Myc-in-
duced human telomerase reverse transcriptase gene
(hTERT) promoter activity in breast cancer, J. Biol.
Chem., 277, 20965-20973, https://doi.org/10.1074/
jbc.M112231200.
4. Monsen, R. C., DeLeeuw, L., Dean, W. L., Gray, R. D.,
Sabo, T.M., Chakravarthy,S., Chaires, J.B., and Trent,
J. O. (2020) The hTERT core promoter forms three
parallel G-quadruplexes, Nucleic Acids Res., 48, 5720-
5734, https://doi.org/10.1093/nar/gkaa107.
5. Bochman, M.L., Paeschke,K., and Zakian, V.A. (2012)
DNA secondary structures: stability and function of
G-quadruplex structures, Nat. Rev. Genet., 13, 770-780,
https://doi.org/10.1038/nrg3296.
6. Verma, A., Yadav, V. K., Basundra, R., Kumar, A.,
and Chowdhury, S. (2009) Evidence of genome-wide
G4 DNA-mediated gene expression in human can-
cer cells, Nucleic Acids Res., 37, 4194-4204, https://
doi.org/10.1093/nar/gkn1076.
7. Holder, I. T., and Hartig, J. S. (2014) A matter of loca-
tion: influence of G-quadruplexes on Escherichia coli
gene expression, Chem. Biol., 21, 1511-1521, https://
doi.org/10.1016/j.chembiol.2014.09.014.
8. Lee, C.-Y., Joshi, M., Wang, A., and Myong, S. (2024)
5′UTR G-quadruplex structure enhances translation
in size dependent manner, Nat. Commun., 15, 3963,
https://doi.org/10.1038/s41467-024-48247-8.
9. Burger, A. M., Dai, F., Schultes, C. M., Reszka, A. P.,
Moore, M. J., Double, J. A., and Neidle, S. (2005)
The G-quadruplex-interactive molecule BRACO-19
inhibits tumor growth, consistent with telomere tar-
geting and interference with telomerase function,
Cancer Res., 65, 1489-1496, https://doi.org/10.1158/
0008-5472.CAN-04-2910.
10. Han, F. X., Wheelhouse, R. T., and Hurley, L. (1999)
Interactions of TMPyP4 and TMPyP2 with quadru-
plex DNA. Structural basis for the differential effects
on telomerase inhibition, J.Am. Chem. Soc., 121,
3561-3570, https://doi.org/10.1021/ja984153m.
11. Piazza, A., Boulé, J. B., Lopes, J., Mingo, K., Largy, E.,
Teulade-Fichou, M.-P., and Nicolas, A. (2010) Genet-
ic instability triggered by G-quadruplex interacting
Phen-DC compounds in Saccharomyces cerevisiae, Nu-
cleic Acids Res., 38, 4337-4348, https://doi.org/10.1093/
nar/gkq136.
12. Obi, I., Rentoft, M., Singh, V., Jamroskovic, J.,
Chand,K., Chorell,E., Westerlund,F., and Sabouri,N.
(2020) Stabilization of G-quadruplex DNA structures
in Schizosaccharomyces pombe causes single-strand
DNA lesions and impedes DNA replication, Nucleic
Acids Res., 48, 10998-11015, https://doi.org/10.1093/
nar/gkaa820.
13. Green, M. R., and Sambrook, J. (2016) Precipitation
of DNA with ethanol, Cold Spring Harb. Protoc., 12,
https://doi.org/10.1101/pdb.prot093377.
14. Osterman, I. A., Prokhorova, I. V., Sysoev, V. O.,
Boykova, Y.V., Efremenkova, O.V., Svetlov, M.S., Kolb,
V. A., Bogdanov, A. A., Sergiev, P. V., and Dontsova,
O. A. (2012) Attenuation-based dual-fluorescent-
protein reporter for screening translation inhibitors,
Antimicrob. Agents Chemother., 56, 1774-1783, https://
doi.org/10.1128/AAC.05395-11.
15. Osterman, I. A., Evfratov, S. A., Sergiev, P. V., and
Dontsova, O.A. (2013) Comparison of mRNA features
affecting translation initiation and reinitiation, Nu-
cleic Acids Res., 41, 474-486, https://doi.org/10.1093/
nar/gks989.
16. Polikanov, Y. S., Osterman, I. A., Szal, T., Tashlitsky,
V. N., Serebryakova, M. V., Kusochek, P., Bulkley, D.,
Malanicheva, I.A., Efimenko, T.A., Efremenkova, O.V.,
Konevega, A.L., Shaw, K.J., Bogdanov, A.A., Rodnina,
M.V., Dontsova, O.A., Mankin, A.S., Steitz, T.A., and
Sergiev, P. V. (2014) Amicoumacin a inhibits transla-
tion by stabilizing mRNA interaction with the ribo-
some, Mol. Cell., 56, 531-540, https://doi.org/10.1016/
j.molcel.2014.09.020.
17. Vorlíčková, M., Kejnovská, I., Sagi, J., Renčiuk, D.,
Bednářová, K., Motlová, J., and Kypr, J. (2012) Circu-
lar dichroism and guanine quadruplexes, Methods,
57, 64-75, https://doi.org/10.1016/j.ymeth.2012.03.011.
18. Sambrook,J., and Russell, D.W. (2006) Purification of
nucleic acids by extraction with phenol:chloroform,
Cold Spring Harb. Protoc., 1, https://doi.org/10.1101/
pdb.prot4455.
19. Froger, A., and Hall, J. E. (2007) Transformation of
plasmid DNA into E.coli using the heat shock meth-
od, J.Vis. Exp., 6, 253, https://doi.org/10.3791/253.
20. Mishra, P., Singh, U., Pandey, C. M., Mishra, P., and
Pandey,G. (2019) Application of student’s t-test, analy-
sis of variance, and covariance, Ann. Card. Anaesth.,
22, 407-411, https://doi.org/10.4103/aca.ACA_94_19.
21. Yang,D., and Hurley, L.H. (2006) Structure of the bio-
logically relevant G-quadruplex in the c-Myc promot-
er, Nucleosides Nucleotides Nucleic Acids, 25, 951-968,
https://doi.org/10.1080/15257770600809913.
SYSTEM FOR DETECTION OF G-QUADRUPLEX STRUCTURES 1665
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
22. Siddiqui-Jain,A., Grand, C.L., Bearss, D.J., and Hurley,
L. H. (2002) Direct evidence for a G-quadruplex in a
promoter region and its targeting with a small mole-
cule to repress c-Myc transcription, Proc. Natl. Acad.
Sci. USA, 99, 11593-11598, https://doi.org/10.1073/
pnas.182256799.
23. Kouzine,F., Sanford,S., Elisha-Feil,Z., and Levens,D.
(2008) The functional response of upstream DNA to
dynamic supercoiling invivo, Nat. Struct. Mol. Biol.,
15, 146-154, https://doi.org/10.1038/nsmb.1372.
24. Sekibo, D. A. T., and Fox, K. R. (2017) The effects of
DNA supercoiling on G-quadruplex formation, Nucle-
ic Acids Res., 45, 12069-12079, https://doi.org/10.1093/
nar/gkx856.
25. Savitskaya, V. Y., Novoselov, K. A., Dolinnaya, N. G.,
Monakhova, M. V., Snyga, V. G., Diatlova, E. A.,
Peskovatskova, E. S., Golyshev, V. M., Kitaeva, M. I.,
Eroshenko, D. A., Zvereva, M. I., Zharkov, D. O., and
Kubareva, E. A. (2025) Position-dependent effects of
AP sites within an hTERT promoter G-quadruplex
scaffold on quadruplex stability and repair activity
of the APE1 enzyme, Int.J. Mol. Sci., 26, 337, https://
doi.org/10.3390/ijms26010337.
26. Campbell, N. H., Parkinson, G. N., Reszka, A. P., and
Neidle, S. (2008) Structural basis of DNA quadruplex
recognition by an acridine drug, J.Am. Chem. Soc.,
130, 6722-6724, https://doi.org/10.1021/ja8016973.
27. Wheelhouse, R. T., Sun, D., and Hurley, L. H. (1998)
Cationic porphyrins as telomerase inhibitors: the in-
teraction of tetra-(N-methyl-4-pyridyl)porphine with
quadruplex DNA, J.Am. Chem. Soc., 120, 3261-3262,
https://doi.org/10.1021/ja973792e.
28. De Cian,A., Delemos,E., Mergny, J.-L., Teulade-Fichou,
M.-P., and Monchaud, D. (2007) Highly efficient
G-quadruplex recognition by bisquinolinium com-
pounds, J.Am. Chem. Soc., 129, 1856-1857, https://
doi.org/10.1021/ja067352b.
29. Parkinson, G. N., and Collie, G. W. (2019) X-Ray crys-
tallographic studies of G-quadruplex structures, Meth-
ods Mol. Biol., 2035, 131-155, https://doi.org/10.1007/
978-1-4939-9666-7_8.
30. Dolinnaya, N.G., Ogloblina, A.M., and Yakubovskaya,
M. G. (2016) Structure, properties, and biological rel-
evance of the DNA and RNA G-quadruplexes: over-
view 50 years after their discovery, Biochemistry
(Moscow), 81, 1602-1649, https://doi.org/10.1134/
S0006297916130034.
31. Simonsson,T., Pecinka,P., and Kubista,M. (1998) DNA
tetraplex formation in the control region of c-myc,
Nucleic Acids Res., 26, 1167-1172, https://doi.org/
10.1093/nar/26.5.1167.
32. Sun,D., Guo,K., Rusche, J.J., and Hurley, L.H. (2005)
Facilitation of a structural transition in the polypu-
rine/polypyrimidine tract within the proximal pro-
moter region of the human VEGF gene by the presence
of potassium and G-quadruplex-interactive agents,
Nucleic Acids Res., 33, 6070-6080, https://doi.org/
10.1093/nar/gki917.
33. Rankin, S., Reszka, A. P., Huppert, J., Zloh, M.,
Parkinson, G. N., Todd, A. K., Ladame, S., Balasu-
bramanian, S., and Neidle, S. (2005) Putative DNA
quadruplex formation within the human c-kit on-
cogene, J.Am. Chem. Soc., 127, 10584-10589, https://
doi.org/10.1021/ja050823u.
34. Dai, J., Dexheimer, T. S., Chen, D., Carver, M.,
Ambrus,A., Jones, R.A., and Yang,D. (2006) Anintra-
molecular G-quadruplex structure with mixed paral-
lel/antiparallel G-strands formed in the human BCL-2
promoter region in solution, J.Am. Chem. Soc., 128,
1096-1098, https://doi.org/10.1021/ja055636a.
35. Eddy, J., and Maizels, N. (2006) Gene function cor-
relates with potential for G4 DNA formation in the
human genome, Nucleic Acids Res., 34, 3887-3896,
https://doi.org/10.1093/nar/gkl529.
36. Berner, A., Das, R. N., Bhuma, N., Golebiewska, J.,
Abrahamsson, A., Andréasson, M., Chaudhari, N.,
Doimo, M., Bose, P. P., Chand, K., Strömberg, R.,
Wanrooij, S., and Chorell, E. (2024) G4-ligand-conju-
gated oligonucleotides mediate selective binding and
stabilization of individual G4 DNA structures, J. Am.
Chem. Soc., 146, 6926-6935, https://doi.org/10.1021/
jacs.3c14408.
37. De Cian,A., Lacroix,L., Douarre,C., Temime- Smaali,N.,
Trentesaux,C., Riou, J.F., and Mergny, J.L. (2008) Tar-
geting telomeres and telomerase, Biochimie, 90, 131-
155, https://doi.org/10.1016/j.biochi.2007.07.011.
38. Asamitsu, S., Obata, S., Yu, Z., Bando, T., and
Sugiyama, H. (2019) Recent progress of targeted
G-quadruplex-preferred ligands toward cancer ther-
apy, Molecules, 24, 429, https://doi.org/10.3390/mole-
cules24030429.
39. Panebianco, F., Nikitski, A. V., Nikiforova, M. N.,
and Nikiforov, Y. E. (2019) Spectrum of TERT pro-
moter m utations and mechanisms of activation in
thyroid cancer, Cancer Med., 8, 5831-5839, https://
doi.org/10.1002/cam4.2467.
40. Vinagre, J., Nabais, J., Pinheiro, J., Batista, R.,
Oliveira, R. C., Gonçalves, A. P., Pestana, A., Reis, M.,
Mesquita, B., Pinto, V., Lyra, J., Cipriano, M. A.,
Ferreira, M.G., Lopes, J.M., Sobrinho-Simões,M., and
Soares,P. (2016) TERT promoter mutations in pancre-
atic endocrine tumours are rare and mainly found
in tumours from patients with hereditary syndromes,
Sci. Rep., 6, 29714, https://doi.org/10.1038/srep29714.
41. Huang, D.-S., Wang,Z., He, X.-J., Diplas, B.H., Yang,R.,
Killela, P. J., Meng, Q., Ye, Z.-Y., Wang, W., Jiang, X.-T.,
Xu,L., He, X.-L., Zhao, Z.-S., Xu, W.-J., Wang, H.-J., Ma,
Y.-Y., Xia, Y.-J., Li, L., Zhang, R.-X., Jin, T., Zhao, Z.-K.,
Xu,J., Yu,S., Wu,F., Liang,J., Wang,S., Jiao,Y., Yan,H.,
and Tao, H.-Q. (2015) Recurrent TERT promoter mu-
tations identified in a large-scale study of multiple
tumour types are associated with increased TERT
IAKUSHKINA et al.1666
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
expression and telomerase activation, Eur. J. Cancer,
51, 969-976, https://doi.org/10.1016/j.ejca.2015.03.010.
42. Shanmugam, R., Ozturk, M. B., Low, J.-L., Akincilar,
S. C., Chua, J. Y. H., Thangavelu, M., Periyasamy, G.,
DasGupta,R., and Tergaonkar,V. (2022) Genome-wide
screens identify specific drivers of mutant hTERT pro-
moters, Proc. Natl. Acad. Sci. USA, 119, e2105171119,
https://doi.org/10.1073/pnas.2105171119.
43. Morgan, R. K., and Brooks, T. A. (2018) Targeting pro-
moter G-quadruplexes for transcriptional control, in
Small-molecule Transcription Factor Inhibitors in
Oncology (Rahman, K. M., and Thurston, D. E., eds)
The Royal Society of Chemistry, Chapt. 7, p. 169-193,
https://doi.org/10.1039/9781782624011-00169.
44. Onel, B., Carver, M., Wu, G., Timonina, D., Kalarn, S.,
Larriva,M., and Yang,D. (2016) Anew G-quadruplex
with hairpin loop immediately upstream of the human
BCL2 P1 promoter modulates transcription, J. Am.
Chem. Soc., 138, 2563-2570, https://doi.org/10.1021/
jacs.5b08596.
45. McLuckie, K. I. E., Waller, Z. A. E., Sanders, D. A.,
Alves, D., Rodriguez, R., Dash, J., McKenzie, G. J.,
Venkitaraman, A. R., and Balasubramanian, S.
(2011) G-quadruplex-binding benzo[a]phenoxazines
down-regulate c-kit expression in human gastric
carcinoma cells, J.Am. Chem. Soc., 133, 2658-2663,
https://doi.org/10.1021/ja109474c.
46. Kang, H.-J., Cui, Y., Yin, H., Scheid, A., Hendricks,
W.P.D., Schmidt,J., Sekulic,A., Kong,D., Trent, J.M.,
Gokhale,V., Mao,H., and Hurley, L.H. (2016) Aphar-
macological chaperone molecule induces cancer cell
death by restoring tertiary DNA structures in mutant
hTERT promoters, J.Am. Chem. Soc., 138, 13673-
13692, https://doi.org/10.1021/jacs.6b07598.
47. Pavlova, A. V., Dolinnaya, N. G., Zvereva, M. I.,
Kubareva, E. A., and Monakhova, M. V. (2023) New
DNA plasmid model for studying DNA mismatch re-
pair response to the G4 structure, Int.J. Mol. Sci., 24,
1061, https://doi.org/10.3390/ijms24021061.
48. Jana,J., and Weisz, K.A. (2020) Thermodynamic per-
spective on potential G-quadruplex structures as si-
lencer elements in the MYC promoter, Chemistry, 26,
17242-17251, https://doi.org/10.1002/chem.202002985.
49. Phan, A. T., Modi, Y. S., and Patel, D. J. (2004) Pro-
peller-type parallel-stranded G-quadruplexes in the
human c-myc promoter, J.Am. Chem. Soc., 126, 8710-
8716, https://doi.org/10.1021/ja048805k.
50. Santos,T., Lopes-Nunes,J., Alexandre,D., Miranda,A.,
Figueiredo, J., Silva, M. S., Mergny, J.-L., and Cruz, C.
(2022) Stabilization of a DNA aptamer by ligand
binding, Biochimie, 200, 8-18, https://doi.org/10.1016/
j.biochi.2022.05.002.
51. Laigre, E., Bonnet, H., Beauvineau, C., Lavergne, T.,
Verga, D., Defrancq,E., Dejeu,J., and Teulade-Fichou,
M.-P. (2024) Systematic evaluation of benchmark G4
probes and G4 clinical drugs using three biophysical
methods: a guideline to evaluate rapidly G4-bind-
ing affinity, Chembiochem, 25, e202400210, https://
doi.org/10.1002/cbic.202400210.
52. Guimaraes, A. F. R., and de Oliveira, D. M. (2017) Ef-
fect of long term treatment with BRACO 19 on HeLa
proliferation and senescence, Cancer Res., 77, 3476,
https://doi.org/10.1158/1538-7445.AM2017-3476.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in published
maps and institutional affiliations. AI tools may have
been used in the translation or editing of this article.