Article

ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 8, pp. 1077-1087 © The Author(s) 2025. This article is an open access publication.

Published in Russian in Biokhimiya, 2025, Vol. 90, No. 8, pp. 1177-1188.

1077

Autoregulation of YB-1 Synthesis in Cells

Valeria S. Kachan

, Irina A. Eliseeva

, Andrey I. Buyan

, and Dmitry N. Lyabin

2,a

Laboratory of Experimental and Cellular Medicine, Moscow Institute of Physics and Technology,

141701 Dolgoprudny, Moscow Region, Russia

Group of Protein Biosynthesis Regulation, Institute of Protein Research, Russian Academy of Sciences,

142290 Pushchino, Moscow Region, Russia

e-mail: lyabin@vega.protres.ru

Received May 22, 2025

Revised July 4, 2025

Accepted July 18, 2025

Abstract— The Y-box binding protein 1 (YB-1) plays a crucial role in regulating essential cell functions, includ-

ing transcription, translation, and DNA repair, through its interactions with nucleic acids and multiple protein

partners. The multifunctionality of YB-1 makes the control of its levels critical for cellular homeostasis and

adaptation to stress. The synthesis of YB-1 is regulated by gene transcription, protein stability (mediated by

long non-coding RNAs), and translation of its mRNA. Autoregulation of YB-1 mRNA translation remains the

topic of ongoing debate. Some earlier in vitro studies suggested a role of the 5′ untranslated region (UTR)

in inhibiting protein synthesis, while others demonstrated the importance of YB-1 binding to the 3′ UTR for

reducing translation. This disagreement has been further complicated by the absence of evidence for these

mechanisms in living cells. Here, we provide the first direct evidence that YB-1 represses its synthesis in

cultured human cells. Using metabolic protein labeling and immunoprecipitation, we confirmed the effect

of YB-1 on the translation of its mRNA. Experiments with reporter constructs showed that both UTRs of the

YB-1 mRNA are involved in autoregulation, thus resolving the contradiction in the literature. These results

highlight a sophisticated mechanism for controlling YB-1 levels, which requires both 5′ and 3′ UTRs of the

YB-1 mRNA, and confirm their role in fine-tuning YB-1 synthesis.

DOI: 10.1134/S0006297925601571

Keywords: YB-1, translation regulation, mRNA

* To whom correspondence should be addressed.

INTRODUCTION

The Y-box binding protein 1 (YB-1) performs nu-

merous functions in the cell via interaction with nu-

cleic acids and binding to multiple partner proteins

[1, 2]. It is involved in the regulation of transcription

of a large set of genes and the control of both global

translation and specific regulation of translation of a

fairly large number of mRNAs. Additionally, it partic-

ipates in DNA repair, metabolism of small non-cod-

ing RNAs, alternative splicing, and some other cellu-

lar events (see reviews [1-3] and references therein).

This functional diversity ultimately determines the

important role of YB-1 in cell proliferation, differen-

tiation, apoptosis, etc. [1, 3, 4]. Notably, YB-1 plays a

specific role in oncogenesis, as cancer cells use its

diverse functions for their survival and adaptation to

challenging conditions [5, 6].

Strict control over the YB-1 amount in the cell is

essential for the normal cell life and survival under

stress. The regulation of the YB-1 gene transcription is

one of the options to control the YB-1 levels. It typical-

ly happens during cell differentiation, when one set

of transcription factors is replaced by another, thus

reducing the YB-1 mRNA synthesis [7]. Additionally,

the stability of YB-1 protein can be regulated by long

non-coding RNAs (for example, see [7]). However, for

precise adjustment of the YB-1 level, controlling the

translation of YB-1 mRNA is likely the most crucial

factor.

Though it has long been known that YB-1 regu-

lates the translation of its mRNA [8-10], the knowl-

edge of the regulatory mechanism remains sparse,

and the available data are somewhat contradictory.

KACHAN et al.1078

BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025

For example, according to Fukuda etal. [8], the 5′un-

translated region (UTR) of YB-1 mRNA is important

for autoregulation because preincubation of the YB-1

protein with luciferase reporter mRNA containing

the 5′  UTR of YB-1 mRNA leads to the inhibition of

luciferase synthesis in a cell-free translation system.

On the other hand, in a series of our studies [9-11],

we showed that YB-1 synthesis is inhibited by its spe-

cific binding to the 3′  UTR of YB-1 mRNA.

A controversial point in the work of Fukuda et

al. is that the site found within the 5′  UTR of YB-1

mRNA seems to be absent from natural YB-1 mRNAs

in most cell lines (for details, see [7]). Furthermore,

both these studies were conducted in cell-free transla-

tion systems, and the results have not been confirmed

ex vivo. The evidence for the autoregulation of YB-1

synthesis in cells could be provided by an experiment

with expressed exogenous tag-labeled YB-1 whose

presence should suppress the synthesis of endogenous

YB-1, thus reducing its amount. However, numerous

experiments of this type reported no decrease in the

amount of endogenous protein (see Fig.  4 in  [12];

Fig.  1 in  [13], and Fig.  1 in [14]), which might have

been due to the following reasons. Firstly, it is quite

difficult to ensure the long-term high expression of

YB-1 from a plasmid. As reported, the most frequently

achieved increase in the YB-1 amount is twofold, i.e.,

1  :  1 relative to the endogenous protein, which may

be insufficient to strongly inhibit the translation of

the YB-1 mRNA. Secondly, the high stability of YB-1

(according to our data, its half-life is ~60  h, see Fig.S1

in the Online Resource  1) may cause only a slight

change in the amount of endogenous protein during

the experiment (which is typically 48 h long), even

if synthesis is decreased. Thirdly, such experiments

show changes not in the level of YB-1 synthesis, but

only in the amount of protein, which, along with the

YB-1 mRNA translation, depends on the YB-1 mRNA

synthesis and stability of the protein itself.

In this work, we used metabolic labeling of cel-

lular proteins followed by immunoprecipitation with

anti-YB-1 antibodies to provide the first direct evi-

dence for the effect of YB-1 on its synthesis in cul-

tured human cells. Also, using reporter constructs,

we demonstrated that both 5′ and 3′  UTRs of the YB-1

mRNA are required for the autoregulation of YB-1

synthesis in cultured cells.

MATERIALS AND METHODS

Cell cultures. HEK293T∆YB-1 and HEK-

293T∆YB-1+YB-1 cells were described previously [15].

HeLa cells were kindly provided by Elena Nadezhdina

(Institute of Protein Research, Russian Academy of Sci-

ences). HEK293T cells were cultured in plastic dish-

es (Corning, USA) in Dulbecco Modified Eagle Me-

dium (DMEM) (Capricorn, Germany) supplemented

with 10% fetal calf serum (Hyclone, USA; Capricorn),

100  U/ml penicillin, and 100μg/ml streptomycin (Pan-

Eco, Russia; ServiceBio, China). HeLa cells were cul-

tured similarly, except that the medium was DMEM/

F12 (Capricorn). The cells were incubated in a CO

incubator at 37°C in a humidified atmosphere con-

taining 5%  CO

. As the cells grew, they were periodi-

cally reseeded after pre-treatment with trypsin-EDTA

(PanEco) to detach them from the plastic.

Transient transfection of cells was performed us-

ing Lipofectamine 3000 (Invitrogen, USA) according to

the manufacturer’s recommendations.

Analysis of YB-1 synthesis levels in cultured

cells using metabolic labeling. For [

S]-methionine

labeling, the cells were cultured in 35-mm dish-

es in L-methionine-free DMEM supplemented with

0.1  mCi/ml L-[

S]-methionine (Perkin Elmer, USA,

1000  Ci/mmol) for 1-2  h. The cells were then washed

with PBS and lysed with 400  μl of buffer containing

20  mM  Hepes-KOH, pH  7.6, 100  mM  KCl, 5  mM  MgCl

2  mM  DTT, 0.25%  Nonidet P-40, 0.2% SDS, and prote-

ase inhibitor cocktail (Roche, Switzerland). Cell ex-

tracts were cleared by centrifugation at 10,000g for

15 min and incubated with anti-YB-1 antibodies (rat

polyclonal antibodies against the 14-a.a. C-terminal

peptide of YB-1; IMTEK, Russia) and 20  μl of Protein

G-sepharose (GE Healthcare, USA) equilibrated with

the lysis buffer for 2  h at 4°C. After extensive washing

with PBS (6 times with 500  µl each), proteins were

eluted with the acid-urea sample solution (8  M urea,

5% acetic acid, 0.025% methylene blue) and analyzed

by acid-urea 10% polyacrylamide gel electrophoresis.

To detect radiolabeled proteins, the dried gel was

exposed to an intensifying screen followed by detec-

tion using a Cyclone®Storage PhosphorSystem (Pack-

ard Instrument Company Inc.). The relative amount

of radioactivity was determined using the OptiQuant

(ver. 03.00) software.

Immunoblotting. Proteins were transferred onto

a nitrocellulose membrane (Cytiva, USA) using an

electrophoretic transfer chamber and transfer buffer

(25  mM  Tris-HCl, pH  8.7, 90  mM  glycine, 10%  isopro-

panol, 0.1%  SDS). To prevent non-specific adsorption,

the membrane was incubated in TBS (10  mM  Tris-HCl,

pH  7.6, 150  mM NaCl) containing 5% dry fat-free milk

for 1h at room temperature. The membrane was then

incubated in TBS-T (10  mM  Tris-HCl, pH  7.6, 150  mM

NaCl, 0.05% Tween-20) containing 5% BSA and pri-

mary antibodies against YB-1 (Y0396; Sigma-Aldrich,

USA; dilution, 1  :  10000) or rps6 (2217S; Cell Signaling

Technology, USA; dilution, 1  :  10000) for 16-20h at 4°C.

The membrane was washed three times with TBS-T

and incubated in TBS-T containing 5% dry fat-fee milk

and secondary anti-rabbit IgG antibodies conjugated

AUTOREGULATION OF YB-1 SYNTHESIS IN CELLS 1079

BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025

Table 1. Sequences of primers used in the work

Primer Sequence (5′→3′)

F1 TGGTGGCGCGTCGCGCCG

R1 ATGGTCTTCACACTCGAAGATTTCGTTGG

F2 TGGCGGGACAGGCGGGATAAG

R2 ATGGTCTTCACACTCGAAGATTTCGTTGG

F3 CGGCGCGACGCGCCACCATTCTCGCTAGTTCGATCGGTAGCGG

R3 ATCTTCGAGTGTGAAGACCATGGTTGCGGTGATGGTGACTGGGG

F4 CTTATCCCGCCTGTCCCGCCACCCTTTAGCTGCCATCTTGCGTC

R4 ATCTTCGAGTGTGAAGACCATCGCCTTCCTCTCCTCCTCTGC

F5 GCTGTTCCGAGTAACCATCAAC

R5 GGTCCATACCGCTTTCTTGTG

F6 GGATTACCAGGGATTTCAGTCGATG

R6 GTTTTGTCACGATCAAAGGACTCTGGTAC

F7 ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGCAGTG GTATCAACGCAGAGT

R7 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGT CCATACCGCTTTCTTGTG

with horseradish peroxidase (A9169; Sigma-Aldrich;

dilution, 1  :  10000) for 1  h at room temperature. Next,

the membrane was washed 3 times in TBS-T for 5min

each. Proteins were detected using an Amersham ECL

Plus Western Blotting Detection System kit (Cytiva) ac-

cording to the manufacturer’s instructions.

Plasmid constructs. The pNL2.2 YB-1pr_YB-1_

NlucP_YB-1, pNL2.2 ACTBpr_BTF3_NlucP_BTF3, and

pNL2.2 ACTBpr_BTF3_Fluc_BTF3 plasmids were ob-

tained previously [15, 16]. The digestion of these

plasmids with the restriction endonucleases EcoRI and

BamHI produced the fragments containing 3′ UTRs of

the YB-1 and BTF3 (basic transcription factor 3) mRNAs

and vectors containing the YB-1 or ACTB (beta-actin)

promoter, the 5′  UTR of the YB-1 or BTF3 mRNAs, and

NlucP cDNA. Ligation of the obtained fragments into

the vectors yielded the pNL2.2 YB-1pr_YB-1_NlucP_

BTF3 and pNL2.2 ACTBpr_BTF3_NlucP_YB-1 plasmids.

The F1/R1 and F2/R2 primer pairs (Table 1) and

the above plasmids were used to generate the pNL2.2

YB-1pr_NlucP_BTF3, ACTBpr_NlucP_BTF3, pNL2.2

YB-1pr_NlucP_YB-1, and ACTBpr_NlucP_YB-1 vectors

that were assembled by SLIC (sequence and ligation

independent cloning) using the sequences containing

the 5′  UTRs of the YB-1 or BTF3 mRNAs. These se-

quences were obtained by PCR with the F3/R3 (YB-1

5′  UTR) and F4/R4 (BTF3 5′  UTR) primers (Table  1)

on the pNL2.2 YB-1pr_YB-1_NlucP_YB-1 and pNL2.2

ACTBpr_BTF3_NlucP_BTF3 plasmids, respectively.

The resultant plasmids were pNL2.2 YB-1pr_BTF3_

NlucP_BTF3, pNL2.2 YB-1pr_BTF3_NlucP_YB-1, pNL2.2

ACTBpr_YB-1_NlucP_YB-1, and pNL2.2 ACTBpr_YB-1_

NlucP_BTF3.

Measurement of luciferase activity in cells. The

next day after transfection with the plasmids encod-

ing luciferases (NlucP/Fluc ratio, 10  :  1), the cells were

reseeded into smaller dishes (to obtain 2 wells in 3

replicates for each cell line). After incubation for 24h,

half of the wells were used for the luciferase activi-

ty assay, and the rest – for the analysis of luciferase

mRNA levels by RT-qPCR.

The activities of NlucP (nanoluciferase with the

PEST sequence) and Fluc (firefly luciferase) were

measured using the Nano-Dual-Glo Luciferase Assay

System (Promega, USA). The cultured cells were lysed

in passive lysis buffer (PLB, Promega) for 10 min at

room temperature, and the enzymatic activity of lu-

ciferases was determined using a GloMax 20/20 lumi-

nometer (Promega).

The translation efficiency of the reporter mRNA

was calculated as the ratio between the NlucP lucif-

erase activity normalized to the activity of Fluc and

the relative amount of the NlucP mRNA normalized to

the amount of the control Fluc mRNA. When calculat-

ing the relative translation efficiency, the translation

efficiency in HEK293T∆YB-1 cells was taken as 100%.

KACHAN et al.1080

BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025

Reverse transcription-quantitative PCR (RT-qPCR).

Total RNA was isolated using a Direct-Zol RNA Micro-

prep kit (Zymo Research, USA) according to the manu-

facturer’s recommendations. One μg of total RNA was

reverse transcribed with Maxima H Minus reverse

transcriptase (Thermo Fisher Scientific, USA) accord-

ing to the manufacturer’s recommendations. qPCR

was performed in a QuantStudio 5 system (Thermo

Fisher Scientific) using the qPCRmix-HS SYBR+

LowROX reaction mixture (Evrogen, Russia). The

reaction mixture (25  μl) contained 0.5  μl of the re-

verse transcription reaction mixture and 0.2  μM of

each primer pair (F5/R5 for NlucP and F6/R6 for

Fluc; Table 1). The following amplification conditions

were used: 5  min at 95°C followed by 35 cycles of

95°C for 10  s, 57°C for 20  s, and 72°C for 10  s. In the

experiments measuring the relative mRNA amounts,

the content of the transcripts was calculated using the

QuantStudio™ Design & Analysis Software (Thermo

Fisher Scientific).

5′  RACE (rapid amplification of cDNA ends).

cDNAs for the 5′  RACE analysis were synthesized us-

ing a Mint RACE cDNA amplification kit (Evrogen)

according to the manufacturer’s recommendations

using the PlugOligo adapter and oligodT

. The first

round of PCR was performed with the NlucP and

PlugOligo-specific primers F7 and R7 (Table 1) carry-

ing additional Illumina adapter sequences. PCR prod-

ucts were purified with SPRIselect beads (NEB, USA)

according to the manufacturer’s recommendations.

The second round of PCR was performed using the

primers from the NEBNext Dual Index Primers Set 1

for Illumina (NEB, USA). PCR products were purified

with SPRIselect beads and sequenced on the Nova-

Seq6000 platform (Illumina) at the Skoltech Research

Facilities Center (Genomics Facilities), Skolkovo Insti-

tute of Science and Technology, Russia. The resulting

reads were processed with cutadapt v. 4.8 [17] to re-

move adapter sequences and 5′  poly-G tracks added

by Mint reverse transcriptase. The mapping of the

reads to pNL2.2 sequences was performed with bwa

mem v.0.7.17 [18]. The cumulative 5′  end coverage of

the reads was calculated with bedtools v. 2.30.0 [19].

Statistical analysis of the experimental data

was carried out using the one- or two-tailed Student’s

t-tests for independent samples in the R software en-

vironment.

RESULTS AND DISCUSSION

Autoregulation of YB-1 synthesis in HeLa cells.

To understand how YB-1 controls its synthesis at the

translation level, we designed an experiment aimed

at elucidating whether increasing the amount of YB-1

in a cell by introducing additional YB-1 synthesized

from a plasmid would reduce the endogenous expres-

sion of YB-1 (Fig.1). Note that we used HeLa cells be-

cause a significant portion of the YB-1 mRNA in these

cells is polysome-associated [20], providing conditions

in which a clear decrease in the protein synthesis

level can be expected in the case of autoregulation.

HeLa cells were transfected with the pcDNA3- HA-YB-1

plasmid encoding hemagglutinin-tagged YB-1 (HA-YB-1)

to distinguish between the exogenous and endogenous

YB-1 and cultured in the presence of [

S]-methionine

after 24 or 48 h.

Importantly, the pcDNA3-HA-YB-1 plasmid did not

encode the UTRs of the YB-1 mRNA; therefore, the

translation of the plasmid-synthesized HA-YB-1 mRNA

should not have been regulated by either endogenous

YB-1 or exogenous HA-YB-1. The expression of the

exogenous HA-YB-1 reached its maximum 24 h after

the transfection (Fig.  1a). The amounts of HA-YB-1

and YB-1 were approximately equal, with no notable

changes in the amount of the latter. However, the syn-

thesis of endogenous YB-1 24  h after the transfection

(Fig.  1, b and c) decreased in the HA-YB-1-express-

ing cells, while the level of total protein synthesis in

these cells remained unchanged. Interestingly, 48  h af-

ter transfection, the synthesis of exogenous HA-YB-1

dropped down to the level of YB-1 synthesis, which

returned to the values observed in the cells that did

not express HA-YB-1. This means that 48h after trans-

fection, the amount of exogenous HA-YB-1 decreased

(Fig.  1a) and was no longer sufficient to inhibit the

synthesis of endogenous YB-1. This decrease might

have been caused by the inability of HeLa cells to

efficiently replicate the pcDNA3 plasmid. Accordingly,

an approximately twofold decrease in the amount of

exogenous HA-YB-1 could be expected after roughly

one cell division cycle, as shown in Fig. 1a.

The effect of YB-1 on the translation of re-

porter mRNAs containing the 5′ and 3′  UTRs of the

YB-1 mRNA in HEK293T cells. A drawback of the

above-described experiment is the inability to reveal

the role of the YB-1 mRNA UTRs in the regulation of

translation of this mRNA by YB-1. This problem can

be solved by using plasmid constructs encoding a re-

porter gene (NlucP in our case) flanked by the UTRs

of the YB-1 mRNA or some control mRNA (here, BTF3

mRNA) (Fig.  2a). It is important to use the plasmids,

because in the case of cell transfection with mRNAs,

a significant fraction of these mRNAs remains inactive

within the liposomal particles [21]. Also, we used a

modified nanoluciferase that contained an instabili-

ty element (PEST domain) that reduced its half-life

to 15 min [16]. This allows measuring the amount of

protein synthesized within a certain time interval,

which, together with the known amount of NlucP

mRNA, indicates the level of mRNA from which this

protein was synthesized. Therefore, we were able

AUTOREGULATION OF YB-1 SYNTHESIS IN CELLS 1081

BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025

Fig. 1. The autoregulation of YB-1 synthesis in HeLa cells. a) The content of YB-1 (endogenous) and HA-YB-1 (exogenous)

proteins in HeLa cells transfected with pcDNA3-HA-YB-1 or pcDNA3-HA 24 and 48 h after transfection was analyzed by

immunoblotting with anti-YB-1 antibodies (1). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading

control. Band intensities for endogenous (YB-1) and exogenous (HA-YB-1) proteins (2). b) The levels of synthesis of en-

dogenous (YB-1) and exogenous (HA-YB-1) proteins were determined by metabolic protein labeling with [

S]-methionine

followed by YB-1 immunoprecipitation(1). All samples contained the same amount of total protein (2). c) Relative levels of

YB-1 protein synthesis as determined from the radioactivity of the YB-1-corresponding bands in the autoradiograph shown

in panel b (2). The level of YB-1 synthesis in the cells transfected with pcDNA3-HA was taken as 100%. The values are

shown as means ±2 standard deviations(SD) from three independent experiments. The two-tailed Student’s t-test was used

to assess the statistical significance of differences; **  p  <  0.01; ***  p  <  0.005; #  statistically insignificant.

to determine the translation efficiency of the report-

er mRNA. The results were normalized against the

translation of the control RNA. Note that the YB-1 and

ACTB promoters were used as the reporter gene pro-

moters in the pNL2.2 plasmids (Fig.  2a).

To demonstrate the effect of YB-1 on the trans-

lation of reporter mRNAs, two types of cells should

be used – with low or no YB-1 and with the normal

YB-1 level. Accordingly, we used HEK293TΔYB-1 cells

in which the synthesis of endogenous YB-1 was

blocked using the CRISPR/Cas9 genome editing system,

and HEK293TΔYB-1+YB-1 cells stably expressing YB-1

at a level comparable to that of endogenous protein

in normal HEK293T cells (Fig. 2b). These cells were

transfected with pNL2.2 plasmids encoding the NlucP

mRNAs with the 5′ and 3′  UTRs from the YB-1 and/

or BTF3 mRNAs under control of the YB-1 or ACTB

promoters. As an internal control, we introduced

KACHAN et al.1082

BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025

Fig. 2. Genetic constructs and cell lines used in the study. a)pNL2.2 plasmids encoding the reporter NlucP mRNAs containing

a combination of UTRs from the YB-3 and BTF3 mRNAs and pNL2.2BTF3_Fluc_BTF3 plasmid encoding the Fluc mRNA (inter-

nal control) that were used for the transfection of HEK293TΔYB-1 and HEK293TΔYB-1+YB-1 cells. b)Analysis of YB-1 content

in HEK293T, HEK293TΔYB-1, and HEK293TΔYB-1+YB-1 cells. Rps6 (ribosomal protein S6) was used as a loading control.

Fig. 3. Translation of the NlucP mRNA containing the 5′ and 3′ UTRs from the YB-1 and/or BTF3 mRNA under control of

the YB-1 (a) or ACTB (b) promoters in HEK293TΔYB-1 and HEK293TΔYB-1+YB-1 cells. Twenty-four hours after transfection

with the pNL2.2 plasmids (Fig. 2a), the cells were harvested and divided into two fractions. Total RNA isolated from one

fraction were used for measuring the amounts of NlucP and Fluc mRNAs by RT-qPCR. Cells from the other fraction were

used for determining the activities of NlucP and Fluc. The relative level of NlucP translation was calculated as the NlucP

activity normalized to the amount of mRNA. The level of translation in HEK293TΔYB-1 cells is taken as 100%. c) Same

as(a) and(b), except that the graph shows the absolute values of the translation level. The values shown are as means ±SD

from three independent experiments. The one-tailed Student’s t-test was used to assess statistical significance; *  p  <  0.05,

**  p  <  0.01, ***  p  <  0.001; #  statistically insignificant.

AUTOREGULATION OF YB-1 SYNTHESIS IN CELLS 1083

BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025

Fig.  4. Analysis of the transcription start sites from the pNL2.2 plasmids in HEK293TΔYB-1 and HEK293TΔYB-1+YB-1

cells. The cells were transfected with the pNL2.2-YB-1_YB-1-NlucP-YB-1, pNL2.2-YB-1_BTF3-NlucP-BTF3, pNL2.2-ACTB_YB-1-

NlucP-YB-1, and pNL2.2-ACTB_BTF3-NlucP-BTF3 plasmids. After 24h, total RNA was isolated from the cells, and the 5′ ends

of the reporter mRNAs were analyzed by 5′ RACE.

a plasmid encoding the Fluc mRNA with the 5′ and

3′  UTRs from the BTF3 mRNA along with the pNL2.2

plasmid.

After 24 h of culturing, RNA was isolated from a

fraction of cells to measure the amount of synthesized

NlucP and Fluc mRNAs, while the remaining cells

were used to measure the activity of NlucP and Fluc

luciferases. The activity of the former was normalized

to the Fluc activity (internal control); the amount of

the NlucP mRNA was normalized to the amount of

the Fluc mRNA.

Figure 3a shows that upon the restoration of the

YB-1 amount in the cells, the decrease in the trans-

lation efficiency of the NlucP mRNA containing both

UTRs of the YB-1 mRNA was much stronger (~3-fold)

than that of the reporter mRNA with the UTRs from

the control BTF3 mRNA (~1.3-fold). The presence of

either of the reporter mRNAs containing solely the

5′ or 3′  UTR of the YB-1 mRNA was insufficient for

the suppression of mRNA translation by YB-1 to the

same extent as when both UTRs from the YB-1 mRNA

were used. Although the translation of the reporter

mRNA with the YB-1 mRNA 5′  UTR was more sensitive

to YB-1, both UTRs of the YB-1 mRNA were required

for the efficient regulation of the YB-1 mRNA trans-

lation by YB-1 (Fig. 3a).

Interestingly, the use of plasmid constructs with

the reporter genes under control of the ACTB pro-

moter produced the same results (Fig. 3b). The great-

est sensitivity of translation to the presence of YB-1

was observed for the reporter mRNA with both UTRs

of the YB-1 mRNA, although the effect was less pro-

nounced.

This observation may have different explanations.

The start of the mRNA sequence containing the YB-1

mRNA 5′  UTR and the YB-1 promoter corresponds to

the start of the main transcription site for HEK293T

cells, according to the FANTOM project [22] and the

dbTSS database [23]: the length of the YB-1 mRNA

5′ UTR is 140 nucleotides. The use of the ACTB pro-

moter increases the 5′  UTR sequence by 9 nucleotides

at the 5′  end (Fig.4, Fig.S2 in the Online Resource1).

KACHAN et al.1084

BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025

Fig. 5. The content of NlucP mRNA containing 5′ and 3′ UTRs from the YB-1 and/or BTF3 mRNAs synthesized from the YB-1

or ACTB promoters in HEK293TΔYB-1 and HEK293TΔYB-1+YB-1 cells. The amounts of mRNAs are taken from Fig.3. The level

of NlucP mRNA in HEK293TΔYB-1 cells was considered as 1. The results shown are the means ±SD of three independent

experiments. The one-tailed Student’s t-test was used to assess statistical significance; ***  p  <  0.001.

Similarly, the length of the BTF3 mRNA 5′  UTR upon

the use of the ACTB promoter increases from 221 to

228 nucleotides. This slight extension may affect the

regulation of its translation by the YB-1 protein. An

alternative and more probable explanation is that

mRNAs synthesized from different promoters might

be modified differently or recruit different sets of

RNA-binding proteins, which ultimately affects the ef-

ficiency of its translation and regulation. For example,

as reported recently, a promoter can affect not only

the efficiency of transcription, but also the efficiency

of translation [24].

The latter explanation is indirectly supported

by the fact that the translation level (translation

per RNA in absolute values) of mRNAs synthesized

from the ACTB promoter was significantly higher

than that of mRNAs synthesized from the YB-1 pro-

moter (Fig. 3c).

Another important fact about the effect of YB-1

on the synthesis or amount of its mRNA is that during

the YB-1 synthesis, the amount of reporter mRNA de-

creased, which may indicate a negative effect of YB-1

on transcription not only from the YB-1 promoter, but

also from the ACTB promoter (Fig. 5). The effect of

YB-1 on transcription has long been reported [1], but

this might have been a non-specific effect on the over-

all transcription, probably, due to the YB-1 involve-

ment in the regulation of many genes participating in

transcription. Nevertheless, it cannot be ruled out that

both the YB-1 and ACTB promoters can be YB-1-regu-

lated in certain situations, which requires additional

studies.

CONCLUSION

Taken together, the above facts provide evidence

for the existence of the autoregulation of YB-1 syn-

thesis in cultured mammalian cells. We can also state

that both 5′ and 3′  UTRs of the YB-1 mRNA mediate

the inhibitory effect of YB-1 on its translation. Previ-

ously, in vitro experiments showed that removal of

the regulatory element from the YB-1 mRNA 3′  UTR

is sufficient to eliminate the inhibitory effect of YB-1

[11]. Still, the situation may be more complicated

in cultured eukaryotic cells, where the YB-1 mRNA

5′  UTR has been shown to participate in the autoreg-

ulation of YB-1 synthesis [8].

Presumably, the spatial proximity of the 5′ and

3′  UTRs of the YB-1 mRNA can allow YB-1, through its

specific interaction with the regulatory element in the

3′  UTR, to influence the initiation of the YB-1 mRNA

translation. Presumably, such proximity can be pro-

vided by proteins interacting with both UTRs of this

mRNA. Also, it cannot be ruled out that YB-1 itself

interacts simultaneously with the 5′ and 3′  UTRs of

the YB-1 mRNA. Besides, in many mRNAs, the 5′ and

3′  ends are close to each other due to the secondary

structure architecture [25]. This suggests that the

5′  UTR of the YB-1 mRNA might be in proximity to

the 3′  UTR, thereby contributing to the effect of the

3′  UTR-bound YB-1 on translation. In any case, the

5′  UTR of the YB-1 mRNA is likely an element pro-

viding an increased sensitivity of the YB-1 mRNA

translation to YB-1, while the 3′  UTR serves as a YB-1

carrier.

AUTOREGULATION OF YB-1 SYNTHESIS IN CELLS 1085

BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025

The discussion on the inhibitory effect of YB-1 on

its synthesis cannot ignore a surprising fact recent-

ly reported by Wang et al. [26] who found that the

5′  UTR of the YB-1 mRNA participates in the regulation

of its translation. Overexpression of Flag-YB-1 from a

plasmid in glioblastoma cells stimulated the synthe-

sis of both endogenous YB-1 and a reporter mRNA

containing the YB-1 mRNA 5′  UTR. This suggests that

the effect of YB-1 on the translation of its mRNA can

vary depending on the cellular context and, probably,

other proteins interacting with the YB-1 mRNA UTRs.

However, it cannot be ruled out that the properties of

Flag-YB-1 used by Wang et al. were altered due to a

high negative charge of the Flag tag (more precisely,

3xFlag tag) that could interact with or block positively

charged amino acid residues of the YB-1 C-terminal

domain.

Some other proteins interacting with the YB-1

mRNA UTRs may also be involved in the regulation

of translation of the YB-1 mRNA in the cells. For ex-

ample, involvement of the poly(A)-binding protein

(PABP) and heterogeneous nuclear ribonucleoprotein

Q (hnRNP Q) in this process has been shown invitro

[11, 27]. Therefore, the mechanism of regulation of

the YB-1 mRNA translation by YB-1 requires further

investigation.

Abbreviations

ACTB beta-actin;

BTF3 basic transcription factor3;

Fluc firefly luciferase;

NlucP

nanoluciferase with the PEST se-

quence;

UTR untranslated region;

YB-1 Y-box binding protein1.

Supplementary information

The online version contains supplementary material

available at https://doi.org/10.1134/S0006297925601571.

Acknowledgments

We thank the staff of the Skoltech Research Facilities

Center (Genomics Facilities), Skolkovo Institute of Sci-

ence and Technology, Russia, for help with the library

quality assessment, basic analysis of bioinformatics

data, and sequencing on the NovaSeq6000 platform.

We thank E. Serebrova for help in manuscript prepa-

ration.

Contributions

D.N.L. developed the study concept and supervised the

study; D.N.L., I.A.E., V.S.K., and A.I.B. conducted the ex-

periments; D.N.L. and I.A.E. validated the data; D.N.L.

wrote the text of the article; I.A.E. edited the manu-

script.

Funding

This work was performed under the State Assign-

ment of the Ministry of Science and Higher Education

of the Russian Federation (Structural and Functional

Studies of Proteins and Macromolecular Complexes,

no. 125011500317-6; experiments on the YB-1 mRNA

translation in cells) and supported by the Russian

Science Foundation (project no. 19-74-20129; 5′ RACE

analysis of reporter mRNAs).

Ethics approval and consent to participate

This work does not contain any studies involving hu-

man or animal subjects.

Conflict of interest

The authors of this work declare that they have

noconflicts of interest.

Open access

This article is licensed under a Creative Commons At-

tribution4.0 International License, which permits use,

sharing, adaptation, distribution, and reproduction

in any medium or format, as long as you give appro-

priate credit to the original author(s) and the source,

provide a link to the Creative Commons license, and

indicate if changes were made. The images or other

third party material in this article are included in the

article’s Creative Commons license, unless indicated

otherwise in a credit line to the material. If material is

not included in the article’s Creative Commons license

and your intended use is not permitted by statutory

regulation or exceeds the permitted use, you will need

to obtain permission directly from the copyright hold-

er. To view a copy of this license, visit http://creative-

commons.org/licenses/by/4.0/.

REFERENCES

1. Eliseeva, I.A., Kim, E.R., Guryanov, S.G., Ovchinnikov,

L.P., and Lyabin, D.N. (2011) Y-box-binding protein1

(YB-1) and its functions, Biochemistry (Moscow), 76,

1402-1433, https://doi.org/10.1134/S0006297911130049.

2. Mordovkina,D., Lyabin, D.N., Smolin, E.A., Sogorina,

E.M., Ovchinnikov, L.P., and Eliseeva,I. (2020) Y-Box

binding proteins in mRNP assembly, translation,

and stability control, Biomolecules, 10, 591, https://

doi.org/10.3390/biom10040591.

3. Lyabin, D. N., Eliseeva, I. A., and Ovchinnikov, L. P.

(2014) YB-1 protein: functions and regulation, Wiley

Interdiscip. Rev. RNA, 5, 95-110, https://doi.org/10.1002/

wrna.1200.

4. Lindquist, J. A., and Mertens, P. R. (2018) Cold shock

proteins: from cellular mechanisms to pathophysiol-

ogy and disease, Cell Commun. Signal., 16, 63, https://

doi.org/10.1186/s12964-018-0274-6.

KACHAN et al.1086

BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025

5. Alkrekshi,A., Wang,W., Rana, P.S., Markovic,V., and

Sossey-Alaoui, K. (2021) A comprehensive review of

the functions of YB-1 in cancer stemness, metastasis

and drug resistance, Cell Signal., 85, 110073, https://

doi.org/10.1016/j.cellsig.2021.110073.

6. Johnson, T.G., Schelch,K., Mehta,S., Burgess,A., and

Reid, G. (2019) Why be one protein when you can

affect many? Themultiple roles of YB-1 in lung can-

cer and mesothelioma, Front. Cell. Dev. Biol., 7, 221,

https://doi.org/10.3389/fcell.2019.00221.

7. Eliseeva, I.A., Sogorina, E.M., Smolin, E.A., Kulakovs-

kiy, I. V., and Lyabin, D. N. (2022) Diverse regulation

of YB-1 and YB-3 abundance in mammals, Biochem-

istry (Moscow), 87, S48-S167, https://doi.org/10.1134/

S000629792214005X.

8. Fukuda,T., Ashizuka,M., Nakamura,T., Shibahara,K.,

Maeda, K., Izumi, H., Kohno, K., Kuwano, M., and

Uchiumi,T. (2004) Characterization of the 5′-untrans-

lated region of YB-1 mRNA and autoregulation of

translation by YB-1 protein, Nucleic Acids Res., 32,

611-622, https://doi.org/10.1093/nar/gkh223.

9. Skabkina, O. V., Lyabin, D. N., Skabkin, M. A., and

Ovchinnikov, L. P. (2005) YB-1 autoregulates trans-

lation of its own mRNA at or prior to the step of

40S ribosomal subunit joining, Mol. Cell. Biol., 25,

3317-3323, https://doi.org/10.1128/MCB.25.8.3317-

3323.2005.

10. Skabkina, O. V., Skabkin, M. A., Lyabin, D. N., and

Ovchinnikov, L. P. (2004) P50/YB-1, a major pro-

tein of cytoplasmic mRNPs, regulates its own syn-

thesis, Dokl. Biochem. Biophys., 395, 93-95, https://

doi.org/10.1023/b:dobi.0000025554.28703.bf.

11. Lyabin, D. N., Eliseeva, I. A., Skabkina, O. V., and

Ovchinnikov, L.P. (2011) Interplay between Y-box-bind-

ing protein 1 (YB-1) and poly(A) binding protein

(PABP) in specific regulation of YB-1 mRNA trans-

lation, RNA Biol., 8, 883-892, https://doi.org/10.4161/

rna.8.5.16022.

12. Ha,B., Lee, E.B., Cui,J., Kim,Y., and Jang, H.H. (2015)

YB-1 overexpression promotes a TGF-beta1-induced

epithelial-mesenchymal transition via Akt activation,

Biochem. Biophys. Res. Commun., 458, 347-351, https://

doi.org/10.1016/j.bbrc.2015.01.114.

13. Kim, E. R., Selyutina, A. A., Buldakov, I. A.,

Evdokimova,V., Ovchinnikov, L.P., and Sorokin, A.V.

(2013) The proteolytic YB-1 fragment interacts with

DNA repair machinery and enhances survival during

DNA damaging stress, Cell Cycle, 12, 3791-3803,

https://doi.org/10.4161/cc.26670.

14. Lyabin, D. N., Eliseeva, I. A., Smolin, E. A., Doronin,

A. N., Budkina, K. S., Kulakovskiy, I. V., and Ovchin-

nikov, L. P. (2020) YB-3 substitutes YB-1 in glob-

al mRNA binding, RNA Biol., 17, 487-499, https://

doi.org/10.1080/15476286.2019.1710050.

15. Lyabin, D. N., Smolin, E. A., Budkina, K. S., Eliseeva,

I.A., and Ovchinnikov, L.P. (2021) Towards the mech-

anism(s) of YB-3 synthesis regulation by YB-1, RNA

Biol., 18, 1630-1641, https://doi.org/10.1080/15476286.

2020.1859243.

16. Eliseeva,I., Vasilieva,M., and Ovchinnikov, L.P. (2019)

Translation of human beta-actin mRNA is regulat-

ed by mTOR pathway, Genes (Basel), 10, 96, https://

doi.org/10.3390/genes10020096.

17. Martin,M. (2011) Cutadapt removes adapter sequenc-

es from high-throughput sequencing reads, EMBnetJ.,

17, 10-12, https://doi.org/10.14806/ej.17.1.200.

18. Li,H. (2013) Aligning sequence reads, clone sequences

and assembly contigs with BWA-MEM, arXiv, https://

doi.org/10.48550/arXiv.1303.3997.

19. Quinlan, A. R. (2014) BEDTools: the Swiss-army tool

for genome feature analysis, Curr. Protoc. Bioinfor-

matics, 47, 11.12.11-11.12.34, https://doi.org/10.1002/

0471250953.bi1112s47.

20. Lyabin, D. N., Eliseeva, I. A., and Ovchinnikov, L. P.

(2012) YB-1 synthesis is regulated by mTOR signaling

pathway, PLoS One, 7, e52527, https://doi.org/10.1371/

journal.pone.0052527.

21. Barreau, C., Dutertre, S., Paillard, L., and Osborne,

H. B. (2006) Liposome-mediated RNA transfection

should be used with caution, RNA, 12, 1790-1793,

https://doi.org/10.1261/rna.191706.

22. FANTOM Consortium and the RIKEN PMI and CLST

(DGT) (2014) Apromoter-level mammalian expression

atlas, Nature, 507, 462-470, https://doi.org/10.1038/

nature13182.

23. Suzuki, A., Kawano, S., Mitsuyama, T., Suyama, M.,

Kanai, Y., Shirahige, K., Sasaki, H., Tokunaga, K.,

Tsuchihara, K., Sugano, S., Nakai, K., and Suzuki, Y.

(2018) DBTSS/DBKERO for integrated analysis of

transcriptional regulation, Nucleic Acids Res., 46,

D229-D238, https://doi.org/10.1093/nar/gkx1001.

24. Peterman, E.L., Ploessl, D.S., Love, K.S., Sanabria,V.,

Daniels, R.F., Johnstone, C.P., Godavarti, D.R., Kabaria,

S.R., Oakes, C.G., Pai, A.A., and Galloway, K.E. (2025)

High-resolution profiling reveals coupled transcrip-

tional and translational regulation of transgenes, Nu-

cleic Acids Res., 53, gkaf528, https://doi.org/10.1093/

nar/gkaf528.

25. Lai, W.C., Kayedkhordeh,M., Cornell, E.V., Farah,E.,

Bellaousov,S., Rietmeijer,R., Salsi,E., Mathews, D.H.,

and Ermolenko, D. N. (2018) mRNAs and lncRNAs

intrinsically form secondary structures with short

end-to-end distances, Nat. Commun., 9, 4328, https://

doi.org/10.1038/s41467-018-06792-z.

26. Wang, J.Z., Zhu,H., You,P., Liu,H., Wang, W.K., Fan,X.,

Yang,Y., Xu,K., Zhu,Y., Li,Q., Wu,P., Peng,C., Wong,

C.C., Li,K., Shi,Y., Zhang,N., et al. (2022) Upregulated

YB-1 protein promotes glioblastoma growth through

a YB-1/CCT4/mLST8/mTOR pathway, J.Clin. Invest.,

https://doi.org/10.1172/JCI146536.

27. Lyabin, D. N., Nigmatullina, L. F., Doronin, A. N.,

Eliseeva, I. A., and Ovchinnikov, L. P. (2013) Identi-

AUTOREGULATION OF YB-1 SYNTHESIS IN CELLS 1087

BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025

fication of proteins specifically interacting with YB-1

mRNA 3′ UTR and the effect of hnRNP Q on YB-1

mRNA translation, Biochemistry (Moscow), 78, 651-

659, https://doi.org/10.1134/S0006297913060102.

Publisher’s Note. Pleiades Publishing remains

neutral with regard to jurisdictional claims in published

maps and institutional affiliations. AI tools may have

been used in the translation or editing of this article.