ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 11, pp. 1643-1651 © The Author(s) 2025. This article is an open access publication.
Russian Text © The Author(s), 2025, published in Biokhimiya, 2025, Vol. 90, No. 11, pp. 1754-1764.
1643
Cellular Proteins Hsp60 and SAHH as Negative
Regulators of the Early Stages of HIV-1 Replication
Stepan E. Feigin
1
, Tatiana F. Kikhai
2,3
, Yulia Yu. Agapkina
2,3
,
Andrei N. Anisenko
1,2,3
, Marina B. Gottikh
2,3
, and Sergey P. Korolev
1,2,3,a
*
1
Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University,
119234 Moscow, Russia
2
Belozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University,
119992 Moscow, Russia
3
Chemistry Department, Lomonosov Moscow State University, 119991 Moscow, Russia
a
e-mail: spkorolev@mail.ru
Received July 14, 2025
Revised July 14, 2025
Accepted August 6, 2025
Abstract— Increasing resistance of human immunodeficiency virus type1 (HIV-1) to the drugs targeting viral
proteins stimulates the search for new therapeutic targets, among which are blockers of virus–host protein
interactions. For two cellular proteins (LEDGF/p75 and Ku70) that interact with viral integrase, binding in-
hibitors have already been identified that reduce replication efficiency. Previously, using the methods of
cross-linking and co-immunoprecipitation followed by mass spectrometry, several novel potential cellular
partners of HIV-1 integrase were identified, including the Hsp60 chaperonin and S-adenosylhomocysteine hy-
drolase (SAHH). In the present study, we demonstrate that these purified recombinant proteins co-precipitate
invitro with integrase, indicating their ability to directly interact with the enzyme. Knockdown of Hsp60 and
SAHH in the human cells was found to stimulate transduction efficiency by the HIV-1-based pseudovirus. This
effect occurs specifically at the early stages of HIV-1 replication, not at the stage of proviral transcription.
Furthermore, we were able to determine the stage of HIV-1 replication influenced by these proteins. It was
revealed that the Hsp60 knockdown stimulates integration, while the SAHH knockdown enhances efficiency
of the viral reverse transcription, in which integrase is also involved.
DOI: 10.1134/S0006297925602163
Keywords: SAHH, Hsp60, reverse transcriptase, integrase, HIV-1
* To whom correspondence should be addressed.
INTRODUCTION
During a replicative cycle, viruses inevitably en-
counter host cell proteins. Some of these interactions
represent cellular defense mechanisms against a vi-
rus, whereas others enable a virus to exploit host sys-
tems for its own replication [1]. Each viral protein has
a specific set of cellular protein partners, constituting
its interactome. The number of such partners can be
substantial, reaching several dozen cellular proteins
per single viral protein and more than a hundred for
the entire viral proteome [2]. Information on these
interactions could be valuable for the development
of new therapeutic strategies against viral infections,
particularly in the case of rapidly evolving viruses,
such as human immunodeficiency virus type1 (HIV-1)
that acquires resistance to antiviral medications [3, 4].
Most antiretroviral drugs used in the HIV-1 ther-
apy are inhibitors of one of the three viral enzymes:
reverse transcriptase (RT), integrase (IN), and pro-
tease. Due to the rapid emergence of resistance to
individual drugs, current treatment standards recom-
mend the simultaneous use of at least three inhibitors
targeting two or more viral enzymes [5]. Nevertheless,
the multidrug-resistant HIV-1 strains are regularly de-
tected in patients, and these strains are often difficult
to combat using traditional approaches [6, 7]. Recent
studies have shown that in such cases, the following
FEIGIN et al.1644
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
inhibitors of protein–protein interactions can be ef-
fective: fostemsavir, which blocks interaction between
the gp120 and the CD4 receptor [8, 9]; ibalizumab, tar-
geting the same interaction [10, 11]; and lenacapavir,
blocking interaction between subunits of the capsid
protein [12]. Efficacy of such drugs demonstrates that
studying these interactions is important not only for
advancing theoretical understanding of the HIV-1 life
cycle but also for the development of novel therapeu-
tic strategies.
HIV-1 integrase (IN) is a promising subject for
investigating protein–protein interaction between a
virus and a host cell for two reasons. First, it is re-
quired for the successful completion of three major
early stages of the viral replicative cycle: reverse tran-
scription, integration, and post-integration repair; dis-
rupting any of them leads to inhibition of replication
[13-15]. Second, more than 20 cellular partners of IN
have been described to date, while this list is steadily
growing; their roles and mechanisms of action are
diverse, providing potentials for novel approaches to
targeting viral replication [16].
In the 2025 study using cross-linking and co-im-
munoprecipitation followed by mass spectrometry,
a number of potential cellular partners of HIV-1 IN
were identified, including the heat shock protein 60
(Hsp60) chaperonin and S-adenosylhomocysteine hy-
drolase (SAHH, of which two isoforms – SAHH1 and
SAHH2 – are known, differing by the presence of a
29-amino acid N-terminal fragment in the former)
[17]. In the present work, we demonstrate for the
first time that both isoforms of SAHH are capable
of interacting with IN in  vitro, and we also confirm
the previously reported in  vitro interaction between
Hsp60 and integrase [18]. Using HIV-1-based pseudo-
typed viral particles, we characterized these proteins
as negative HIV-1 factors acting at the early stages of
viral replication. Furthermore, by quantifying differ-
ent forms of viral DNA using qPCR, we determined
that the effect of SAHH is due to its negative influence
on reverse transcription, whereas Hsp60 acts at the
integration step.
MATERIALS AND METHODS
Oligonucleotides were synthesized by the phos-
phoramidite method by Evrogen (Russia) (Table 1).
Small interfering RNAs (siRNAs) were synthe-
sized by the phosphoramidite method by Genterra
(Russia) (Table 2).
Plasmids. Two commercial plasmids were used
in this study: pNL4-3.Luc.R-E (NovoPro, China) and
pCMV-VSVG (Addgene, USA), encoding the genome of
pseudoviral particles with the firefly luciferase report-
er gene and the surface glycoprotein G of the vesicular
stomatitis virus, respectively. For prokaryotic expres-
sion of the GST-tagged recombinant human proteins
SAHH1, SAHH2, and Hsp60, plasmids were construct-
ed on the basis of the pGEX vector (Addgene). For
this purpose, PCR was performed with total cellular
cDNA using primers Hsp60_s and Hsp60_as; SAHH1_s
and SAHH1_as; SAHH2_s and SAHH2_as (Table1), and
Q5 High-Fidelity Polymerases (New England Biolabs,
USA), according to the manufacturer’s instructions.
The resulting PCR products were digested with the
restriction endonucleases FastDigest NdeI and FastDi-
gest XhoI (Thermo Fisher Scientific, USA) and cloned
into the pGEX vector. Sequences of the resulting
pGEX_Hsp60, pGEX_SAHH1, and pGEX_SAHH2 vectors
were confirmed by sequencing.
Production, isolation, and purification of re-
combinant proteins. Recombinant HIV-1 IN was
obtained as described previously [19]. For the pro-
duction of GST-Hsp60, GST-SAHH1, and GST-SAHH2
proteins, competent Escherichia coli BL21-Codon Plus
cells (Agilent, USA) were transformed with 10 ng of
pGEX_Hsp60, pGEX_SAHH1, and pGEX_SAHH2 plas-
mids, respectively. Selected clones were grown in a
2.5% LB medium (Amresco, USA) supplemented with
100 µg/ml ampicillin in 1-liter flasks at 16°C. When
OD
600
reached 0.8, expression was induced by addi-
tion of 0.1mM IPTG, followed by cultivation for 18  h.
Cells were harvested by centrifugation for 30 min at
3000 rpm. Cell pellets were resuspended on ice in a
buffer (20  mM Tris-HCl (pH  8.0), 500  mM NaCl, 2  mM
2-mercaptoethanol, 1  mM  PMSF) at a ratio 10  ml buf-
fer per 1  g of pellet, and exposed to ultrasonication
(3-5  kJ of transmitted energy per 1  g of resuspended
Table 1. Primer sequences used in this study
Primers 5′→3′ primer sequences
Hsp60_s d(AGACTCCATATGCTTCGGTTACCC)
Hsp60_as d(GATCCTCGAGTTATCCGAACATGCCAC)
SAHH1_s d(GCCGATCCATATGTCTGACAAACTGC)
SAHH1_as d(GATCCTCGAGTTATCCGTAGCGGTAG)
SAHH2_s d(GGATCCATATGCCGGGCC)
SAHH2_as d(GATCCTCGAGTTATCCGTAGCGGTAG)
GAPDH_fw d(CCACTCCTCCACCTTTGAC)
GAPDH_rv d(ACCCTGTTGCTGTAGCCA)
Hsp60_fw d(AGCCTTGGACTCATTGAC)
SAHH_fw d(GTGGAGATCGATGTCAAGTG)
SAHH_rv d(CTGGTTGGTGAAGGAGTTAC)
HSP60 AND SAHH IN HIV-1 REPLICATION 1645
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Table 2. siRNA sequences used in this study
siRNAs 5′→3′ oligonucleotide sequences
siC
S: rArGrGrUrCrGrArArCrUrArCrGrGrGrUrCrArAdTdT
AS: rUrUrGrArCrCrCrGrUrArGrUrUrCrGrArCrCrUdTdT
siHsp60
S: rUrGrUrUrGrArArGrGrArUrCrUrUrUrGrArUrAdTdT
AS: rUrArUrCrArArArGrArUrCrCrUrUrCrArArCrAdTdT
siSAHH
S: rCrArGrGrCrUrGrUrArUrUrGrArCrArUrCrArUdTdT
AS: rArUrGrArUrGrUrCrArArUrArCrArGrCrCrUrGdTdT
pellet). Insoluble material was removed by centrifuga-
tion. Lysates were incubated with a glutathione-aga-
rose (Thermo Fisher Scientific, USA) pre-equilibrated
with a buffer for 3 h at 4°C. Glutathione-agarose was
washed with 25 ml of a resuspension buffer. Elution
was performed in two steps: glutathione-agarose was
incubated with an elution buffer (20 mM Tris-HCl (pH
7.5), 500 mM NaCl, 2 mM 2-mercaptoethanol, 50 mM
glutathione) for 30 min at room temperature, the el-
uate was collected, and the procedure was repeated.
Dialysis against a dialysis buffer (20 mM Tris-HCl
(pH  7.6), 500  mM  NaCl, 5%  glycerol, 2  mM  2-mercap-
toethanol) was performed overnight. For storage,
20% glycerol was added to the buffer, and protein
solutions were stored at −80°C. Protein concentration
in the final preparations was quantified by the Brad-
ford assay [20].
Protein co-precipitation. Interaction between
the GST-tagged human proteins and 6×His-tagged IN
was analyzed using protein co-precipitation on glu-
tathione-agarose. Protein pairs were incubated in
200µl of a co-precipitation buffer (20mM HEPES (pH
7.5), 100 mM NaCl, 7.5 mM MgCl
2
, 2 mM 2-mercap-
toethanol, 50  µg/ml  BSA, 0.1%  NP-40) for 1  h at 25°C,
followed by addition of 30 µl glutathione- agarose
pre-equilibrated in the same buffer supplemented
with BSA, and incubation for another hour. Super-
natants were removed, and the agarose was washed
twice with 600 µl of the co-precipitation buffer. Pre-
cipitated proteins were eluted from the agarose by
its incubation in a buffer containing 50 mM Tris-HCl
(pH 6.8), 1% SDS, 10% glycerol, 100 mM 2-mercap-
toethanol, ~0.0025% bromophenol blue at 95°C for
10 min. Proteins were separated with 12% SDS-PAGE
according to Laemmli [21] and analyzed by Western
blot analysis.
Western blot analysis. After SDS-PAGE separa-
tion, proteins were transferred to Immobilon®-PVDF
membranes (Bio-Rad, USA) using the Trans-Blot
Turbo Transfer System (Bio-Rad), (semi-dry transfer).
GST- and 6×His-tagged proteins were detected with
rabbit anti-GST and mouse anti-His antibodies (Sigma,
USA), respectively. Visualization was performed with
HRP-conjugated secondary antibodies: mouse an-
ti-rabbit and goat anti-mouse (Sigma, USA). Detection
was carried out using an HRP Clarity Western ECL
substrate kit (Bio-Rad) and a ChemiDoc MP system
(Bio-Rad).
Culturing human cells. All experiments with hu-
man cells were carried out using the HEK 293T cell
line. Cells were cultured in DMEM medium (PanEco,
Russia) supplemented with 10% FBS, 100 U/ml peni-
cillin, and 100 µg/ml streptomycin (Invitrogen, USA).
To obtain HEK 293T cells with a stably integrated
pseudoprovirus, cells were transduced with pseudo-
viral particles and maintained for one week.
Liposome-mediated siRNA transfection. HEK
293T cells were transfected with siHsp60 and siSAHH
siRNAs, targeting Hsp60 and SAHH mRNAs, respec-
tively, in the presence of GenJect-40 (Molekta, Rus-
sia) according to the manufacturer’s instructions.
As a control, a nonspecific siRNA (siC) was used.
Efficiency of siRNA action was analyzed 48  h after
transfection by qPCR with total cellular cDNA using
a 5X qPCRmix-HS SYBR mix (Evrogen), a Gentier 96
Real-Time Quantitative PCR system (Drawell Scientific,
China), and Hsp60_fw/Hsp60_rv; SAHH_fw/SAHH_rv
primers (Table 1) to assess Hsp60 and SAHH siRNA
levels, respectively. GAPDH_fw and GAPDH_rv prim-
ers (Table 1) were used as an internal control to as-
sess mRNA levels of the GAPDH household gene.
Production of VSV-G-pseudotyped viral par-
ticles. To produce pseudoviral particles, HEK 293T
cells were transfected using the calcium phosphate
method with two plasmids: pNL4-3.Luc.R-E and pC-
MV-VSVG (at a 5  :  1 mass ratio). For transfection of
one T-175 flask (179.5  cm
2
), a total of 90  µg of plas-
mid DNA was used, dissolved in 1969  µl of buffer
(10 mM Tris-HCl (pH  8.0), 1  mM EDTA), 2250  µl of
2×HBS buffer (10 mM HEPES (pH  7.4), 150  mM NaCl),
and 281  µl of 2 M CaCl
2
. After 48  h, the culture medi-
um was collected and replaced with a fresh medium.
FEIGIN et al.1646
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Fig. 1. Co-precipitation of recombinant GST-tagged Hsp60, SAHH1, and SAHH2 proteins (150 nM) with 6×His-tagged HIV-1
IN (75 or 150 nM) on glutathione–agarose.
The harvested medium was centrifuged at 3000 rpm
and supernatants were filtered through a 0.45µm fil-
ter (Membrane Solutions, USA). The filtrate was cen-
trifuged at 56,000g for 1.5  h at 4°C under vacuum.
The resulting pellet was resuspended in PBS buffer
(Gibco, USA) and stored at −80°C. After another 24  h
(72  h after transfection), the medium was collected
again and processed as described above.
Luciferase activity assay in transduced cells.
HEK 293T cells were transduced with pseudoviral par-
ticles 48  h after siRNA transfection. 24  h post-trans-
duction, Photinus pyralis firefly luciferase activity
was measured using the Luciferase Assay System
(Promega, USA) according to the manufacturer’s pro-
tocol. Luminescence was analyzed using the BioTek
SYNERGY H1 multimode reader (Agilent Technologies,
USA). Luminescence in HEK 293T cells with stably
integrated pseudoprovirus was analyzed 48 h after
siRNA transfection.
Relative quantification of HIV-1 DNA forms.
Relative levels of total and integrated HIV-1 DNA were
determined as described previously [22]. Relative ef-
ficiency of post-integration repair of HIV-1 DNA was
assessed as described by Anisenko et al. [23].
Data visualization. Data analysis was performed
using the Microsoft Excel software. Luciferase assay
and MTT assay results were visualized using the
GraphPad Prism 9.5.1 software.
Statistical analysis. All experiments were per-
formed in at least three biological replicates. One-way
ANOVA followed by Dunnett’s test was used for mul-
tiple comparisons.
RESULTS
Interaction of HIV-1 integrase with recombi-
nant Hsp60 and SAHH proteins in  vitro. Interac-
tion of Hsp60 and SAHH with HIV-1 integrase (IN)
observed by Agapkina et al. [17] could have resulted
from either direct or indirect protein interactions due
to the specifics of the method, which was based on
formaldehyde treatment of a cell lysate containing
overexpressed HIV-1 IN, followed by co-immunoprecip-
itation of protein complexes and mass spectrometric
detection of IN-bound proteins. To determine whether
the potential partners interact directly with IN, we
expressed the GST-tagged human proteins (Hsp60 or
one of the two SAHH isoforms) and incubated them
with the 6×His-tagged HIV-1 IN, followed by analysis
of their interaction using an in  vitro co-precipitation
assay. For each of the proteins tested, we observed
co-precipitation of IN at least at one of the concentra-
tions used (Fig. 1). In addition, the amount of co-pre-
cipitated IN increased with increasing concentration
of this protein in solution. No nonspecific binding of
IN to the sorbent was observed in the control sample,
where IN alone was incubated with the resin without
any human protein. These data indicate that the hu-
man Hsp60, SAHH1, and SAHH2 proteins specifically
bind to the HIV-1 IN in vitro.
Effect of Hsp60 and SAHH knockdown on the
HIV-1 replication. Having established that the test-
ed proteins can directly interact with IN, we next
investigated their effect on the HIV-1 replication.
To this end, we performed knockdown of Hsp60 and
SAHH in the HEK 293T cells using siRNA, followed
by transduction with the replication-defective HIV-1-
based pseudovirus particles carrying a firefly lucifer-
ase reporter gene. This system allows assessment of
the knockdown effects on early stages of replication
(reverse transcription, integration, and post-integra-
tion repair), as well as transcription of the integrat-
ed provirus from the HIV-1 LTR promoter. According
to our data, a statistically significant difference was
observed between the reporter activity in the cells
transfected with the control non-specific siRNA (siC)
and the cells transfected with the siRNAs targeting the
mRNAs of the studied proteins (Fig. 2a). Knockdown
of Hsp60 led to the 1.9  ±  0.4-fold increase in the lu-
ciferase signal, while knockdown of SAHH resulted in
the 1.65  ±  0.11-fold increase. Thus, since knockdown
HSP60 AND SAHH IN HIV-1 REPLICATION 1647
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Fig. 2. Effect of Hsp60 or SAHH knockdown on HIV-1 replication in the cells transduced with HIV-1-based pseudoviral parti-
cles(a) and on transcription of the integrated pseudoprovirus(b). Changes in the signal intensity of the luciferase reporter
protein were measured. Statistical significance was determined using Dunnett’s method for multiple comparisons. All exper-
iments were performed in at least four biological replicates. p-value: ns > 0.05 ≥ * > 0.01 ≥ ** > 0.005; ns, non-significant.
of either protein enhanced reporter activity, it could
be concluded that Hsp60 and SAHH act as negative
regulators of the HIV-1 replication cycle.
Effect of Hsp60 and SAHH knockdown on provi-
rus transcription. Since the signal in our pseudoviral
system depends not only on the early stages of HIV-1
replication, but also on the proviral transcription ef-
ficiency, we performed an additional experiment in
which cells were first transduced with pseudoviral
particles and, after the completion of all early replica-
tion stages, knockdown of SAHH and Hsp60 was car-
ried out and reporter signal was measured. This ap-
proach allows identification of the knockdown effect
separately on the stage of proviral transcription from
the HIV-1 LTR promoter. According to our data, knock-
down of these proteins had no statistically significant
effect on pseudoprovial transcription (Fig. 2b). Thus,
the reduced intracellular levels of Hsp60 and SAHH
affect specifically the early stages of HIV-1 replication,
highlighting importance of their interaction specifical-
ly with IN during these stages.
Relative quantification of HIV-1 DNA forms.
To further investigate the mechanism through which
Hsp60 and SAHH impact the HIV-1 life cycle, we
examined the effect of their knockdown on reverse
transcription, integration, and post-integration re-
pair by determining the relative levels of different
HIV-1 DNA forms [22,  23]. This method is based on
quantification of the total, integrated, and repaired
forms of viral DNA produced as a result of reverse
transcription, integration, and post-integration repair,
respectively. The DNA levels were measured using
quantitative PCR (Fig. 3). The knockdown of SAHH
led to the 1.47  ±  0.14-fold increase in total HIV-1 DNA,
whereas the knockdown of Hsp60 had no visible ef-
fect (Fig.  3a). At the same time, knockdown of both
Hsp60 and SAHH equally affected the level of inte-
grated DNA, resulting in the 1.6  ±  0.3-fold increase
(Fig. 3b). No statistically significant effects of the
protein knockdown on relative post-integration repair
efficiency were observed (Fig. 3c).
DISCUSSION
Hsp60 is the chaperone family protein, its pri-
mary function is to partially unfold proteins in an
ATP-dependent manner, and to facilitate their refold-
ing into the correct native conformation [24]. It is
well established that under stress conditions the level
of cellular expression of Hsp60 is markedly increased,
accompanied by the parallel rise in the number of
cell proteins associated with it [25]. Our findings on
the direct interaction of Hsp60 with IN are consistent
with the previously published data obtained with the
yeast model [18]. Notably, Hsp60 is a predominantly
mitochondrial protein (up to 85% of the total pool is
normally localized in mitochondria), but it has also
been detected in the cytoplasm, on the outer mito-
chondrial membrane, within cytoplasmic vesicles and
secretory granules, in the nucleus, and even on the
outer surface of the plasma membrane [26, 27]. Since
the HIV-1 replication does not involve mitochondria,
it is reasonable to assume that viral replication is
affected precisely by this minor non-mitochondrial
fraction of Hsp60. It has been reported that in certain
FEIGIN et al.1648
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
Fig. 3. Effect of Hsp60 or SAHH knockdown on the relative levels of different HIV-1 DNA forms: total (a), integrated (b),
and repaired(c). Statistical significance was determined using Dunnett’s method for multiple comparisons. All experiments
were performed in at least three biological replicates. p-value: ns > 0.05; 0.01 ≥ ** > 0.005.
infectious diseases the fraction of non-mitochondrial
Hsp60 may increase substantially and play an import-
ant role in the immune response [28], although such
an effect has not been demonstrated for HIV-1.
As reported by Parissi etal. [18], the Hsp60 bind-
ing site was identified between the residues 48 and
212 of IN, i.e., within its central catalytic domain.
Moreover, experiments with the recombinant proteins
revealed that the addition of small amounts of Hsp60
stimulated the catalytic activity of IN in both 3′-pro-
cessing and strand transfer reactions [18]. The stron-
gest stimulatory effect was observed at a 10-20-fold
excess of IN relative to Hsp60; increasing Hsp60 con-
centration reduced its stimulatory effect, and at the
Hsp60/IN ratio of 1  :  3.5, complete inhibition of both
IN catalytic activities was observed, most likely due
to excessively strong binding of Hsp60 to the catalyt-
ic domain of IN. We suggest that the negative effect
of Hsp60 on HIV-1 integration observed in our more
physiologically relevant cell system (Fig. 3b) could be
explained by functional inhibition of IN through its
interaction with Hsp60.
S-adenosylhomocysteine hydrolase (SAHH) is
the only mammalian enzyme catalyzing hydrolysis
of S-adenosylhomocysteine into L-homocysteine and
adenosine [29]. It is one of the most conserved en-
zymes across living organisms (found in eukaryotes,
archaea, and bacteria) [30, 31]. Deletion of the corre-
sponding gene is embryonically lethal in many spe-
cies [32, 33], while mutations in the human ortholog
often result in the severe disorders and early death
[33, 34]. SAHH was initially considered to be a cyto-
plasmic enzyme, but later was shown to accumulate
in significant amounts in the nucleus [35], predomi-
nantly in the actively transcribed chromatin regions,
where it colocalizes with RNA polymerase II.
Several examples of the influence of SAHH in-
hibitors on viral replication have been documented:
negative effect on the Rous sarcoma virus in chicken
embryo cells [36], suppression of the human cytomeg-
alovirus replication in embryonic lung fibroblasts[37],
as well as reduced cytopathic effects of the cowpox
virus, vesicular stomatitis virus, parainfluenza vi-
rus, reovirus type 1, herpes simplex virus, and oth-
ers [38]. Evidence also exists for a negative effect of
SAHH inhibitors on HIV-1 transcription in HeLa cells,
whereas no similar effect was observed in human
lymphocyte and macrophage cultures [39]. Converse-
ly, another study demonstrated that 3-deazaadenos-
ine analogs (SAHH inhibitors) effectively suppressed
HIV-1 replication in peripheral blood mononuclear
cells [40]. Despite these pronounced antiviral prop-
erties of SAHH inhibitors, such findings should be
interpreted with caution for two following reasons.
First, SAHH inhibitors exert systemic effects on the
cell by altering both DNA and RNA methylation pro-
files, complicating interpretation and often leading to
inconsistent results across different cell lines. Second,
their broad spectrum of activity most likely reflects
a low specificity of their influence on HIV-1 replica-
tion. The effect we observed is opposite in nature: the
SAHH knockdown enhances pseudovirus replication
efficiency, and this effect is unrelated to the tran-
scription stage. This finding indicates importance of
the interaction between HIV-1 IN and SAHH, since IN
functions at the early stages of the replication cycle
HSP60 AND SAHH IN HIV-1 REPLICATION 1649
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
but not in the stage of proviral transcription. Direct
interaction between HIV-1 IN and RT was reported
[41], in addition, certain IN mutations that disrupt
this interaction negatively affected reverse transcrip-
tion [42, 43]. SAHH interaction with IN is assumed
to interfere with the proper IN–RT interaction, which
explains the effect of SAHH knockdown on the total
HIV-1 DNA level observed in our experiments. Nota-
bly, the increase in the integrated DNA level upon the
SAHH knockdown was proportional to the increase
in the total viral DNA produced during reverse tran-
scription, indicating that the SAHH knockdown affects
specifically reverse transcription, but not integration.
CONCLUSION
Integrase is one of the key enzymes of HIV-1 re-
quired for successful completion of the early stages
of the viral replicative cycle. During replication, IN
interacts with numerous host cellular factors that in-
fluence replication efficiency. We demonstrated that
the previously identified potential partners of IN –
Hsp60, SAHH1, and SAHH2 – indeed interact direct-
ly with it in  vitro. Furthermore, we established that
these proteins act as negative regulators of the viral
replication cycle, since their depletion results in the
enhanced replication efficiency. Our data indicate that
the observed effects occur at the early stages of viral
replication in which IN is involved, and do not affect
transcription of the integrated provirus. Moreover, we
found that the role of Hsp60 is critical at the integra-
tion stage of HIV-1, whereas SAHH exerts its influence
at the reverse transcription stage. Further studies of
the mechanisms by which these proteins affect HIV-1
replication could be valuable both for advancing our
understanding of the virus–host interactions and for
developing novel approaches to HIV therapy.
Abbreviations
HIV-1 human immunodeficiency virus type 1
IN HIV-1 integrase
siRNA small interfering RNAs
RT reverse transcriptase
Hsp60 Heat Shock Protein 60
SAHH S-adenosylhomocysteine hydrolase
Acknowledgments
Isolation and analysis of the relative amounts of dif-
ferent forms of HIV-1 DNA were performed by quan-
titative PCR using a Gentier 96 Real-Time Quantitative
PCR amplifier, an AllSheng Fluo-800 fluorimeter, and a
Bioer GenePure Pro automated nucleic acid extraction
and purification station, acquired under the Develop-
ment Program of Lomonosov Moscow State University
(PNR5.13).
Contributions
M.B.G. and S.P.K. developed the concept and super-
vised the study; T.F.K., S.P.K., and S.E.F. conducted the
experiments; Yu.Yu.A., A.N.A., M.B.G., and S.P.K. dis-
cussed the study results; S.P.K. and S.E.F. prepared the
manuscript; M.B.G. edited the manuscript.
Fundings
This work was financially supported by the Russian
Science Foundation (project no.22-14-00073-P).
Ethics approval and consent to participate
This work does not contain any studies involving hu-
man and animal subjects.
Conflict of interest
The authors of this work declare that they have no
conflicts of interest.
Open access
This article is licensed under a Creative Commons
Attribution 4.0 International License, which permits
use, sharing, adaptation, distribution, and reproduc-
tion in any medium or format, as long as you give
appropriate credit to the original author(s) and the
source, provide a link to the Creative Commons li-
cense, and indicate if changes were made. The images
or other third party material in this article are includ-
ed in the article’s Creative Commons license, unless
indicated otherwise in a credit line to the material.
If material is not included in the article’s Creative
Commons license and your intended use is not permit-
ted by statutory regulation or exceeds the permitted
use, you will need to obtain permission directly from
the copyright holder. To view a copy of this license,
visit http://creativecommons.org/licenses/by/4.0/.
REFERENCES
1. Brito, A. F., and Pinney, J. W. (2017) Protein-pro-
tein interactions in virus-host systems, Front. Mi-
crobiol., 8, 1557, https://doi.org/10.3389/fmicb.2017.
01557.
2. Martinez-Gil,L., Vera-Velasco, N.M., and Mingarro,I.
(2017) Exploring the human-Nipah virus protein-pro-
tein interactome, J. Virol., 91, e01452-17, https://
doi.org/10.1128/JVI.01461-17.
3. Loregian, A., Marsden, H. S., and Palu, G. (2002)
Protein-protein interactions as targets for antiviral
chemotherapy, Rev. Med. Virol., 12, 239-262, https://
doi.org/10.1002/rmv.356.
4. Markovic, V., Szczepanska, A., and Berlicki, L. (2024)
Antiviral protein-protein interaction inhibitors,
J. Med. Chem., 67, 3205-3231, https://doi.org/10.1021/
acs.jmedchem.3c01543.
FEIGIN et al.1650
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
5. Phanuphak, N., and Gulick, R. M. (2020) HIV treat-
ment and prevention 2019: current standards of care,
Curr. Opin. HIV AIDS, 15, 4-12, https://doi.org/10.1097/
COH.0000000000000588.
6. Iversen, A. K., Shafer, R. W., Wehrly, K., Winters,
M. A., Mullins, J. I., Chesebro, B., and Merigan, T. C.
(1996) Multidrug-resistant human immunodeficiency
virus type 1 strains resulting from combination an-
tiretroviral therapy, J. Virol., 70, 1086-1090, https://
doi.org/10.1128/jvi.70.2.1086-1090.1996.
7. Shafer, R.W., Winters, M.A., Palmer,S., and Merigan,
T.C. (1998) Multiple concurrent reverse transcriptase
and protease mutations and multidrug resistance of
HIV-1 isolates from heavily treated patients, Ann.
Intern. Med., 128, 906-911, https://doi.org/10.7326/
0003-4819-128-11-199806010-00008.
8. Kozal,M., Aberg,J., Pialoux,G., Cahn,P., Thompson,M.,
Molina, J. M., Grinsztejn, B., Diaz, R., Castagna, A.,
Kumar, P., Latiff, G., DeJesus, E., Gummel, M.,
Gartland, M., Pierce, A., Ackerman, P., Llamoso, C.,
and Lataillade, M. (2020) Fostemsavir in adults
with multidrug-resistant HIV-1 infection, N. Engl.
J. Med., 382, 1232-1243, https://doi.org/10.1056/
NEJMoa1902493.
9. Hiryak, K., and Koren, D. E. (2021) Fostemsavir: a
novel attachment inhibitor for patients with multi-
drug-resistant HIV-1 infection, Ann. Pharmacother.,
55, 792-797, https://doi.org/10.1177/1060028020962424.
10. Beccari, M. V., Mogle, B. T., Sidman, E. F., Mastro,
K. A., Asiago-Reddy, E., and Kufel, W. D. (2019) Ibal-
izumab, a novel monoclonal antibody for the man-
agement of multidrug-resistant HIV-1 infection, An-
timicrob. Agents Chemother., 63, e00110-19, https://
doi.org/10.1128/AAC.00110-19.
11. Blair, H. A. (2020) Ibalizumab: a review in multi-
drug-resistant HIV-1 infection, Drugs, 80, 189-196,
https://doi.org/10.1007/s40265-020-01258-3.
12. Segal-Maurer, S., DeJesus, E., Stellbrink, H. J.,
Castagna, A., Richmond, G. J., Sinclair, G. I.,
Siripassorn, K., Ruane, P. J., Berhe, M., Wang, H.,
Margot, N.A., Dvory-Sobol,H., Hyland, R.H., Brainard,
D. M., Rhee, M. S., Baeten, J. M., and Molina, J. M.
(2022) Capsid inhibition with lenacapavir in multi-
drug-resistant HIV-1 infection, N.Engl. J. Med., 386,
1793-1803, https://doi.org/10.1056/NEJMoa2115542.
13. Tekeste, S. S., Wilkinson, T. A., Weiner, E. M., Xu, X.,
Miller, J. T., Le Grice, S. F., Clubb, R. T., and Chow,
S.A. (2015) Interaction between reverse transcriptase
and integrase is required for reverse transcription
during HIV-1 replication, J. Virol., 89, 12058-12069,
https://doi.org/10.1128/JVI.01471-15.
14. Brown, P. O. (1990) Integration of retroviral DNA,
Curr. Top. Microbiol. Immunol., 157, 19-48, https://
doi.org/10.1007/978-3-642-75218-6_2.
15. Anisenko, A. N., Knyazhanskaya, E. S., Zalevsky,
A. O., Agapkina, J. Y., Sizov, A. I., Zatsepin, T. S., and
Gottikh, M. B. (2017) Characterization of HIV-1 in-
tegrase interaction with human Ku70 protein and
initial implications for drug targeting, Sci. Rep., 7,
5649, https://doi.org/10.1038/s41598-017-05659-5.
16. Rozina, A., Anisenko, A., Kikhai, T., Silkina, M.,
and Gottikh, M. (2022) Complex relationships be-
tween HIV-1 integrase and its cellular partners,
Int.J. Mol. Sci., 23, 12341, https://doi.org/10.3390/
ijms232012341.
17. Agapkina, Y. Y., Ponomareva, T. Y., Vdovina, M. V.,
Ziganshin, R. H., Rozina, A. A., Anisenko, A. N., and
Gottikh, M. B. (2025) New cellular partners of HIV-1
integrase and their role in viral replication, Dokl. Bio-
chem. Biophys., 522, 279-284, https://doi.org/10.1134/
S1607672925600149.
18. Parissi,V., Calmels,C., De Soultrait, V.R., Caumont,A.,
Fournier, M., Chaignepain, S., and Litvak, S. (2001)
Functional interactions of human immunodeficiency
virus type 1 integrase with human and yeast HSP60,
J. Virol., 75, 11344-11353, https://doi.org/10.1128/JVI.
75.23.11344-11353.2001.
19. Leh, H., Brodin, P., Bischerour, J., Deprez, E., Tauc,P.,
Brochon, J.-C., LeCam,E., Coulaud,D., Auclair,C., and
Mouscadet, J. F. (2000) Determinants of Mg
2+
-depen-
dent activities of recombinant human immunode-
ficiency virus type 1 integrase, Biochemistry, 39,
9285-9294, https://doi.org/10.1021/bi000398b.
20. Bradford, M. M. (1976) A rapid and sensitive meth-
od for the quantitation of microgram quantities of
protein utilizing the principle of protein-dye binding,
Anal. Biochem., 72, 248-254, https://doi.org/10.1016/
0003-2697(76)90527-3.
21. Laemmli, U.K. (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophageT4,
Nature, 227, 680-685, https://doi.org/10.1038/227680a0.
22. Vandergeeten, C., Fromentin, R., Merlini, E., Lawani,
M. B., DaFonseca, S., Bakeman, W., McNulty, A.,
Ramgopal, M., Michael, N., Kim, J. H., Ananworan-
ich, J., and Chomont, N. (2014) Cross-clade ultrasen-
sitive PCR-based assays to measure HIV persistence
in large-cohort studies, J. Virol., 88, 12385-12396,
https://doi.org/10.1128/JVI.00609-14.
23. Anisenko, A. N., Knyazhanskaya, E. S., Isaguliants,
M. G., and Gottikh, M. B. (2018) A qPCR assay for
measuring the post-integrational DNA repair in HIV-1
replication, J. Virol. Methods, 262, 12-19, https://
doi.org/10.1016/j.jviromet.2018.09.004.
24. Bukau, B., and Horwich, A. L. (1998) The Hsp70
and Hsp60 chaperone machines, Cell, 92, 351-366,
https://doi.org/10.1016/S0092-8674(00)80928-9.
25. Martin,J., Horwich, A.L., and Hartl, F. U. (1992) Pre-
vention of protein denaturation under heat stress by
the chaperonin Hsp60, Science, 258, 995-998, https://
doi.org/10.1126/science.1359644.
26. Soltys, B. J., and Gupta, R. S. (1996) Immunoelectron
microscopic localization of the 60-kDa heat shock
HSP60 AND SAHH IN HIV-1 REPLICATION 1651
BIOCHEMISTRY (Moscow) Vol. 90 No. 11 2025
chaperonin protein (Hsp60) in mammalian cells,
Exp. Cell Res., 222, 16-27, https://doi.org/10.1006/
excr.1996.0003.
27. Itoh, H., Kobayashi, R., Wakui, H., Komatsuda, A.,
Ohtani, H., Miura, A. B., Otaka, M., Masamune, O.,
Andoh, H., Koyama, K., Sato, Y., and Tashima, Y.
(1995) Mammalian 60-kDa stress protein (chaperonin
homolog): identification, biochemical properties, and
localization, J.Biol. Chem., 270, 13429-13435, https://
doi.org/10.1074/jbc.270.22.13429.
28. Wu,T., Jia,L., Lei,S., Jiang,H., Liu,J., Li,N., Langford,
P. R., Liu, H., and Lei, L. (2022) Host HSPD1 translo-
cation from mitochondria to the cytoplasm induced
by Streptococcus suis serovar 2 enolase mediates
apoptosis and loss of blood-brain barrier integrity,
Cells, 11, 2071, https://doi.org/10.3390/cells11132071.
29. Turner, M.A., Simpson,A., McInnes, R.R., and Howell,
P. L. (1998) Structure determination of selenomethi-
onyl S-adenosylhomocysteine hydrolase using data
at a single wavelength, Nat. Struct. Biol., 5, 369-376,
https://doi.org/10.1038/nsb0598-369.
30. Vizan,P., Di Croce,L., and Aranda,S. (2021) Functional
and pathological roles of AHCY, Front. Cell Dev. Biol.,
9, 654344, https://doi.org/10.3389/fcell.2021.654344.
31. Mushegian, A. R., Garey, J. R., Martin, J., and Liu,
L. X. (1998) Large-scale taxonomic profiling of eu-
karyotic model organisms: a comparison of orthol-
ogous proteins encoded by the human, fly, nema-
tode, and yeast genomes, Genome Res., 8, 590-598,
https://doi.org/10.1101/gr.8.6.590.
32. Dickinson, M. E., Flenniken, A. M., Ji, X., Teboul, L.,
Wong, M. D., White, J. K., Meehan, T. F., Weninger,
W. J., Westerberg, H., Adissu, H., Baker, C. N.,
Bower, L., Brown, J. M., Caddle, L. B., Chiani, F.,
Clary, D., Cleak,J., Daly, M. J., Denegre, J. M., Doe, B.,
Dolan, M. E., Edie, S. M., Fuchs, H., Gailus-Durner, V.,
Galli,A., Gambadoro, A., Gallegos, J., Guo, S., Horner,
N. R., Hsu, C. W., et al. (2016) High-throughput dis-
covery of novel developmental phenotypes, Nature,
537, 508-514, https://doi.org/10.1038/nature19356.
33. Miller, M. W., Duhl, D. M., Winkes, B. M., Arredondo-
Vega,F., Saxon, P.J., Wolff, G.L., Epstein, C.J., Hersh-
field, M. S., and Barsh, G. S. (1994) The mouse lethal
nonagouti (a(x)) mutation deletes the S-adenosylho-
mocysteine hydrolase (Ahcy) gene, EMBOJ., 13, 1806-
1816, https://doi.org/10.1002/j.1460-2075.1994.tb06449.x.
34. Vugrek, O., Beluzic, R., Nakic, N., and Mudd, S. H.
(2009) S-adenosylhomocysteine hydrolase (AHCY) de-
ficiency: two novel mutations with lethal outcome,
Hum. Mutat., 30, E555-E565, https://doi.org/10.1002/
humu.20985.
35. Radomski, N., Kaufmann, C., and Dreyer, C. (1999)
Nuclear accumulation of S-adenosylhomocysteine
hydrolase in transcriptionally active cells during
development of Xenopus laevis, Mol. Biol. Cell, 10,
4283-4298, https://doi.org/10.1091/mbc.10.12.4283.
36. Bader, J. P., Brown, N. R., Chiang, P. K., and Cantoni,
G. L. (1978) 3-Deazaadenosine, an inhibitor of ad-
enosylhomocysteine hydrolase, inhibits reproduc-
tion of Rous sarcoma virus and transformation of
chick embryo cells, Virology, 89, 494-505, https://
doi.org/10.1016/0042-6822(78)90193-4.
37. Snoeck, R., Andrei, G., Neyts, J., Schols, D., Cools, M.,
Balzarini, J., and De Clercq, E. (1993) Inhibitory ac-
tivity of S-adenosylhomocysteine hydrolase inhib-
itors against human cytomegalovirus replication,
Antiviral Res., 21, 197-216, https://doi.org/10.1016/
0166-3542(93)90007-6.
38. De Clercq, E. (2005) John Montgomery’s legacy:
carbocyclic adenosine analogues as SAH hydrolase
inhibitors with broad-spectrum antiviral activity,
Nucleosides Nucleotides Nucleic Acids, 24, 1395-1415,
https://doi.org/10.1080/15257770500265638.
39. Daelemans, D., Este, J. A., Witvrouw, M., Panne-
couque, C., Jonckheere, H., Aquaro, S., Perno, C. F.,
De Clercq, E., and Vandamme, A. M. (1997) S-ade-
nosylhomocysteine hydrolase inhibitors interfere
with the replication of human immunodeficiency
virus type 1 through inhibition of the LTR trans-
activation, Mol. Pharmacol., 52, 1157-1163, https://
doi.org/10.1124/mol.52.6.1157.
40. Mayers, D. L., Mikovits, J. A., Joshi, B., Hewlett, I. K.,
Estrada, J. S., Wolfe, A. D., Garcia, G. E., Doctor,
B. P., Burke, D. S., and Gordon, R. K. (1995) Anti-hu-
man immunodeficiency virus 1 (HIV-1) activities of
3-deazaadenosine analogs: increased potency against
3′-azido-3′-deoxythymidine-resistant HIV-1 strains,
Proc. Natl. Acad. Sci. USA, 92, 215-219, https://
doi.org/10.1073/pnas.92.1.215.
41. Wu, X., Liu, H., Xiao, H., Conway, J. A., Hehl, E.,
Kalpana, G. V., Prasad, V., and Kappes, J. C. (1999)
Human immunodeficiency virus type 1 integrase
protein promotes reverse transcription through
specific interactions with the nucleoprotein re-
verse transcription complex, J. Virol., 73, 2126-
2135, https://doi.org/10.1128/JVI.73.3.2126-2135.1999.
42. Engelman, A., Englund, G., Orenstein, J. M., Martin,
M. A., and Craigie, R. (1995) Multiple effects of mu-
tations in human immunodeficiency virus type 1 in-
tegrase on viral replication, J. Virol., 69, 2729-2736,
https://doi.org/10.1128/JVI.69.5.2729-2736.1995.
43. Leavitt, A. D., Robles, G., Alesandro, N., and Varmus,
H. E. (1996) Human immunodeficiency virus type 1
integrase mutants retain in vitro integrase activity
yet fail to integrate viral DNA efficiently during in-
fection, J. Virol., 70, 721-728, https://doi.org/10.1128/
JVI.70.2.721-728.1996.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in published
maps and institutional affiliations. AI tools may have
been used in the translation or editing of this article.