Article

ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 7, pp. 911-920 © Pleiades Publishing, Ltd., 2025.

Russian Text © The Author(s), 2025, published in Biokhimiya, 2025, Vol. 90, No. 7, pp. 993-1003.

911

Effect of Cultivation Conditions

on the Expression of the Exiguobacterium sibiricum

Proteorhodopsin Gene

Lada E. Petrovskaya

1,2,a

*, Elena V. Spirina

, Artemiy Yu. Sukhanov

Elena A. Kryukova

, Evgeniy P. Lukashev

, Rustam H. Ziganshin

Elizaveta M. Rivkina

, Dmitrii A. Dolgikh

1,5

, and Mikhail P. Kirpichnikov

1,5

Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences,

117997 Moscow, Russia

Moscow Institute of Physics and Technology, 141701 Dolgoprudny, Moscow Region, Russia

Institute of Physicochemical and Biological Problems in Soil Science, Russian Academy of Sciences,

142290 Pushchino, Moscow Region, Russia

FRC Kazan Scientific Center, Russian Academy of Sciences, 420111 Kazan, Russia

Faculty of Biology, Lomonosov Moscow State University, 119991 Moscow, Russia

e-mail: lpetr65@yahoo.com

Received March 28, 2025

Revised May 25, 2025

Accepted May 28, 2025

Abstract— Recombinant proteorhodopsin ESR of the gram-positive bacterium Exiguobacterium sibiricum iso-

lated from permafrost deposits in northeastern Siberia binds retinal and acts as a light-dependent proton

pump, but not much is known about its expression under natural conditions. In this work, expression of the

esr gene in E. sibiricum cultures grown under various conditions was studied by quantitative PCR. It has

been discovered that cultivation on poor media at low temperatures contributes to a significant increase in

the content of the corresponding mRNA. The data obtained are confirmed by the results of the analysis of

the membrane fraction of cells using label-free quantitative chromatography-mass spectrometry. Also, at 10°C,

increased content of phytoene desaturases, which are involved in the biosynthesis of carotenoids, is observed.

However, we were unable to detect the presence of a functional retinal-containing protein in the cells, pre-

sumably due to the lack of an enzymatic retinal synthesis system in E.  sibiricum. The possible functions of

ESR in E.  sibiricum cells are discussed in connection with the characteristics of the extreme habitat of the

bacterium. The results of this study contribute to expanding the understanding of the molecular mechanisms

of microbial adaptation to environmental conditions and the potential role of microbial rhodopsins in these

processes.

DOI: 10.1134/S0006297925600917

Keywords: Exiguobacterium sibiricum, permafrost deposits, microbial rhodopsins, retinal, carotenoids

* To whom correspondence should be addressed.

INTRODUCTION

One of the primary types of energy on our planet

is the energy of sunlight, which various green plants

and photosynthetic microorganisms use to maintain

metabolic processes. Recently, a lot of attention has

been attracted by the contribution of microorganisms

containing rhodopsin-like proteins to the accumula-

tion and transformation of solar energy [1, 2]. Mi-

crobial rhodopsins are integral membrane proteins

consisting of seven alpha-helical segments and con-

taining a retinal cofactor in the all-trans configura-

tion [3, 4]. Absorption of a quantum of light results

in retinal molecule isomerization from the all-trans to

the 13-cis state. Subsequent conformational changes

in the protein are accompanied by various functional

PETROVSKAYA etal.912

BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025

events, such as ion transport or sensory signal trans-

mission [5]. As a result of transmembrane proton

transfer, proton-motive force is generated and ATP is

synthesized, which is then used by cells to meet their

energy needs [6].

Coding sequences of potential retinal proteins

have been found in the genomes of microorganisms

inhabiting various ecological niches, including salt

and fresh water bodies, ice, plant leaves, etc. [7-10].

It has been established that the presence of rhodop-

sins allows microbial cells to survive in unfavorable

environmental conditions, particularly in the case of

a lack of nutrients [11-13]. Thus, the genomes of al-

most half of the marine microorganism species con-

tain genes of potential microbial rhodopsins [14, 15].

Genes of rhodopsin-like proteins have been found in

many psychrotrophic and psychrophilic microorgan-

isms[16,17], as well as in the analysis of metagenom-

ic DNA isolated from natural samples of cold habitats,

mainly of aquatic origin [18-20]. In rare cases, the

presence of rhodopsins has been described in repre-

sentatives of soil microbial communities, for example,

in the dry valleys of Antarctica [20].

Previously, we have obtained and studied the ret-

inal protein of the gram-positive soil bacterium Ex-

iguobacterium sibiricum (ESR), isolated from perma-

frost deposits of northeastern Siberia (age – 3 million

years)[21]. ESR belongs to the proteorhodopsin family,

carries out light-dependent proton transport [22] and

has a number of structural and functional features

that distinguish it from homologous proteins and

make it an interesting study object [23-28]. It should

be noted that the abovementioned studies were car-

ried out using a recombinant protein, therefore, the

functions and regulation of ESR expression in E.  sibir-

icum cells remain unexplored.

In this work, we aimed to investigate the expres-

sion of the esr gene in the culture of E.  sibiricum cells

grown under various conditions and identify the fac-

tors contributing to an increased level of proteorho-

dopsin synthesis in cells.

MATERIALS AND METHODS

The study utilized reagents from Bio-Rad (USA),

Merck (USA), Panreac (Spain); components of bacteri-

al culture media (Difco, USA); organic solvents from

Khimmed (Russia). The solutions were prepared using

MilliQ deionized water. The E. sibiricum 255-15 strain

was provided by Dr.  T.  A.  Vishnivetskaya.

Cultivation of E.  sibiricum cells. Cells of E.  si-

biricum strain255-15 were stored at –70°C in 1/2 TSB

medium (trypticase soy broth diluted 2-fold with dis-

tilled water) supplemented with 20% glycerol. Frozen

cells were reconstituted on 1/2 TSA (trypticase soy

agar) solid nutrient medium at 30°C. The grown col-

onies were transferred to 50 ml tubes (Corning, USA)

and incubated in 1/2TSB nutrient medium at 30°C for

16h to OD600  ≈  4. The resulting inoculum (10ml) was

added to 1 liter shaker flasks containing 200  ml of

sterile tap water or liquid TSB medium diluted 2 and

10 times with sterile tap water. The final dilution of

the medium was thus 1/2, 1/10, or 1/40 TSB. Cultiva-

tion was carried out under an illumination intensity

of 30 μmol photons m

−2

∙sec

−1

(natural light and fluo-

rescent lamps) under forced aeration (200rpm) on an

Innova shaker (Brunswick, USA) at 10 or 25°C. For in-

cubation in the dark, the flasks were covered with foil.

Membrane fraction isolation. The cells were

centrifuged at 7000g for 10min at 5°C, after which the

pellet was resuspended in a buffer containing 50mM

Tris-HCl (pH 8.0), 5 mM EDTA, 20% sucrose and lyso-

zyme (0.4mg/ml), incubated for 1h and disrupted by

ultrasonication. The suspension was centrifuged for

30 min (6000g, 5°C). The resulting supernatant was

centrifuged for 1 h (100,000g, 5°C) and the membrane

fraction pellet was resuspended in 50 mM Tris-HCl

(pH 8.0).

To remove cytoplasmic protein impurities, 300μl

of a cooled 100 mM Na

solution was added to

100 μl of the suspension, incubated for 1  h with stir-

ring in an ice bath, after which centrifugation at

100,000g and 5°C was repeated. The pellet was resus-

pended in 50 mM Tris-HCl (pH 8.0) and used for sub-

sequent proteomic analysis.

Membrane fraction spectroscopy was performed

after solubilization of the fraction by adding a solu-

tion of n-dodecyl-β-D-maltopyranoside (Anatrace, USA)

to 0.5% and NaCl to 100mM, incubation at room tem-

perature for 3 h and centrifugation (20,000g, 10 min).

The absorption spectrum of the supernatant was ob-

tained using a Hitachi-557 spectrophotometer (Hitachi,

Japan). The Origin 8.1 program was used for multiex-

ponential approximation of the curves.

Changes in absorption per single flash [532  nm;

7 ns duration, 10 mJ pulse energy; YAG-Nd LS-2131M

laser (LOTISTII, Belarus)] were recorded using a flash

photolysis setup with double monochromatization

of the measuring light. Using an Octopus CompuS-

cope 8327 analog-to-digital converter (GaGe, Canada),

100 single signals were accumulated.

Total RNA isolation. Total RNA was obtained

using the ExtractRNA reagent (Evrogen, Russia). E. si-

biricum cells in an amount corresponding to 1 OD

unit at 600 nm were sedimented by centrifugation in

a tabletop centrifuge for 2 min at 10,000g and sus-

pended in 1 ml of the reagent with the addition of

200 μl of a mixture of 150-300 μm and 400-600 μm

glass beads (Sigma-Aldrich, USA). The suspension was

shaken in a Mini Bead Mill (VWR, USA) at the maxi-

mum speed for 1min, then heated for 10min at 70°C.

E.sibiricum PROTEORHODOPSIN GENE EXPRESSION 913

BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025

This treatment was repeated 3 times, ensuring effec-

tive cell destruction and maximum RNA yield.

The subsequent steps were carried out accord-

ing to the protocol of the ExtractRNA manufacturer.

The resulting lysate was centrifuged for 10 min at

15,000g at room temperature, 0.2 ml of chloroform

was added to the supernatant, after which the mix-

ture was incubated for 5 min at room temperature

with periodic shaking. After 15 min centrifugation

(12,000g, 4°C), the upper aqueous phase was collected

and 0.5 ml of 100% isopropanol was added to it, the

mixture was incubated for 10 min at room tempera-

ture, then centrifuged for 10 min at 12,000g. The sed-

iment was washed with 1ml of 75% ethanol and cen-

trifuged at room temperature (20,000g for 5min), then

air-dried and dissolved in 30 μl of RNase-free water.

To remove genomic DNA, the samples were treat-

ed with DNase I (Thermo Fisher Scientific, USA) ac-

cording to the manufacturer’s recommendations, then

the preparation was purified using the CleanRNA

Standard kit (Evrogen). If DNA impurities were de-

tected in the total RNA preparation, additional purifi-

cation was performed using the TURBO DNA-free Kit

(Thermo Fisher Scientific). The concentration of the

obtained RNA was determined using Qubit2.0 (Thermo

Fisher Scientific).

cDNA synthesis and qPCR. RevertAid reverse

transcriptase (Thermo Fisher Scientific) was used for

cDNA synthesis. The reaction mixture (20  μl) included

4μl of 5× buffer, 1 μl of random hexamer primer mix

(Invitrogen, USA), 0.5 μl of RiboLock RNase inhibitor

(Thermo Fisher Scientific), 2 μl of dNTP mix, 1  μl of

enzyme, and 1μg of isolated RNA. The sample was in-

cubated for 10min at room temperature and then for

60 min at 42°C. The reaction was stopped by heating

for 10min at 70°C. The concentration of the obtained

cDNA was determined by using Qubit 2.0.

Quantitative PCR (qPCR) was performed using

a LightCycler 96 PCR analyzer (Roche, Switzerland).

The relative quantitative analysis mode was selected

for measurements; the esr gene fragment was ampli-

fied in the presence of ESR_F1 and ESR_R1 primers.

Fragments of the genes of DNA gyrase, gyrA, and of

the β-subunit of RNA polymerase, rpoB, were ampli-

fied as references using primers gA2F and gA2R, rB1F

and rB1R, respectively. The primers (synthesized by

Evrogen) were selected using the Primer3Plus pro-

gram. The sequences of all the primers used in this

study are given in Table 1.

The stability of reference gene expression was

confirmed using the geNorm test. The reaction mixture

(20  μl) contained 4  μl of the ready-made qPCRmix-HS

SYBR mixture (Evrogen), 8  pM of each primer, and

100 ng of cDNA. The reaction conditions were as fol-

lows: denaturation at 95°C for 5 min; 45 cycles (95°C

for 20 sec; 60°C for 20 sec; 72°C for 20 sec); melt-

ing at 95°C for 10 sec, then at 65°C for 60 sec. All

measurements were performed in three independent

replicates with a negative control (template-free mix-

ture). The absence of genomic DNA impurities in

RNA samples was checked by adding the appropriate

amount of the RNA preparation that had not been

reverse transcribed to the reaction mixture instead

of cDNA. The data were processed using LightCycler

Software 1.1.

Protein hydrolysis with trypsin in solution. An

aliquot of the suspension containing 20 μg of protein

was dried thoroughly in a SpeedVac centrifugal vac-

uum concentrator (Savant, France) and dissolved in

20 μl of a buffer solution containing 100 mM Tris-

HCl (pH 8.5), 1% sodium deoxycholate, 10 mM TCEP

(Tris(2-carboxyethyl)phosphine) and 20 mM 2-CAA

(2-chloroacetamide); heated for 10 min at 85°C and

cooled to room temperature. Trypsin (0.4μg) in 10 μl

of 100mM Tris-HCl (pH8.5) was added to the protein

solution and the mixture was incubated at 37°C over-

night. After incubation, an equal volume of 2% TFA

was added to the reaction mixture and the peptides

were desalted on a laboratory-made SDB-RPS StageTip

microcolumn constructed as described by Rappsilber

et al. [29]. The peptide solution was applied to the

microcolumn by centrifugation at 300g, washed twice

with a solvent mixture (50 μl of 1% TFA, 50 μl eth-

yl acetate), then with 50 μl of 0.2% TFA and eluted

with 60 μl of a solution containing 5% ammonium

hydroxide and 60% acetonitrile in water. The eluate

was dried and stored at −80°C. Before analysis, the

peptides were dissolved in 40μl of a solution contain-

ing 0.1% TFA and 2% acetonitrile in water.

Chromatography-mass spectrometry analysis.

The samples were loaded onto a laboratory-made pre-

column (50  ×  0.1  mm) packed with Reprosil-Pur 200

C18-AQ 5μm sorbent (Dr. Maisch, Germany) in a solu-

tion containing 2% acetonitrile, 98% H

O, 0.1% TFA

at a flow rate of 4.2 μl/min and separated at room

temperature on a fused silica column (300  ×  0.1 mm)

with an emitter manufactured on a P2000 Laser Puller

Table  1. The sequences of the primers used in the study

Primer name 5′→3′ primer sequence

ESR_F1 AATCGACGGTTTTCCAACAG

ESR_R1 TAGATCCAGGCGAAACATCC

gA2F GACGATGATTCCGGTCAACT

gA2R ATTGATTCGGGCATAAGCAG

rB1F GACGTTTCACCGAAACAGGT

rB1R AGGATTTCACGTGCCGTTAC

PETROVSKAYA etal.914

BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025

Fig. 1. The effects of medium composition, illumination (a) and temperature (b) on the esr gene expression level; +NaCl –

with the addition of NaCl up to 30g/liter. Normalization was performed for the expression level under illumination during

growth on 1/40 TSB at 25°C.

(Sutter, USA) and packed with Reprosil-Pur 200 C18-AQ

1.9  μm sorbent (Dr.  Maisch) in the laboratory. Re-

versed-phase chromatography was performed on an

Ultimate 3000 Nano LC System chromatograph (Ther-

mo Fisher Scientific) coupled to an Orbitrap Q Exac-

tive Plus mass spectrometer (Thermo Fisher Scientific)

via a nanoelectrospray source (Thermo Fisher Scien-

tific). For chromatographic separation of peptides, sol-

vent systemsA (99.9%water; 0.1% formic acid) and B

(19.9% water; 0.1% formic acid; 80% acetonitrile) were

used. The peptides were eluted from the column using

a linear gradient: A  →  3% B for 3 min; 3  →  6% B for

2min; 6  →  32%B for 100min; 32  →  50%B for 18min;

50  →  99% B for 0.1 min; 99% B for 3 min; 99 → 3% B

for 0.1 min at a flow rate of 500 nl/min.

Analysis of mass spectrometric data was car-

ried out by using the MaxQuant 2.4.2.0 [30] and

Perseus 2.0.10.0 [31] programs. The Uniprot protein

sequence database (version date 06.2023) was used

to correlate tandem mass spectra with amino acid

protein sequences.

RESULTS

The effect of cultivation conditions on esr gene

expression. To determine the optimal cultivation

mode providing the maximum level of ESR proteor-

hodopsin gene expression in E.  sibiricum cells, the

bacterial culture was grown while varying the follow-

ing parameters: 1)medium composition (TSB nutrient

medium diluted 2, 10, and 40 times with sterile tap wa-

ter); 2) presence/absence of light; 3) presence/absence

of NaCl; 4) temperature (10 and 25°C). It should be

noted that E.  sibiricum cells turned out to be resistant

to standard treatments used in RNA isolation, which

required the development of a special technique for

their destruction. The esr gene expression level was

determined by qPCR; normalization was performed

according to the expression level of the reference

genes gyrA and rpoB.

The experiments demonstrated that the esr gene

expression level was 4 times higher when grown on

1/10 TSB than on 1/2 TSB (data not shown). Cultivation

of E.  sibiricum cells on 1/40 TSB showed that limiting

nutrient resources further increases the content of the

corresponding mRNA. Thus, the esr gene expression

level in the culture grown on 1/40 TSB under natural

light was 30 times higher than in the culture grown

on 1/10TSB, but when grown in the dark, it decreased

by about 3times (Fig.1a). Addition of NaCl to the nu-

trient medium at a concentration of 30g/liter resulted

in a decrease in the expression level by 1.8 times, re-

gardless of the presence or absence of a light source.

It is known that E.  sibiricum is a psychrotrophic

organism with the ability to grow at low ambient tem-

peratures [21, 32]. In the course of this study, it was

established that E.  sibiricum cells retain their viabili-

ty during cultivation on various media for a week at

10°C (Fig.2). We studied the expression of the esr gene

Fig. 2. Growth dynamics of E.  sibiricum on various media

at 10°C.

E.sibiricum PROTEORHODOPSIN GENE EXPRESSION 915

BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025

Fig. 3. Carotenoid synthesis in E. sibiricum cells. Colonies grown on 1/2 TSA plates (a) and the absorption spectrum of

the membrane fraction of cells cultured at 10°C (b). The black line is the experimental curve; the red line is the result

of approximation using Gaussian functions; the corresponding curves are shown in green. The calculated positions of the

absorption maxima are indicated.

in cells cultured at 10°C for seven days on 1/40 TSB

under illumination. Determination of the amount of

mRNA by qPCR showed that the expression level un-

der these conditions increases significantly. After a

week of cultivation at 10°C it is 7 times higher than

the expression level achieved at room temperature

(Fig. 1b).

Spectroscopic analysis of the membrane frac-

tion of E.  sibiricum cells. E. sibiricum cells exhibit a

yellow-orange color during cultivation in liquid and

solid media [21] (Fig. 3a). We isolated the membrane

fraction from cells grown for a week at 10°C and an-

alyzed it using spectroscopic methods. The absorption

spectrum of the membrane fraction solubilized in the

presence of n-dodecyl-β-D-maltopyranoside detergent

contains characteristic peaks indicating the synthesis

of carotenoids (Fig. 3b). Approximation of the curves

showed the presence of absorption maxima at 414,

452, 477, and 506 nm. Previously, the presence of ca-

rotenoids, including lycopene, β-carotene and zeaxan-

thin was demonstrated in extracts of Exiguobacterium

acetylicum, Exiguobacterium auranticum, Exiguobac-

terium profundum [33, 34] and other representatives

of this genus. It should be noted that the maximum

corresponding to proteorhodopsin of E.  sibiricum

(532nm) was not detected in the absorption spectrum.

Also, no light-induced changes in absorption (photocy-

cle) were detected in the studied sample at the wave-

lengths characteristic of ESR mediated by the func-

tional activity of the retinal protein (data not shown).

Proteomic analysis of the membrane fraction

of E.  sibiricum cells. To confirm the obtained data,

we performed a comparative analysis of the mem-

brane fractions of cells grown at 25 and 10°C using la-

bel-free quantitative chromatography-mass spectrom-

etry (high performance liquid chromatography with

tandem mass-spectroscopy, HPLC-MS/MS). A total of

1604 polypeptides were identified, including enzymes,

transporters, components of the secretion system, sen-

sory and other proteins. In particular, the presence of

peptides corresponding to E.  sibiricum rhodopsin was

detected, and the ESR content in the sample obtained

as a result of cultivation at 10°C was 1.57 times high-

er than its content in the sample from cells grown at

room temperature. Also noteworthy is the increased

level of synthesis of phytoene desaturases, which are

involved in the biosynthesis of carotenoids (Exig_0517,

Exig_0735, Exig_0736, and Exig_0738). The content of

these enzymes turned out to be 1.54, 1.81, 2.47, and

2.93 times higher, respectively, in samples of mem-

brane fractions of cells grown at a lower temperature.

DISCUSSION

Permafrost deposits are characterized by a set of

conditions that hinder survival of living organisms

(decreased temperature, low nutrient concentration,

low water activity)[35,36]. A number of studies have

shown that growth of microorganisms (Pelagibacter

ubique, Vibrio sp., etc.) on minimal or highly diluted

media promotes an increase in the expression of rho-

dopsin genes[12, 37, 38]. Similar results were obtained

in our study as well. Growing E.  sibiricum cultures

under resource-limited conditions (on 1/40 TSB) led

to a 30-fold increase in esr gene expression, with illu-

mination promoting a higher expression level, as was

shown, for example, for Dokdonia sp. MED134 [38].

The optimum temperature for E. sibiricum is 36°C,

however, this bacterium is capable of growing in the

temperature range from −2.5 to +40°C[21]. Ithas been

established that at low temperatures, the bacterial cells

PETROVSKAYA etal.916

BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025

Fig. 4. Fragments of the E.sibiricum genomic sequence containing the esr (Exig_1419;a) and phytoene desaturase (Exig_0735–

Exig_0738;b) genes. The data were obtained from the KEGG website, https://www.kegg.jp/genome/T00687. The numbers indi-

cate the locations of genes on the E. sibiricum chromosome.

undergo a significant changes of their gene expres-

sion profile, with many of their genes encoding pro-

teins synthesized only under certain conditions [32].

In this study, we found that a decrease in tempera-

ture to 10°C promotes a significant (7-fold) increase

in the esr gene expression. Oligotrophic environment

and decreased temperature correspond to the condi-

tions observed in the seasonally thawed permafrost

layer in summer, and access to solar energy on the

soil surface is mainly preserved during this season

due to poor vegetation cover. Previously, similar regu-

lation of synthesis was described for xanthorhodopsin

in Sphingomonas glaciales AAP5 from an alpine lake,

which begins to accumulate in cells only at tempera-

tures below 16°C [39].

ESR-specific peptides were detected in the mem-

brane fraction of cells using HPLC-MS/MS analysis.

The protein content was significantly higher in the

sample obtained from the culture grown at a lower

temperature. The lower degree of increase in protein

content compared to the degree of increase in mRNA

content (1.57 and 7 times, respectively) may indicate

differences in the regulation of ESR expression at the

level of transcription and translation.

Despite the obtained data demonstrating the

presence of ESR in E.  sibiricum cells, the absence of

a maximum corresponding to the retinal protein in

the absorption spectrum of the membrane fraction as

well as light-induced absorption (photocycle) changes

suggests that under the studied conditions the cells

do not synthesize retinal, which is necessary for the

formation of functional rhodopsin. The absence of ret-

inal in cells and an increased level of proteorhodopsin

gene synthesis with a low level of blh gene expression

were previously described for a number of Flavobac-

terium strains isolated from glaciers [40].

The coding sequences of rhodopsin-like proteins

are often included in operons that contain genes of

enzymes of the β-carotene and retinal biosynthesis

pathway [41]. Thus, the coding sequence of proteor-

hodopsin (PR) is located before a cluster of six genes

(idi, crtEIBY and blh) responsible for the synthesis

of such enzymes [6]. In the E. sibiricum genome, the

proteorhodopsin gene is not a part of such a cluster

(Fig. 4a). At a significant distance from the esr gene

are the genes of phytoene synthases and phytoene de-

saturases (Fig. 4b), which could potentially carry out

the synthesis of carotenoids[32,41]. However, the gene

for β-carotene-15,15′-dioxygenase (blh), which produc-

es all-trans-retinal from β-carotene, is not detected. It

should be noted that for approximately 28% of E.  si-

biricum proteins, no possible functions could be pre-

dicted due to a lack of homologous sequences in the

databases [32].

Thus, at present, no bioinformatic or experimen-

tal evidence has been obtained proving that E.  sibir-

icum is capable of synthesizing retinal as a cofactor

for proteorhodopsin. The ESR molecule contains a ly-

sine residue, necessary for the formation of a Schiff

base, in a position corresponding to that of homolo-

gous proteins. Heterologous expression of the esr gene

in Escherichia coli cells upon the addition of retinal

is accompanied by its binding with the formation of

a functional holo-form of the protein [22]. It can be

assumed that retinal synthesis by E. sibiricum cells oc-

curs under conditions that could not be reproduced in

our experiment and with the participation of enzymes

that have no homologues among the known proteins.

There is also a hypothetical possibility of using bacte-

rial retinal from the environment, as is probably the

case with the rhodopsins of Saccharibacteria [42] or

Rhodoluna lacicola [43]. However, given the low con-

centration of microbial cells in permafrost sediments,

this option seems unlikely.

An alternative explanation may be the presence

of additional functions of ESR that do not depend on

the presence of retinal and facilitate cell survival un-

der extreme environmental conditions. For example,

the presence of scramblase activity, which improves

biophysical properties of a cell membrane (its fluidity

and membrane potential), was established for prote-

orhodopsin of the psychrophilic bacterium Psychrof-

lexus torquis [44]. Escherichia coli cells that express

this protein demonstrate increased resistance to stress

even in the absence of light and without the addition

of retinal. Increased mobility of membrane lipids could

contribute to maintaining the viability of E.  sibiricum

cells at low temperatures. It is known that increased

synthesis of desaturases is one of the adaptation

mechanisms of psychrophilic microorganisms[45,46].

E.sibiricum PROTEORHODOPSIN GENE EXPRESSION 917

BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025

Fig. 5. A proposed scheme of carotenoid biosynthesis pathways in E.sibiricum cells according to KEGG data, https://www.

kegg.jp/pathway/esi00906. FPP – farnesyl pyrophosphate; GGPP – geranylgeranyl pyrophosphate. The enzymes whose genes

have been identified in the E.sibiricum genome are shown. The lycopene cyclase gene crtY was not found in the genome;

the putative enzyme catalyzing this stage is indicated.

To confirm this hypothesis, further analysis of the

presence of scramblase activity in ESR is proposed.

Along with the increased expression of the esr

gene in bacterial cells at 10°C, we also found an in-

crease in the content of some enzymes involved in

carotenoid synthesis at this temperature. At present,

it has not been experimentally established which ca-

rotenoids are contained in E.  sibiricum cells; how-

ever, based on the presence of coding sequences for

the corresponding enzymes in the genome, it can be

positively stated that lycopene and/or its derivatives

are synthesized (Fig.  5). The enzyme that synthesiz-

es β-carotene (CrtY lycopene cyclase) has not been

identified in the genome of E.  sibiricum and other

representatives of the Exiguobacterium genus; how-

ever, it is known that many of them contain this ca-

rotenoid [33, 34]. It can be assumed that the function

of CrtY in Exiguobacterium cells is performed by phy-

toene synthase Exig_0737 or some other enzyme of

this metabolic pathway. Indeed, enzymes with both ac-

tivities have been found in some microorganisms[47].

Carotenoids are of particular importance for the sur-

vival of cold-adapted bacterial species, as they possess

antioxidant and photoprotective properties, and also

have a cryoprotective effect on membranes, protect-

ing them during repeated freeze-thaw cycles [48-52].

Increased carotenoid synthesis at low temperatures

has been noted in many species of psychrophilic and

psychrotolerant bacteria, including Staphylococcus xy-

losus[51], Sphingobacterium antarcticus[52], etc.[49].

CONCLUSION

In this work, the expression of the proteorho-

dopsin gene of the soil bacterium E.  sibiricum un-

der various conditions was studied for the first time.

It was found that cultivation on a poor medium at

a low temperature promotes a significant increase

in the expression level of ESR and the enzymes of

the carotenoid biosynthesis pathways, which may

reflect the corresponding changes in cell pheno-

types under seasonal thawing of permafrost deposits.

However, we failed to detect the presence of a func-

tional retinal-containing protein in the cells, presum-

ably due to the absence of an enzymatic system for

retinal synthesis in E.  sibiricum. The results of the

study facilitate the development of ideas concern-

ing the molecular mechanisms of microorganism ad-

aptation to extreme environmental conditions and

the possible role of microbial rhodopsins in these

processes.

PETROVSKAYA etal.918

BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025

Abbreviations. ESR, Exiguobacterium sibiricum

proteorhodopsin; TSB, trypticase soy broth.

Contributions. L. E. Petrovskaya, E. M. Rivkina,

D. A. Dolgikh, and M. P. Kirpichnikov – concept and

supervision of the work; E. V. Spirina, E. A. Kryuko-

va, A. Yu. Sukhanov, E. P. Lukashev, R. H. Ziganshin,

and L. E. Petrovskaya – experiments; L. E. Petrovska-

ya, E. P. Lukashev, R. H. Ziganshin, E. M. Rivkina, and

D. A. Dolgikh – discussion of the results of the work;

L. E. Petrovskaya, A. Yu. Sukhanov, E. V. Spirina, and

E. M. Rivkina– writing the text of the paper.

Funding. This work was financially support-

ed by the Russian Science Foundation (project

no. 23-14-00160; qPCR, spectroscopic studies and

proteomic analysis) and by the State Assignment

no. 12204500038-3 “Permafrost deposits and frozen

soils: temperature regime, biota, biogeochemical pro-

cesses, and prospects for ecosystem functioning un-

der global warming” (bacterial cultures acquisition,

RNAisolation).

Ethics approval and consent to participate. This

work does not contain any studies involving human

and animal subjects performed by any of the authors.

Conflict of interest. The authors of this work de-

clare that they have no conflicts of interest.

REFERENCES

1. Rozenberg, A., Inoue, K., Kandori, H., and Béjà, O.

(2021) Microbial rhodopsins: the last two decades,

Annu. Rev. Microbiol., 75, 427-447, https://doi.org/

10.1146/annurev-micro-031721-020452.

2. Pinhassi,J., DeLong, E.F., Béjà,O., González, J.M., and

Pedrós-Alió, C. (2016) Marine bacterial and archaeal

ion-pumping rhodopsins: genetic diversity, physiolo-

gy, and ecology, Microbiol. Mol. Biol. Rev., 80, 929-954,

https://doi.org/10.1128/mmbr.00003-16.

3. Govorunova, E. G., Sineshchekov, O. A., Li, H., and

Spudich, J. L. (2017) Microbial rhodopsins: diversi-

ty, mechanisms, and optogenetic applications, Annu.

Rev. Biochem., 86, 845-872, https://doi.org/10.1146/

annurev-biochem-101910-144233.

4. Gordeliy, V., Kovalev, K., Bamberg, E., Rodriguez-

Valera, F., Zinovev, E., Zabelskii, D., Alekseev, A.,

Rosselli, R., Gushchin, I., and Okhrimenko, I. (2022)

Microbial rhodopsins, in Rhodopsin: Methods and

Protocols (Gordeliy, V. ed) Springer US, New York, NY,

pp.1-52, https://doi.org/10.1007/978-1-0716-2329-9_1.

5. Brown, L.S. (2022) Light-driven proton transfers and

proton transport by microbial rhodopsins – A bio-

physical perspective, Biochim. Biophys. Acta, 1864,

183867, https://doi.org/10.1016/j.bbamem.2022.183867.

6. Martinez,A., Bradley, A.S., Waldbauer, J.R., Summons,

R.E., and DeLong, E.F. (2007) Proteorhodopsin photo-

system gene expression enables photophosphorylation

in a heterologous host, Proc. Nat. Acad. Sci. USA, 104,

5590-5595, https://doi.org/10.1073/pnas.0611470104.

7. Atamna-Ismaeel,N., Finkel, O.M., Glaser,F., Sharon,I.,

Schneider,R., Post, A.F., Spudich, J.L., von Mering,C.,

Vorholt, J. A., Iluz, D., Béjà, O., and Belkin, S. (2012)

Microbial rhodopsins on leaf surfaces of terrestri-

al plants, Environ. Microbiol., 14, 140-146, https://

doi.org/10.1111/j.1462-2920.2011.02554.x.

8. Béjà, O., Spudich, E. N., Spudich, J. L., Leclerc, M.,

and DeLong, E. F. (2001) Proteorhodopsin photot-

rophy in the ocean, Nature, 411, 786-789, https://

doi.org/10.1038/35081051.

9. Atamna-Ismaeel, N., Sabehi, G., Sharon, I., Witzel,

K.-P., Labrenz, M., Jürgens, K., Barkay, T., Stomp, M.,

Huisman,J., and Beja,O. (2008) Widespread distribu-

tion of proteorhodopsins in freshwater and brackish

ecosystems, ISMEJ., 2, 656-662, https://doi.org/10.1038/

ismej.2008.27.

10. Koh Eileen,Y., Atamna-Ismaeel, N., Martin, A., Cowie

Rebecca, O. M., Beja, O., Davy Simon, K., Maas

Elizabeth,W., and Ryan Ken,G. (2010) Proteorhodop-

sin-bearing bacteria in antarctic sea ice, Appl. Envi-

ron. Microbiol., 76, 5918-5925, https://doi.org/10.1128/

AEM.00562-10.

11. Gómez-Consarnau, L., Akram, N., Lindell, K.,

Pedersen,A., Neutze,R., Milton, D.L., González, J.M.,

and Pinhassi, J. (2010) Proteorhodopsin phototrophy

promotes survival of marine bacteria during starva-

tion, PLOS Biol., 8, e1000358, https://doi.org/10.1371/

journal.pbio.1000358.

12. Steindler, L., Schwalbach, M.S., Smith, D.P., Chan,F.,

and Giovannoni, S. J. (2011) Energy starved candi-

datus Pelagibacter ubique substitutes light-mediat-

ed ATP production for endogenous carbon respi-

ration, PLoS One, 6, e19725, https://doi.org/10.1371/

journal.pone.0019725.

13. DeLong, E.F., and Beja,O. (2010) Thelight-driven pro-

ton pump proteorhodopsin enhances bacterial surviv-

al during tough times, PLoS Biol., 8, e1000359, https://

doi.org/10.1371/journal.pbio.1000359.

14. Gómez-Consarnau, L., Raven, J. A., Levine, N. M.,

Cutter, L. S., Wang, D., Seegers, B., Arístegui, J.,

Fuhrman, J. A., Gasol, J. M., and Sañudo-Wilhelmy,

S.A. (2019) Microbial rhodopsins are major contribu-

tors to the solar energy captured in the sea, Sci. Adv.,

5, eaaw8855, https://doi.org/10.1126/sciadv.aaw8855.

15. Finkel, O. M., Béjà, O., and Belkin, S. (2013) Global

abundance of microbial rhodopsins, ISME J., 7, 448-

451, https://doi.org/10.1038/ismej.2012.112.

16. Feng, S., Powell, S. M., Wilson, R., and Bowman,

J. P. (2013) Light-stimulated growth of proteorho-

dopsin-bearing sea-ice psychrophile Psychroflexus

torquis is salinity dependent, ISME J., 7, 2206-2213,

https://doi.org/10.1038/ismej.2013.97.

17. Kondo, K., Ohtake, R., Nakano, S., Terashima, M.,

Kojima,H., Fukui,M., Demura,M., Kikukawa,T., and

E.sibiricum PROTEORHODOPSIN GENE EXPRESSION 919

BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025

Tsukamoto, T. (2024) Contribution of proteorhodop-

sin to light-dependent biological responses in Hy-

menobacter nivis P3T isolated from red snow in ant-

arctica, Biochemistry, 63, 2257-2265, https://doi.org/

10.1021/acs.biochem.4c00286.

18. Kim, S.-H., Jung,B., Hong, S.G., and Jung, K.-H. (2020)

Temperature dependency of proton pumping activity

for marine microbial rhodopsin from antartic ocean,

Sci. Rep., 10, 1356, https://doi.org/10.1038/s41598-

020-58023-5.

19. Lamm, G. H. U., Marin, E., Alekseev, A., Schellbach,

A. V., Stetsenko, A., Bourenkov, G., Borshchevskiy, V.,

Asido, M., Agthe, M., Engilberge, S., Rose, S. L.,

Caramello,N., Royant,A., Schneider, T.R., Bateman,A.,

Mager, T., Moser, T., Wachtveitl, J., Guskov, A., and

Kovalev, K. (2024) CryoRhodopsins: a comprehen-

sive characterization of a group of microbial rho-

dopsins from cold environments, bioRxiv, https://

doi.org/10.1101/2024.01.15.575777.

20. Guerrero, L. D., Vikram, S., Makhalanyane, T. P., and

Cowan, D. A. (2017) Evidence of microbial rhodop-

sins in Antarctic Dry Valley edaphic systems, Envi-

ron. Microbiol., 19, 3755-3767, https://doi.org/10.1111/

1462-2920.13877.

21. Rodrigues, D. F., Goris, J., Vishnivetskaya, T., Gili-

chinsky, D., Thomashow, M. F., and Tiedje, J. M.

(2006) Characterization of Exiguobacterium isolates

from the Siberian permafrost. Description of Exig-

uobacterium sibiricum sp. nov, Extremophiles, 10,

285-294, https://doi.org/10.1007/s00792-005-0497-5.

22. Petrovskaya, L.E., Lukashev, E.P., Chupin, V.V., Sychev,

S. V., Lyukmanova, E. N., Kryukova, E. A., Ziganshin,

R. H., Spirina, E. V., Rivkina, E. M., Khatypov, R. A.,

Erokhina, L.G., Gilichinsky, D.A., Shuvalov, V.A., and

Kirpichnikov, M. P. (2010) Predicted bacteriorhodop-

sin from Exiguobacterium sibiricum is a function-

al proton pump, FEBS Lett., 584, 4193-4196, https://

doi.org/10.1016/j.febslet.2010.09.005.

23. Balashov, S. P., Petrovskaya, L. E., Lukashev, E. P.,

Imasheva, E.S., Dioumaev, A.K., Wang, J.M., Sychev,

S. V., Dolgikh, D.A., Rubin, A. B., Kirpichnikov, M.P.,

and Lanyi, J.K. (2012) Aspartate-histidine interaction

in the retinal Schiff base counterion of the light-driv-

en proton pump of Exiguobacterium sibiricum,

Biochemistry, 51, 5748-5762, https://doi.org/10.1021/

bi300409m.

24. Balashov, S. P., Petrovskaya, L. E., Imasheva, E. S.,

Lukashev, E.P., Dioumaev, A.K., Wang, J. M., Sychev,

S. V., Dolgikh, D.A., Rubin, A. B., Kirpichnikov, M.P.,

and Lanyi, J. K. (2013) Breaking the carboxyl rule:

lysine 96 facilitates reprotonation of the Schiff base

in the photocycle of a retinal protein from Exiguo-

bacterium sibiricum, J.Biol. Chem., 288, 21254-21265,

https://doi.org/10.1074/jbc.M113.465138.

25. Petrovskaya, L., Balashov, S., Lukashev, E., Ima-

sheva, E., Gushchin, I. Y., Dioumaev, A., Rubin, A.,

Dolgikh, D., Gordeliy, V., Lanyi, J., and Kirpich-

nikov, M. (2015) ESR – a retinal protein with un-

usual properties from Exiguobacterium sibiricum,

Biochemistry (Moscow), 80, 688-700, https://doi.org/

10.1134/S000629791506005X.

26. Siletsky, S. A., Mamedov, M. D., Lukashev, E. P.,

Balashov, S. P., Dolgikh, D. A., Rubin, A. B., Kirpich-

nikov, M. P., and Petrovskaya, L. E. (2016) Electro-

genic steps of light-driven proton transport in ESR,

a retinal protein from Exiguobacterium sibiricum,

Biochim. Biophys. Acta, 1857, 1741-1750, https://

doi.org/10.1016/j.bbabio.2016.08.004.

27. Petrovskaya, L. E., Siletsky, S. A., Mamedov, M. D.,

Lukashev, E. P., Balashov, S. P., Dolgikh, D. A., and

Kirpichnikov, M.P. (2023) Features of the mechanism

of proton transport in ESR, retinal protein from Ex-

iguobacterium sibiricum, Biochemistry (Moscow), 88,

1544-1554, https://doi.org/10.1134/s0006297923100103.

28. Gushchin,I., Chervakov,P., Kuzmichev,P., Popov, A.N.,

Round, E., Borshchevskiy, V., Ishchenko, A., Petrov-

skaya, L., Chupin, V., Dolgikh, D. A., Arseniev, A. S.,

Kirpichnikov, M., and Gordeliy, V. (2013) Structural

insights into the proton pumping by unusual proteor-

hodopsin from nonmarine bacteria, Proc. Nat. Acad.

Sci. USA, 110, 12631-12636, https://doi.org/10.1073/

pnas.1221629110.

29. Rappsilber, J., Mann,M., and Ishihama,Y. (2007) Pro-

tocol for micro-purification, enrichment, pre-frac-

tionation and storage of peptides for proteomics

using StageTips, Nat. Protocols, 2, 1896-1906, https://

doi.org/10.1038/nprot.2007.261.

30. Tyanova, S., Temu, T., and Cox, J. (2016) The Max-

Quant computational platform for mass spectrom-

etry-based shotgun proteomics, Nat. Protocols, 11,

2301-2319, https://doi.org/10.1038/nprot.2016.136.

31. Tyanova, S., Temu, T., Sinitcyn, P., Carlson, A.,

Hein, M. Y., Geiger, T., Mann, M., and Cox, J. (2016)

The Perseus computational platform for comprehen-

sive analysis of (prote)omics data, Nat. Meth., 13, 731-

740, https://doi.org/10.1038/nmeth.3901.

32. Rodrigues, D. F., Ivanova, N., He, Z., Huebner, M.,

Zhou, J., and Tiedje, J. M. (2008) Architecture of

thermal adaptation in an Exiguobacterium sibir-

icum strain isolated from 3 million year old per-

mafrost: a genome and transcriptome approach,

BMC Genomics, 9, 547, https://doi.org/10.1186/1471-

2164-9-547.

33. Jinendiran, S., Dileep Kumar, B. S., Dahms, H.-U.,

Arulanandam, C. D., and Sivakumar, N. (2019) Op-

timization of submerged fermentation process for

improved production of β-carotene by Exiguobac-

terium acetylicum S01, Heliyon, 5, e01730, https://

doi.org/10.1016/j.heliyon.2019.e01730.

34. Patel, V.K., Srivastava,R., Sharma,A., Srivastava, A.K.,

Singh,S., Srivastava, A.K., Kashyap, P.L., Chakdar,H.,

Pandiyan, K., Kalra, A., and Saxena, A. K. (2018)

PETROVSKAYA etal.920

BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025

Halotolerant Exiguobacterium profundum PHM11

tolerate salinity by accumulating L-proline and

fine-tuning gene expression profiles of related met-

abolic pathways, Front. Microbiol., 9, 423, https://

doi.org/10.3389/fmicb.2018.00423.

35. Gilichinsky, D. A., and Rivkina, E. M. (2011) Perma-

frost microbiology, in Encyclopedia of Geobiology,

Springer, pp. 726-732, https://doi.org/10.1007/978-1-

4020-9212-1_162.

36. Jansson, J. K., and Tas, N. (2014) The microbial ecol-

ogy of permafrost, Nat. Rev. Microbiol., 12, 414-425,

https://doi.org/10.1038/nrmicro3262.

37. Akram, N., Palovaara, J., Forsberg, J., Lindh, M. V.,

Milton, D.L., Luo,H., González, J.M., and Pinhassi,J.

(2013) Regulation of proteorhodopsin gene expres-

sion by nutrient limitation in the marine bacterium

Vibrio sp. AND4, Environ. Microbiol., 15, 1400-1415,

https://doi.org/10.1111/1462-2920.12085.

38. Kimura, H., Young, C. R., Martinez, A., and DeLong,

E. F. (2011) Light-induced transcriptional responses

associated with proteorhodopsin-enhanced growth

in a marine flavobacterium, ISME J., 5, 1641-1651,

https://doi.org/10.1038/ismej.2011.36.

39. Kopejtka, K., Tomasch, J., Kaftan, D., Gardiner, A. T.,

Bína, D., Gardian,Z., Bellas, C., Dröge, A., Geffers, R.,

Sommaruga, R., and Koblížek, M. (2022) A bacteri-

um from a mountain lake harvests light using both

proton-pumping xanthorhodopsins and bacteriochlo-

rophyll-based photosystems, Proc. Nat. Acad. Sci.

USA, 119, e2211018119, https://doi.org/10.1073/pnas.

2211018119.

40. Liu, Q., Li, W., Liu, D., Li, L., Li, J., Lv, N., Liu, F.,

Zhu, B., Zhou, Y., Xin, Y., and Dong, X. (2021) Light

stimulates anoxic and oligotrophic growth of glacial

Flavobacterium strains that produce zeaxanthin,

ISME J., 15, 1844-1857, https://doi.org/10.1038/s41396-

020-00891-w.

41. Klassen, J. L. (2010) Phylogenetic and evolutionary

patterns in microbial carotenoid biosynthesis are re-

vealed by comparative genomics, PLoS One, 5, e11257,

https://doi.org/10.1371/journal.pone.0011257.

42. Jaffe, A. L., Konno, M., Kawasaki, Y., Kataoka, C.,

Béjà, O., Kandori, H., Inoue, K., and Banfield, J. F.

(2022) Saccharibacteria harness light energy using

type-1 rhodopsins that may rely on retinal sourced

from microbial hosts, ISME J., 16, 2056-2059, https://

doi.org/10.1038/s41396-022-01231-w.

43. Keffer, J. L., Hahn, M. W., and Maresca, J. A. (2015)

Characterization of an unconventional rhodop-

sin from the freshwater actinobacterium Rhodol-

una lacicola, J. Bacteriol., 197, 2704-2712, https://

doi.org/10.1128/jb.00386-15.

44. Fang, J., Zhang, Y., Zhu, T., and Li, Y. (2023) Scram-

blase activity of proteorhodopsin confers physiolog-

ical advantages to Escherichia coli in the absence of

light, iScience, 26, 108551, https://doi.org/10.1016/j.

isci.2023.108551.

45. Raymond-Bouchard, I., and Whyte, L. G. (2017) From

transcriptomes to metatranscriptomes: cold adapta-

tion and active metabolisms of psychrophiles from

cold environments, in Psychrophiles: From Biodi-

versity to Biotechnology (Margesin, R. ed), Springer

International Publishing, Cham, pp. 437-457, https://

doi.org/10.1007/978-3-319-57057-0_18.

46. Wu, G., Baumeister, R., and Heimbucher, T. (2023)

Molecular mechanisms of lipid-based metabolic ad-

aptation strategies in response to cold, Cells, 12, 1353,

https://doi.org/10.3390/cells12101353.

47. Zhao, Z., Liu, Z., and Mao, X. (2020) Biotechnolog-

ical advances in lycopene β-cyclases, J. Agric. Food

Chem., 68, 11895-11907, https://doi.org/10.1021/acs.

jafc.0c04814.

48. Sajjad, W., Din, G., Rafiq, M., Iqbal, A., Khan, S.,

Zada, S., Ali, B., and Kang, S. (2020) Pigment produc-

tion by cold-adapted bacteria and fungi: colorful tale

of cryosphere with wide range applications, Extrem-

ophiles, 24, 447-473, https://doi.org/10.1007/s00792-

020-01180-2.

49. Collins,T., and Margesin,R. (2019) Psychrophilic life-

styles: mechanisms of adaptation and biotechnologi-

cal tools, Appl. Microbiol. Biotechnol., 103, 2857-2871,

https://doi.org/10.1007/s00253-019-09659-5.

50. Singh,A., Krishnan, K. P., Prabaharan, D., and Sinha,

R. K. (2017) Lipid membrane modulation and pig-

mentation: A cryoprotection mechanism in Arctic

pigmented bacteria, J.Basic Microbiol., 57, 770-780,

https://doi.org/10.1002/jobm.201700182.

51. Seel, W., Baust, D., Sons, D., Albers, M., Etzbach, L.,

Fuss, J., and Lipski, A. (2020) Carotenoids are used

as regulators for membrane fluidity by Staphylococ-

cus xylosus, Sci. Rep., 10, 330, https://doi.org/10.1038/

s41598-019-57006-5.

52. Jagannadham, M. V., Chattopadhyay, M. K., Subbal-

akshmi, C., Vairamani,M., Narayanan, K., Rao, C. M.,

and Shivaji,S. (2000) Carotenoids of an Antarctic psy-

chrotolerant bacterium, Sphingobacterium antarcti-

cus, and a mesophilic bacterium, Sphingobacterium

multivorum, Arch. Microbiol., 173, 418-424, https://

doi.org/10.1007/s002030000163.

Publisher’s Note. Pleiades Publishing remains

neutral with regard to jurisdictional claims in published

maps and institutional affiliations. AI tools may have

been used in the translation or editing of this article.