Article

ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 11, pp. 1643-1651 © The Author(s) 2025. This article is an open access publication.

Russian Text © The Author(s), 2025, published in Biokhimiya, 2025, Vol. 90, No. 11, pp. 1754-1764.

1643

Cellular Proteins Hsp60 and SAHH as Negative

Regulators of the Early Stages of HIV-1 Replication

Stepan E. Feigin

, Tatiana F. Kikhai

2,3

, Yulia Yu. Agapkina

2,3

Andrei N. Anisenko

1,2,3

, Marina B. Gottikh

2,3

, and Sergey P. Korolev

1,2,3,a

Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University,

119234 Moscow, Russia

Belozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University,

119992 Moscow, Russia

Chemistry Department, Lomonosov Moscow State University, 119991 Moscow, Russia

e-mail: spkorolev@mail.ru

Received July 14, 2025

Revised July 14, 2025

Accepted August 6, 2025

Abstract— Increasing resistance of human immunodeficiency virus type1 (HIV-1) to the drugs targeting viral

proteins stimulates the search for new therapeutic targets, among which are blockers of virus–host protein

interactions. For two cellular proteins (LEDGF/p75 and Ku70) that interact with viral integrase, binding in-

hibitors have already been identified that reduce replication efficiency. Previously, using the methods of

cross-linking and co-immunoprecipitation followed by mass spectrometry, several novel potential cellular

partners of HIV-1 integrase were identified, including the Hsp60 chaperonin and S-adenosylhomocysteine hy-

drolase (SAHH). In the present study, we demonstrate that these purified recombinant proteins co-precipitate

invitro with integrase, indicating their ability to directly interact with the enzyme. Knockdown of Hsp60 and

SAHH in the human cells was found to stimulate transduction efficiency by the HIV-1-based pseudovirus. This

effect occurs specifically at the early stages of HIV-1 replication, not at the stage of proviral transcription.

Furthermore, we were able to determine the stage of HIV-1 replication influenced by these proteins. It was

revealed that the Hsp60 knockdown stimulates integration, while the SAHH knockdown enhances efficiency

of the viral reverse transcription, in which integrase is also involved.

DOI: 10.1134/S0006297925602163

Keywords: SAHH, Hsp60, reverse transcriptase, integrase, HIV-1

* To whom correspondence should be addressed.

INTRODUCTION

During a replicative cycle, viruses inevitably en-

counter host cell proteins. Some of these interactions

represent cellular defense mechanisms against a vi-

rus, whereas others enable a virus to exploit host sys-

tems for its own replication [1]. Each viral protein has

a specific set of cellular protein partners, constituting

its interactome. The number of such partners can be

substantial, reaching several dozen cellular proteins

per single viral protein and more than a hundred for

the entire viral proteome [2]. Information on these

interactions could be valuable for the development

of new therapeutic strategies against viral infections,

particularly in the case of rapidly evolving viruses,

such as human immunodeficiency virus type1 (HIV-1)

that acquires resistance to antiviral medications [3, 4].

Most antiretroviral drugs used in the HIV-1 ther-

apy are inhibitors of one of the three viral enzymes:

reverse transcriptase (RT), integrase (IN), and pro-

tease. Due to the rapid emergence of resistance to

individual drugs, current treatment standards recom-

mend the simultaneous use of at least three inhibitors

targeting two or more viral enzymes [5]. Nevertheless,

the multidrug-resistant HIV-1 strains are regularly de-

tected in patients, and these strains are often difficult

to combat using traditional approaches [6, 7]. Recent

studies have shown that in such cases, the following

FEIGIN et al.1644

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

inhibitors of protein–protein interactions can be ef-

fective: fostemsavir, which blocks interaction between

the gp120 and the CD4 receptor [8, 9]; ibalizumab, tar-

geting the same interaction [10, 11]; and lenacapavir,

blocking interaction between subunits of the capsid

protein [12]. Efficacy of such drugs demonstrates that

studying these interactions is important not only for

advancing theoretical understanding of the HIV-1 life

cycle but also for the development of novel therapeu-

tic strategies.

HIV-1 integrase (IN) is a promising subject for

investigating protein–protein interaction between a

virus and a host cell for two reasons. First, it is re-

quired for the successful completion of three major

early stages of the viral replicative cycle: reverse tran-

scription, integration, and post-integration repair; dis-

rupting any of them leads to inhibition of replication

[13-15]. Second, more than 20 cellular partners of IN

have been described to date, while this list is steadily

growing; their roles and mechanisms of action are

diverse, providing potentials for novel approaches to

targeting viral replication [16].

In the 2025 study using cross-linking and co-im-

munoprecipitation followed by mass spectrometry,

a number of potential cellular partners of HIV-1 IN

were identified, including the heat shock protein 60

(Hsp60) chaperonin and S-adenosylhomocysteine hy-

drolase (SAHH, of which two isoforms – SAHH1 and

SAHH2 – are known, differing by the presence of a

29-amino acid N-terminal fragment in the former)

[17]. In the present work, we demonstrate for the

first time that both isoforms of SAHH are capable

of interacting with IN in  vitro, and we also confirm

the previously reported in  vitro interaction between

Hsp60 and integrase [18]. Using HIV-1-based pseudo-

typed viral particles, we characterized these proteins

as negative HIV-1 factors acting at the early stages of

viral replication. Furthermore, by quantifying differ-

ent forms of viral DNA using qPCR, we determined

that the effect of SAHH is due to its negative influence

on reverse transcription, whereas Hsp60 acts at the

integration step.

MATERIALS AND METHODS

Oligonucleotides were synthesized by the phos-

phoramidite method by Evrogen (Russia) (Table 1).

Small interfering RNAs (siRNAs) were synthe-

sized by the phosphoramidite method by Genterra

(Russia) (Table 2).

Plasmids. Two commercial plasmids were used

in this study: pNL4-3.Luc.R-E (NovoPro, China) and

pCMV-VSVG (Addgene, USA), encoding the genome of

pseudoviral particles with the firefly luciferase report-

er gene and the surface glycoprotein G of the vesicular

stomatitis virus, respectively. For prokaryotic expres-

sion of the GST-tagged recombinant human proteins

SAHH1, SAHH2, and Hsp60, plasmids were construct-

ed on the basis of the pGEX vector (Addgene). For

this purpose, PCR was performed with total cellular

cDNA using primers Hsp60_s and Hsp60_as; SAHH1_s

and SAHH1_as; SAHH2_s and SAHH2_as (Table1), and

Q5 High-Fidelity Polymerases (New England Biolabs,

USA), according to the manufacturer’s instructions.

The resulting PCR products were digested with the

restriction endonucleases FastDigest NdeI and FastDi-

gest XhoI (Thermo Fisher Scientific, USA) and cloned

into the pGEX vector. Sequences of the resulting

pGEX_Hsp60, pGEX_SAHH1, and pGEX_SAHH2 vectors

were confirmed by sequencing.

Production, isolation, and purification of re-

combinant proteins. Recombinant HIV-1 IN was

obtained as described previously [19]. For the pro-

duction of GST-Hsp60, GST-SAHH1, and GST-SAHH2

proteins, competent Escherichia coli BL21-Codon Plus

cells (Agilent, USA) were transformed with 10 ng of

pGEX_Hsp60, pGEX_SAHH1, and pGEX_SAHH2 plas-

mids, respectively. Selected clones were grown in a

2.5% LB medium (Amresco, USA) supplemented with

100 µg/ml ampicillin in 1-liter flasks at 16°C. When

600

reached 0.8, expression was induced by addi-

tion of 0.1mM IPTG, followed by cultivation for 18  h.

Cells were harvested by centrifugation for 30 min at

3000 rpm. Cell pellets were resuspended on ice in a

buffer (20  mM Tris-HCl (pH  8.0), 500  mM NaCl, 2  mM

2-mercaptoethanol, 1  mM  PMSF) at a ratio 10  ml buf-

fer per 1  g of pellet, and exposed to ultrasonication

(3-5  kJ of transmitted energy per 1  g of resuspended

Table 1. Primer sequences used in this study

Primers 5′→3′ primer sequences

Hsp60_s d(AGACTCCATATGCTTCGGTTACCC)

Hsp60_as d(GATCCTCGAGTTATCCGAACATGCCAC)

SAHH1_s d(GCCGATCCATATGTCTGACAAACTGC)

SAHH1_as d(GATCCTCGAGTTATCCGTAGCGGTAG)

SAHH2_s d(GGATCCATATGCCGGGCC)

SAHH2_as d(GATCCTCGAGTTATCCGTAGCGGTAG)

GAPDH_fw d(CCACTCCTCCACCTTTGAC)

GAPDH_rv d(ACCCTGTTGCTGTAGCCA)

Hsp60_fw d(AGCCTTGGACTCATTGAC)

SAHH_fw d(GTGGAGATCGATGTCAAGTG)

SAHH_rv d(CTGGTTGGTGAAGGAGTTAC)

HSP60 AND SAHH IN HIV-1 REPLICATION 1645

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Table 2. siRNA sequences used in this study

siRNAs 5′→3′ oligonucleotide sequences

siC

S: rArGrGrUrCrGrArArCrUrArCrGrGrGrUrCrArAdTdT

AS: rUrUrGrArCrCrCrGrUrArGrUrUrCrGrArCrCrUdTdT

siHsp60

S: rUrGrUrUrGrArArGrGrArUrCrUrUrUrGrArUrAdTdT

AS: rUrArUrCrArArArGrArUrCrCrUrUrCrArArCrAdTdT

siSAHH

S: rCrArGrGrCrUrGrUrArUrUrGrArCrArUrCrArUdTdT

AS: rArUrGrArUrGrUrCrArArUrArCrArGrCrCrUrGdTdT

pellet). Insoluble material was removed by centrifuga-

tion. Lysates were incubated with a glutathione-aga-

rose (Thermo Fisher Scientific, USA) pre-equilibrated

with a buffer for 3 h at 4°C. Glutathione-agarose was

washed with 25 ml of a resuspension buffer. Elution

was performed in two steps: glutathione-agarose was

incubated with an elution buffer (20 mM Tris-HCl (pH

7.5), 500 mM NaCl, 2 mM 2-mercaptoethanol, 50 mM

glutathione) for 30 min at room temperature, the el-

uate was collected, and the procedure was repeated.

Dialysis against a dialysis buffer (20 mM Tris-HCl

(pH  7.6), 500  mM  NaCl, 5%  glycerol, 2  mM  2-mercap-

toethanol) was performed overnight. For storage,

20% glycerol was added to the buffer, and protein

solutions were stored at −80°C. Protein concentration

in the final preparations was quantified by the Brad-

ford assay [20].

Protein co-precipitation. Interaction between

the GST-tagged human proteins and 6×His-tagged IN

was analyzed using protein co-precipitation on glu-

tathione-agarose. Protein pairs were incubated in

200µl of a co-precipitation buffer (20mM HEPES (pH

7.5), 100 mM NaCl, 7.5 mM MgCl

, 2 mM 2-mercap-

toethanol, 50  µg/ml  BSA, 0.1%  NP-40) for 1  h at 25°C,

followed by addition of 30 µl glutathione- agarose

pre-equilibrated in the same buffer supplemented

with BSA, and incubation for another hour. Super-

natants were removed, and the agarose was washed

twice with 600 µl of the co-precipitation buffer. Pre-

cipitated proteins were eluted from the agarose by

its incubation in a buffer containing 50 mM Tris-HCl

(pH 6.8), 1% SDS, 10% glycerol, 100 mM 2-mercap-

toethanol, ~0.0025% bromophenol blue at 95°C for

10 min. Proteins were separated with 12% SDS-PAGE

according to Laemmli [21] and analyzed by Western

blot analysis.

Western blot analysis. After SDS-PAGE separa-

tion, proteins were transferred to Immobilon®-PVDF

membranes (Bio-Rad, USA) using the Trans-Blot

Turbo Transfer System (Bio-Rad), (semi-dry transfer).

GST- and 6×His-tagged proteins were detected with

rabbit anti-GST and mouse anti-His antibodies (Sigma,

USA), respectively. Visualization was performed with

HRP-conjugated secondary antibodies: mouse an-

ti-rabbit and goat anti-mouse (Sigma, USA). Detection

was carried out using an HRP Clarity Western ECL

substrate kit (Bio-Rad) and a ChemiDoc MP system

(Bio-Rad).

Culturing human cells. All experiments with hu-

man cells were carried out using the HEK 293T cell

line. Cells were cultured in DMEM medium (PanEco,

Russia) supplemented with 10% FBS, 100 U/ml peni-

cillin, and 100 µg/ml streptomycin (Invitrogen, USA).

To obtain HEK 293T cells with a stably integrated

pseudoprovirus, cells were transduced with pseudo-

viral particles and maintained for one week.

Liposome-mediated siRNA transfection. HEK

293T cells were transfected with siHsp60 and siSAHH

siRNAs, targeting Hsp60 and SAHH mRNAs, respec-

tively, in the presence of GenJect-40 (Molekta, Rus-

sia) according to the manufacturer’s instructions.

As a control, a nonspecific siRNA (siC) was used.

Efficiency of siRNA action was analyzed 48  h after

transfection by qPCR with total cellular cDNA using

a 5X qPCRmix-HS SYBR mix (Evrogen), a Gentier 96

Real-Time Quantitative PCR system (Drawell Scientific,

China), and Hsp60_fw/Hsp60_rv; SAHH_fw/SAHH_rv

primers (Table 1) to assess Hsp60 and SAHH siRNA

levels, respectively. GAPDH_fw and GAPDH_rv prim-

ers (Table 1) were used as an internal control to as-

sess mRNA levels of the GAPDH household gene.

Production of VSV-G-pseudotyped viral par-

ticles. To produce pseudoviral particles, HEK 293T

cells were transfected using the calcium phosphate

method with two plasmids: pNL4-3.Luc.R-E and pC-

MV-VSVG (at a 5  :  1 mass ratio). For transfection of

one T-175 flask (179.5  cm

), a total of 90  µg of plas-

mid DNA was used, dissolved in 1969  µl of buffer

(10 mM Tris-HCl (pH  8.0), 1  mM EDTA), 2250  µl of

2×HBS buffer (10 mM HEPES (pH  7.4), 150  mM NaCl),

and 281  µl of 2 M CaCl

. After 48  h, the culture medi-

um was collected and replaced with a fresh medium.

FEIGIN et al.1646

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Fig. 1. Co-precipitation of recombinant GST-tagged Hsp60, SAHH1, and SAHH2 proteins (150 nM) with 6×His-tagged HIV-1

IN (75 or 150 nM) on glutathione–agarose.

The harvested medium was centrifuged at 3000 rpm

and supernatants were filtered through a 0.45µm fil-

ter (Membrane Solutions, USA). The filtrate was cen-

trifuged at 56,000g for 1.5  h at 4°C under vacuum.

The resulting pellet was resuspended in PBS buffer

(Gibco, USA) and stored at −80°C. After another 24  h

(72  h after transfection), the medium was collected

again and processed as described above.

Luciferase activity assay in transduced cells.

HEK 293T cells were transduced with pseudoviral par-

ticles 48  h after siRNA transfection. 24  h post-trans-

duction, Photinus pyralis firefly luciferase activity

was measured using the Luciferase Assay System

(Promega, USA) according to the manufacturer’s pro-

tocol. Luminescence was analyzed using the BioTek

SYNERGY H1 multimode reader (Agilent Technologies,

USA). Luminescence in HEK 293T cells with stably

integrated pseudoprovirus was analyzed 48 h after

siRNA transfection.

Relative quantification of HIV-1 DNA forms.

Relative levels of total and integrated HIV-1 DNA were

determined as described previously [22]. Relative ef-

ficiency of post-integration repair of HIV-1 DNA was

assessed as described by Anisenko et al. [23].

Data visualization. Data analysis was performed

using the Microsoft Excel software. Luciferase assay

and MTT assay results were visualized using the

GraphPad Prism 9.5.1 software.

Statistical analysis. All experiments were per-

formed in at least three biological replicates. One-way

ANOVA followed by Dunnett’s test was used for mul-

tiple comparisons.

RESULTS

Interaction of HIV-1 integrase with recombi-

nant Hsp60 and SAHH proteins in  vitro. Interac-

tion of Hsp60 and SAHH with HIV-1 integrase (IN)

observed by Agapkina et al. [17] could have resulted

from either direct or indirect protein interactions due

to the specifics of the method, which was based on

formaldehyde treatment of a cell lysate containing

overexpressed HIV-1 IN, followed by co-immunoprecip-

itation of protein complexes and mass spectrometric

detection of IN-bound proteins. To determine whether

the potential partners interact directly with IN, we

expressed the GST-tagged human proteins (Hsp60 or

one of the two SAHH isoforms) and incubated them

with the 6×His-tagged HIV-1 IN, followed by analysis

of their interaction using an in  vitro co-precipitation

assay. For each of the proteins tested, we observed

co-precipitation of IN at least at one of the concentra-

tions used (Fig. 1). In addition, the amount of co-pre-

cipitated IN increased with increasing concentration

of this protein in solution. No nonspecific binding of

IN to the sorbent was observed in the control sample,

where IN alone was incubated with the resin without

any human protein. These data indicate that the hu-

man Hsp60, SAHH1, and SAHH2 proteins specifically

bind to the HIV-1 IN in vitro.

Effect of Hsp60 and SAHH knockdown on the

HIV-1 replication. Having established that the test-

ed proteins can directly interact with IN, we next

investigated their effect on the HIV-1 replication.

To this end, we performed knockdown of Hsp60 and

SAHH in the HEK 293T cells using siRNA, followed

by transduction with the replication-defective HIV-1-

based pseudovirus particles carrying a firefly lucifer-

ase reporter gene. This system allows assessment of

the knockdown effects on early stages of replication

(reverse transcription, integration, and post-integra-

tion repair), as well as transcription of the integrat-

ed provirus from the HIV-1 LTR promoter. According

to our data, a statistically significant difference was

observed between the reporter activity in the cells

transfected with the control non-specific siRNA (siC)

and the cells transfected with the siRNAs targeting the

mRNAs of the studied proteins (Fig. 2a). Knockdown

of Hsp60 led to the 1.9  ±  0.4-fold increase in the lu-

ciferase signal, while knockdown of SAHH resulted in

the 1.65  ±  0.11-fold increase. Thus, since knockdown

HSP60 AND SAHH IN HIV-1 REPLICATION 1647

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Fig. 2. Effect of Hsp60 or SAHH knockdown on HIV-1 replication in the cells transduced with HIV-1-based pseudoviral parti-

cles(a) and on transcription of the integrated pseudoprovirus(b). Changes in the signal intensity of the luciferase reporter

protein were measured. Statistical significance was determined using Dunnett’s method for multiple comparisons. All exper-

iments were performed in at least four biological replicates. p-value: ns > 0.05 ≥ * > 0.01 ≥ ** > 0.005; ns, non-significant.

of either protein enhanced reporter activity, it could

be concluded that Hsp60 and SAHH act as negative

regulators of the HIV-1 replication cycle.

Effect of Hsp60 and SAHH knockdown on provi-

rus transcription. Since the signal in our pseudoviral

system depends not only on the early stages of HIV-1

replication, but also on the proviral transcription ef-

ficiency, we performed an additional experiment in

which cells were first transduced with pseudoviral

particles and, after the completion of all early replica-

tion stages, knockdown of SAHH and Hsp60 was car-

ried out and reporter signal was measured. This ap-

proach allows identification of the knockdown effect

separately on the stage of proviral transcription from

the HIV-1 LTR promoter. According to our data, knock-

down of these proteins had no statistically significant

effect on pseudoprovial transcription (Fig. 2b). Thus,

the reduced intracellular levels of Hsp60 and SAHH

affect specifically the early stages of HIV-1 replication,

highlighting importance of their interaction specifical-

ly with IN during these stages.

Relative quantification of HIV-1 DNA forms.

To further investigate the mechanism through which

Hsp60 and SAHH impact the HIV-1 life cycle, we

examined the effect of their knockdown on reverse

transcription, integration, and post-integration re-

pair by determining the relative levels of different

HIV-1 DNA forms [22,  23]. This method is based on

quantification of the total, integrated, and repaired

forms of viral DNA produced as a result of reverse

transcription, integration, and post-integration repair,

respectively. The DNA levels were measured using

quantitative PCR (Fig. 3). The knockdown of SAHH

led to the 1.47  ±  0.14-fold increase in total HIV-1 DNA,

whereas the knockdown of Hsp60 had no visible ef-

fect (Fig.  3a). At the same time, knockdown of both

Hsp60 and SAHH equally affected the level of inte-

grated DNA, resulting in the 1.6  ±  0.3-fold increase

(Fig. 3b). No statistically significant effects of the

protein knockdown on relative post-integration repair

efficiency were observed (Fig. 3c).

DISCUSSION

Hsp60 is the chaperone family protein, its pri-

mary function is to partially unfold proteins in an

ATP-dependent manner, and to facilitate their refold-

ing into the correct native conformation [24]. It is

well established that under stress conditions the level

of cellular expression of Hsp60 is markedly increased,

accompanied by the parallel rise in the number of

cell proteins associated with it [25]. Our findings on

the direct interaction of Hsp60 with IN are consistent

with the previously published data obtained with the

yeast model [18]. Notably, Hsp60 is a predominantly

mitochondrial protein (up to 85% of the total pool is

normally localized in mitochondria), but it has also

been detected in the cytoplasm, on the outer mito-

chondrial membrane, within cytoplasmic vesicles and

secretory granules, in the nucleus, and even on the

outer surface of the plasma membrane [26, 27]. Since

the HIV-1 replication does not involve mitochondria,

it is reasonable to assume that viral replication is

affected precisely by this minor non-mitochondrial

fraction of Hsp60. It has been reported that in certain

FEIGIN et al.1648

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

Fig. 3. Effect of Hsp60 or SAHH knockdown on the relative levels of different HIV-1 DNA forms: total (a), integrated (b),

and repaired(c). Statistical significance was determined using Dunnett’s method for multiple comparisons. All experiments

were performed in at least three biological replicates. p-value: ns > 0.05; 0.01 ≥ ** > 0.005.

infectious diseases the fraction of non-mitochondrial

Hsp60 may increase substantially and play an import-

ant role in the immune response [28], although such

an effect has not been demonstrated for HIV-1.

As reported by Parissi etal. [18], the Hsp60 bind-

ing site was identified between the residues 48 and

212 of IN, i.e., within its central catalytic domain.

Moreover, experiments with the recombinant proteins

revealed that the addition of small amounts of Hsp60

stimulated the catalytic activity of IN in both 3′-pro-

cessing and strand transfer reactions [18]. The stron-

gest stimulatory effect was observed at a 10-20-fold

excess of IN relative to Hsp60; increasing Hsp60 con-

centration reduced its stimulatory effect, and at the

Hsp60/IN ratio of 1  :  3.5, complete inhibition of both

IN catalytic activities was observed, most likely due

to excessively strong binding of Hsp60 to the catalyt-

ic domain of IN. We suggest that the negative effect

of Hsp60 on HIV-1 integration observed in our more

physiologically relevant cell system (Fig. 3b) could be

explained by functional inhibition of IN through its

interaction with Hsp60.

S-adenosylhomocysteine hydrolase (SAHH) is

the only mammalian enzyme catalyzing hydrolysis

of S-adenosylhomocysteine into L-homocysteine and

adenosine [29]. It is one of the most conserved en-

zymes across living organisms (found in eukaryotes,

archaea, and bacteria) [30, 31]. Deletion of the corre-

sponding gene is embryonically lethal in many spe-

cies [32, 33], while mutations in the human ortholog

often result in the severe disorders and early death

[33, 34]. SAHH was initially considered to be a cyto-

plasmic enzyme, but later was shown to accumulate

in significant amounts in the nucleus [35], predomi-

nantly in the actively transcribed chromatin regions,

where it colocalizes with RNA polymerase II.

Several examples of the influence of SAHH in-

hibitors on viral replication have been documented:

negative effect on the Rous sarcoma virus in chicken

embryo cells [36], suppression of the human cytomeg-

alovirus replication in embryonic lung fibroblasts[37],

as well as reduced cytopathic effects of the cowpox

virus, vesicular stomatitis virus, parainfluenza vi-

rus, reovirus type 1, herpes simplex virus, and oth-

ers [38]. Evidence also exists for a negative effect of

SAHH inhibitors on HIV-1 transcription in HeLa cells,

whereas no similar effect was observed in human

lymphocyte and macrophage cultures [39]. Converse-

ly, another study demonstrated that 3-deazaadenos-

ine analogs (SAHH inhibitors) effectively suppressed

HIV-1 replication in peripheral blood mononuclear

cells [40]. Despite these pronounced antiviral prop-

erties of SAHH inhibitors, such findings should be

interpreted with caution for two following reasons.

First, SAHH inhibitors exert systemic effects on the

cell by altering both DNA and RNA methylation pro-

files, complicating interpretation and often leading to

inconsistent results across different cell lines. Second,

their broad spectrum of activity most likely reflects

a low specificity of their influence on HIV-1 replica-

tion. The effect we observed is opposite in nature: the

SAHH knockdown enhances pseudovirus replication

efficiency, and this effect is unrelated to the tran-

scription stage. This finding indicates importance of

the interaction between HIV-1 IN and SAHH, since IN

functions at the early stages of the replication cycle

HSP60 AND SAHH IN HIV-1 REPLICATION 1649

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

but not in the stage of proviral transcription. Direct

interaction between HIV-1 IN and RT was reported

[41], in addition, certain IN mutations that disrupt

this interaction negatively affected reverse transcrip-

tion [42, 43]. SAHH interaction with IN is assumed

to interfere with the proper IN–RT interaction, which

explains the effect of SAHH knockdown on the total

HIV-1 DNA level observed in our experiments. Nota-

bly, the increase in the integrated DNA level upon the

SAHH knockdown was proportional to the increase

in the total viral DNA produced during reverse tran-

scription, indicating that the SAHH knockdown affects

specifically reverse transcription, but not integration.

CONCLUSION

Integrase is one of the key enzymes of HIV-1 re-

quired for successful completion of the early stages

of the viral replicative cycle. During replication, IN

interacts with numerous host cellular factors that in-

fluence replication efficiency. We demonstrated that

the previously identified potential partners of IN –

Hsp60, SAHH1, and SAHH2 – indeed interact direct-

ly with it in  vitro. Furthermore, we established that

these proteins act as negative regulators of the viral

replication cycle, since their depletion results in the

enhanced replication efficiency. Our data indicate that

the observed effects occur at the early stages of viral

replication in which IN is involved, and do not affect

transcription of the integrated provirus. Moreover, we

found that the role of Hsp60 is critical at the integra-

tion stage of HIV-1, whereas SAHH exerts its influence

at the reverse transcription stage. Further studies of

the mechanisms by which these proteins affect HIV-1

replication could be valuable both for advancing our

understanding of the virus–host interactions and for

developing novel approaches to HIV therapy.

Abbreviations

HIV-1 human immunodeficiency virus type 1

IN HIV-1 integrase

siRNA small interfering RNAs

RT reverse transcriptase

Hsp60 Heat Shock Protein 60

SAHH S-adenosylhomocysteine hydrolase

Acknowledgments

Isolation and analysis of the relative amounts of dif-

ferent forms of HIV-1 DNA were performed by quan-

titative PCR using a Gentier 96 Real-Time Quantitative

PCR amplifier, an AllSheng Fluo-800 fluorimeter, and a

Bioer GenePure Pro automated nucleic acid extraction

and purification station, acquired under the Develop-

ment Program of Lomonosov Moscow State University

(PNR5.13).

Contributions

M.B.G. and S.P.K. developed the concept and super-

vised the study; T.F.K., S.P.K., and S.E.F. conducted the

experiments; Yu.Yu.A., A.N.A., M.B.G., and S.P.K. dis-

cussed the study results; S.P.K. and S.E.F. prepared the

manuscript; M.B.G. edited the manuscript.

Fundings

This work was financially supported by the Russian

Science Foundation (project no.22-14-00073-P).

Ethics approval and consent to participate

This work does not contain any studies involving hu-

man and animal subjects.

Conflict of interest

The authors of this work declare that they have no

conflicts of interest.

Open access

This article is licensed under a Creative Commons

Attribution 4.0 International License, which permits

use, sharing, adaptation, distribution, and reproduc-

tion in any medium or format, as long as you give

appropriate credit to the original author(s) and the

source, provide a link to the Creative Commons li-

cense, and indicate if changes were made. The images

or other third party material in this article are includ-

ed in the article’s Creative Commons license, unless

indicated otherwise in a credit line to the material.

If material is not included in the article’s Creative

Commons license and your intended use is not permit-

ted by statutory regulation or exceeds the permitted

use, you will need to obtain permission directly from

the copyright holder. To view a copy of this license,

visit http://creativecommons.org/licenses/by/4.0/.

REFERENCES

1. Brito, A. F., and Pinney, J. W. (2017) Protein-pro-

tein interactions in virus-host systems, Front. Mi-

crobiol., 8, 1557, https://doi.org/10.3389/fmicb.2017.

01557.

2. Martinez-Gil,L., Vera-Velasco, N.M., and Mingarro,I.

(2017) Exploring the human-Nipah virus protein-pro-

tein interactome, J. Virol., 91, e01452-17, https://

doi.org/10.1128/JVI.01461-17.

3. Loregian, A., Marsden, H. S., and Palu, G. (2002)

Protein-protein interactions as targets for antiviral

chemotherapy, Rev. Med. Virol., 12, 239-262, https://

doi.org/10.1002/rmv.356.

4. Markovic, V., Szczepanska, A., and Berlicki, L. (2024)

Antiviral protein-protein interaction inhibitors,

J. Med. Chem., 67, 3205-3231, https://doi.org/10.1021/

acs.jmedchem.3c01543.

FEIGIN et al.1650

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

5. Phanuphak, N., and Gulick, R. M. (2020) HIV treat-

ment and prevention 2019: current standards of care,

Curr. Opin. HIV AIDS, 15, 4-12, https://doi.org/10.1097/

COH.0000000000000588.

6. Iversen, A. K., Shafer, R. W., Wehrly, K., Winters,

M. A., Mullins, J. I., Chesebro, B., and Merigan, T. C.

(1996) Multidrug-resistant human immunodeficiency

virus type 1 strains resulting from combination an-

tiretroviral therapy, J. Virol., 70, 1086-1090, https://

doi.org/10.1128/jvi.70.2.1086-1090.1996.

7. Shafer, R.W., Winters, M.A., Palmer,S., and Merigan,

T.C. (1998) Multiple concurrent reverse transcriptase

and protease mutations and multidrug resistance of

HIV-1 isolates from heavily treated patients, Ann.

Intern. Med., 128, 906-911, https://doi.org/10.7326/

0003-4819-128-11-199806010-00008.

8. Kozal,M., Aberg,J., Pialoux,G., Cahn,P., Thompson,M.,

Molina, J. M., Grinsztejn, B., Diaz, R., Castagna, A.,

Kumar, P., Latiff, G., DeJesus, E., Gummel, M.,

Gartland, M., Pierce, A., Ackerman, P., Llamoso, C.,

and Lataillade, M. (2020) Fostemsavir in adults

with multidrug-resistant HIV-1 infection, N. Engl.

J. Med., 382, 1232-1243, https://doi.org/10.1056/

NEJMoa1902493.

9. Hiryak, K., and Koren, D. E. (2021) Fostemsavir: a

novel attachment inhibitor for patients with multi-

drug-resistant HIV-1 infection, Ann. Pharmacother.,

55, 792-797, https://doi.org/10.1177/1060028020962424.

10. Beccari, M. V., Mogle, B. T., Sidman, E. F., Mastro,

K. A., Asiago-Reddy, E., and Kufel, W. D. (2019) Ibal-

izumab, a novel monoclonal antibody for the man-

agement of multidrug-resistant HIV-1 infection, An-

timicrob. Agents Chemother., 63, e00110-19, https://

doi.org/10.1128/AAC.00110-19.

11. Blair, H. A. (2020) Ibalizumab: a review in multi-

drug-resistant HIV-1 infection, Drugs, 80, 189-196,

https://doi.org/10.1007/s40265-020-01258-3.

12. Segal-Maurer, S., DeJesus, E., Stellbrink, H. J.,

Castagna, A., Richmond, G. J., Sinclair, G. I.,

Siripassorn, K., Ruane, P. J., Berhe, M., Wang, H.,

Margot, N.A., Dvory-Sobol,H., Hyland, R.H., Brainard,

D. M., Rhee, M. S., Baeten, J. M., and Molina, J. M.

(2022) Capsid inhibition with lenacapavir in multi-

drug-resistant HIV-1 infection, N.Engl. J. Med., 386,

1793-1803, https://doi.org/10.1056/NEJMoa2115542.

13. Tekeste, S. S., Wilkinson, T. A., Weiner, E. M., Xu, X.,

Miller, J. T., Le Grice, S. F., Clubb, R. T., and Chow,

S.A. (2015) Interaction between reverse transcriptase

and integrase is required for reverse transcription

during HIV-1 replication, J. Virol., 89, 12058-12069,

https://doi.org/10.1128/JVI.01471-15.

14. Brown, P. O. (1990) Integration of retroviral DNA,

Curr. Top. Microbiol. Immunol., 157, 19-48, https://

doi.org/10.1007/978-3-642-75218-6_2.

15. Anisenko, A. N., Knyazhanskaya, E. S., Zalevsky,

A. O., Agapkina, J. Y., Sizov, A. I., Zatsepin, T. S., and

Gottikh, M. B. (2017) Characterization of HIV-1 in-

tegrase interaction with human Ku70 protein and

initial implications for drug targeting, Sci. Rep., 7,

5649, https://doi.org/10.1038/s41598-017-05659-5.

16. Rozina, A., Anisenko, A., Kikhai, T., Silkina, M.,

and Gottikh, M. (2022) Complex relationships be-

tween HIV-1 integrase and its cellular partners,

Int.J. Mol. Sci., 23, 12341, https://doi.org/10.3390/

ijms232012341.

17. Agapkina, Y. Y., Ponomareva, T. Y., Vdovina, M. V.,

Ziganshin, R. H., Rozina, A. A., Anisenko, A. N., and

Gottikh, M. B. (2025) New cellular partners of HIV-1

integrase and their role in viral replication, Dokl. Bio-

chem. Biophys., 522, 279-284, https://doi.org/10.1134/

S1607672925600149.

18. Parissi,V., Calmels,C., De Soultrait, V.R., Caumont,A.,

Fournier, M., Chaignepain, S., and Litvak, S. (2001)

Functional interactions of human immunodeficiency

virus type 1 integrase with human and yeast HSP60,

J. Virol., 75, 11344-11353, https://doi.org/10.1128/JVI.

75.23.11344-11353.2001.

19. Leh, H., Brodin, P., Bischerour, J., Deprez, E., Tauc,P.,

Brochon, J.-C., LeCam,E., Coulaud,D., Auclair,C., and

Mouscadet, J. F. (2000) Determinants of Mg

-depen-

dent activities of recombinant human immunode-

ficiency virus type 1 integrase, Biochemistry, 39,

9285-9294, https://doi.org/10.1021/bi000398b.

20. Bradford, M. M. (1976) A rapid and sensitive meth-

od for the quantitation of microgram quantities of

protein utilizing the principle of protein-dye binding,

Anal. Biochem., 72, 248-254, https://doi.org/10.1016/

0003-2697(76)90527-3.

21. Laemmli, U.K. (1970) Cleavage of structural proteins

during the assembly of the head of bacteriophageT4,

Nature, 227, 680-685, https://doi.org/10.1038/227680a0.

22. Vandergeeten, C., Fromentin, R., Merlini, E., Lawani,

M. B., DaFonseca, S., Bakeman, W., McNulty, A.,

Ramgopal, M., Michael, N., Kim, J. H., Ananworan-

ich, J., and Chomont, N. (2014) Cross-clade ultrasen-

sitive PCR-based assays to measure HIV persistence

in large-cohort studies, J. Virol., 88, 12385-12396,

https://doi.org/10.1128/JVI.00609-14.

23. Anisenko, A. N., Knyazhanskaya, E. S., Isaguliants,

M. G., and Gottikh, M. B. (2018) A qPCR assay for

measuring the post-integrational DNA repair in HIV-1

replication, J. Virol. Methods, 262, 12-19, https://

doi.org/10.1016/j.jviromet.2018.09.004.

24. Bukau, B., and Horwich, A. L. (1998) The Hsp70

and Hsp60 chaperone machines, Cell, 92, 351-366,

https://doi.org/10.1016/S0092-8674(00)80928-9.

25. Martin,J., Horwich, A.L., and Hartl, F. U. (1992) Pre-

vention of protein denaturation under heat stress by

the chaperonin Hsp60, Science, 258, 995-998, https://

doi.org/10.1126/science.1359644.

26. Soltys, B. J., and Gupta, R. S. (1996) Immunoelectron

microscopic localization of the 60-kDa heat shock

HSP60 AND SAHH IN HIV-1 REPLICATION 1651

BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025

chaperonin protein (Hsp60) in mammalian cells,

Exp. Cell Res., 222, 16-27, https://doi.org/10.1006/

excr.1996.0003.

27. Itoh, H., Kobayashi, R., Wakui, H., Komatsuda, A.,

Ohtani, H., Miura, A. B., Otaka, M., Masamune, O.,

Andoh, H., Koyama, K., Sato, Y., and Tashima, Y.

(1995) Mammalian 60-kDa stress protein (chaperonin

homolog): identification, biochemical properties, and

localization, J.Biol. Chem., 270, 13429-13435, https://

doi.org/10.1074/jbc.270.22.13429.

28. Wu,T., Jia,L., Lei,S., Jiang,H., Liu,J., Li,N., Langford,

P. R., Liu, H., and Lei, L. (2022) Host HSPD1 translo-

cation from mitochondria to the cytoplasm induced

by Streptococcus suis serovar 2 enolase mediates

apoptosis and loss of blood-brain barrier integrity,

Cells, 11, 2071, https://doi.org/10.3390/cells11132071.

29. Turner, M.A., Simpson,A., McInnes, R.R., and Howell,

P. L. (1998) Structure determination of selenomethi-

onyl S-adenosylhomocysteine hydrolase using data

at a single wavelength, Nat. Struct. Biol., 5, 369-376,

https://doi.org/10.1038/nsb0598-369.

30. Vizan,P., Di Croce,L., and Aranda,S. (2021) Functional

and pathological roles of AHCY, Front. Cell Dev. Biol.,

9, 654344, https://doi.org/10.3389/fcell.2021.654344.

31. Mushegian, A. R., Garey, J. R., Martin, J., and Liu,

L. X. (1998) Large-scale taxonomic profiling of eu-

karyotic model organisms: a comparison of orthol-

ogous proteins encoded by the human, fly, nema-

tode, and yeast genomes, Genome Res., 8, 590-598,

https://doi.org/10.1101/gr.8.6.590.

32. Dickinson, M. E., Flenniken, A. M., Ji, X., Teboul, L.,

Wong, M. D., White, J. K., Meehan, T. F., Weninger,

W. J., Westerberg, H., Adissu, H., Baker, C. N.,

Bower, L., Brown, J. M., Caddle, L. B., Chiani, F.,

Clary, D., Cleak,J., Daly, M. J., Denegre, J. M., Doe, B.,

Dolan, M. E., Edie, S. M., Fuchs, H., Gailus-Durner, V.,

Galli,A., Gambadoro, A., Gallegos, J., Guo, S., Horner,

N. R., Hsu, C. W., et al. (2016) High-throughput dis-

covery of novel developmental phenotypes, Nature,

537, 508-514, https://doi.org/10.1038/nature19356.

33. Miller, M. W., Duhl, D. M., Winkes, B. M., Arredondo-

Vega,F., Saxon, P.J., Wolff, G.L., Epstein, C.J., Hersh-

field, M. S., and Barsh, G. S. (1994) The mouse lethal

nonagouti (a(x)) mutation deletes the S-adenosylho-

mocysteine hydrolase (Ahcy) gene, EMBOJ., 13, 1806-

1816, https://doi.org/10.1002/j.1460-2075.1994.tb06449.x.

34. Vugrek, O., Beluzic, R., Nakic, N., and Mudd, S. H.

(2009) S-adenosylhomocysteine hydrolase (AHCY) de-

ficiency: two novel mutations with lethal outcome,

Hum. Mutat., 30, E555-E565, https://doi.org/10.1002/

humu.20985.

35. Radomski, N., Kaufmann, C., and Dreyer, C. (1999)

Nuclear accumulation of S-adenosylhomocysteine

hydrolase in transcriptionally active cells during

development of Xenopus laevis, Mol. Biol. Cell, 10,

4283-4298, https://doi.org/10.1091/mbc.10.12.4283.

36. Bader, J. P., Brown, N. R., Chiang, P. K., and Cantoni,

G. L. (1978) 3-Deazaadenosine, an inhibitor of ad-

enosylhomocysteine hydrolase, inhibits reproduc-

tion of Rous sarcoma virus and transformation of

chick embryo cells, Virology, 89, 494-505, https://

doi.org/10.1016/0042-6822(78)90193-4.

37. Snoeck, R., Andrei, G., Neyts, J., Schols, D., Cools, M.,

Balzarini, J., and De Clercq, E. (1993) Inhibitory ac-

tivity of S-adenosylhomocysteine hydrolase inhib-

itors against human cytomegalovirus replication,

Antiviral Res., 21, 197-216, https://doi.org/10.1016/

0166-3542(93)90007-6.

38. De Clercq, E. (2005) John Montgomery’s legacy:

carbocyclic adenosine analogues as SAH hydrolase

inhibitors with broad-spectrum antiviral activity,

Nucleosides Nucleotides Nucleic Acids, 24, 1395-1415,

https://doi.org/10.1080/15257770500265638.

39. Daelemans, D., Este, J. A., Witvrouw, M., Panne-

couque, C., Jonckheere, H., Aquaro, S., Perno, C. F.,

De Clercq, E., and Vandamme, A. M. (1997) S-ade-

nosylhomocysteine hydrolase inhibitors interfere

with the replication of human immunodeficiency

virus type 1 through inhibition of the LTR trans-

activation, Mol. Pharmacol., 52, 1157-1163, https://

doi.org/10.1124/mol.52.6.1157.

40. Mayers, D. L., Mikovits, J. A., Joshi, B., Hewlett, I. K.,

Estrada, J. S., Wolfe, A. D., Garcia, G. E., Doctor,

B. P., Burke, D. S., and Gordon, R. K. (1995) Anti-hu-

man immunodeficiency virus 1 (HIV-1) activities of

3-deazaadenosine analogs: increased potency against

3′-azido-3′-deoxythymidine-resistant HIV-1 strains,

Proc. Natl. Acad. Sci. USA, 92, 215-219, https://

doi.org/10.1073/pnas.92.1.215.

41. Wu, X., Liu, H., Xiao, H., Conway, J. A., Hehl, E.,

Kalpana, G. V., Prasad, V., and Kappes, J. C. (1999)

Human immunodeficiency virus type 1 integrase

protein promotes reverse transcription through

specific interactions with the nucleoprotein re-

verse transcription complex, J. Virol., 73, 2126-

2135, https://doi.org/10.1128/JVI.73.3.2126-2135.1999.

42. Engelman, A., Englund, G., Orenstein, J. M., Martin,

M. A., and Craigie, R. (1995) Multiple effects of mu-

tations in human immunodeficiency virus type 1 in-

tegrase on viral replication, J. Virol., 69, 2729-2736,

https://doi.org/10.1128/JVI.69.5.2729-2736.1995.

43. Leavitt, A. D., Robles, G., Alesandro, N., and Varmus,

H. E. (1996) Human immunodeficiency virus type 1

integrase mutants retain in vitro integrase activity

yet fail to integrate viral DNA efficiently during in-

fection, J. Virol., 70, 721-728, https://doi.org/10.1128/

JVI.70.2.721-728.1996.

Publisher’s Note. Pleiades Publishing remains

neutral with regard to jurisdictional claims in published

maps and institutional affiliations. AI tools may have

been used in the translation or editing of this article.