ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 7, pp. 911-920 © Pleiades Publishing, Ltd., 2025.
Russian Text © The Author(s), 2025, published in Biokhimiya, 2025, Vol. 90, No. 7, pp. 993-1003.
911
Effect of Cultivation Conditions
on the Expression of the Exiguobacterium sibiricum
Proteorhodopsin Gene
Lada E. Petrovskaya
1,2,a
*, Elena V. Spirina
3
, Artemiy Yu. Sukhanov
4
,
Elena A. Kryukova
1
, Evgeniy P. Lukashev
5
, Rustam H. Ziganshin
1
,
Elizaveta M. Rivkina
3
, Dmitrii A. Dolgikh
1,5
, and Mikhail P. Kirpichnikov
1,5
1
Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences,
117997 Moscow, Russia
2
Moscow Institute of Physics and Technology, 141701 Dolgoprudny, Moscow Region, Russia
3
Institute of Physicochemical and Biological Problems in Soil Science, Russian Academy of Sciences,
142290 Pushchino, Moscow Region, Russia
4
FRC Kazan Scientific Center, Russian Academy of Sciences, 420111 Kazan, Russia
5
Faculty of Biology, Lomonosov Moscow State University, 119991 Moscow, Russia
a
e-mail: lpetr65@yahoo.com
Received March 28, 2025
Revised May 25, 2025
Accepted May 28, 2025
Abstract— Recombinant proteorhodopsin ESR of the gram-positive bacterium Exiguobacterium sibiricum iso-
lated from permafrost deposits in northeastern Siberia binds retinal and acts as a light-dependent proton
pump, but not much is known about its expression under natural conditions. In this work, expression of the
esr gene in E. sibiricum cultures grown under various conditions was studied by quantitative PCR. It has
been discovered that cultivation on poor media at low temperatures contributes to a significant increase in
the content of the corresponding mRNA. The data obtained are confirmed by the results of the analysis of
the membrane fraction of cells using label-free quantitative chromatography-mass spectrometry. Also, at 10°C,
increased content of phytoene desaturases, which are involved in the biosynthesis of carotenoids, is observed.
However, we were unable to detect the presence of a functional retinal-containing protein in the cells, pre-
sumably due to the lack of an enzymatic retinal synthesis system in E.  sibiricum. The possible functions of
ESR in E.  sibiricum cells are discussed in connection with the characteristics of the extreme habitat of the
bacterium. The results of this study contribute to expanding the understanding of the molecular mechanisms
of microbial adaptation to environmental conditions and the potential role of microbial rhodopsins in these
processes.
DOI: 10.1134/S0006297925600917
Keywords: Exiguobacterium sibiricum, permafrost deposits, microbial rhodopsins, retinal, carotenoids
* To whom correspondence should be addressed.
INTRODUCTION
One of the primary types of energy on our planet
is the energy of sunlight, which various green plants
and photosynthetic microorganisms use to maintain
metabolic processes. Recently, a lot of attention has
been attracted by the contribution of microorganisms
containing rhodopsin-like proteins to the accumula-
tion and transformation of solar energy [1, 2]. Mi-
crobial rhodopsins are integral membrane proteins
consisting of seven alpha-helical segments and con-
taining a retinal cofactor in the all-trans configura-
tion [3, 4]. Absorption of a quantum of light results
in retinal molecule isomerization from the all-trans to
the 13-cis state. Subsequent conformational changes
in the protein are accompanied by various functional
PETROVSKAYA etal.912
BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025
events, such as ion transport or sensory signal trans-
mission [5]. As a result of transmembrane proton
transfer, proton-motive force is generated and ATP is
synthesized, which is then used by cells to meet their
energy needs [6].
Coding sequences of potential retinal proteins
have been found in the genomes of microorganisms
inhabiting various ecological niches, including salt
and fresh water bodies, ice, plant leaves, etc. [7-10].
It has been established that the presence of rhodop-
sins allows microbial cells to survive in unfavorable
environmental conditions, particularly in the case of
a lack of nutrients [11-13]. Thus, the genomes of al-
most half of the marine microorganism species con-
tain genes of potential microbial rhodopsins [14, 15].
Genes of rhodopsin-like proteins have been found in
many psychrotrophic and psychrophilic microorgan-
isms[16,17], as well as in the analysis of metagenom-
ic DNA isolated from natural samples of cold habitats,
mainly of aquatic origin [18-20]. In rare cases, the
presence of rhodopsins has been described in repre-
sentatives of soil microbial communities, for example,
in the dry valleys of Antarctica [20].
Previously, we have obtained and studied the ret-
inal protein of the gram-positive soil bacterium Ex-
iguobacterium sibiricum (ESR), isolated from perma-
frost deposits of northeastern Siberia (age – 3 million
years)[21]. ESR belongs to the proteorhodopsin family,
carries out light-dependent proton transport [22] and
has a number of structural and functional features
that distinguish it from homologous proteins and
make it an interesting study object [23-28]. It should
be noted that the abovementioned studies were car-
ried out using a recombinant protein, therefore, the
functions and regulation of ESR expression in E.  sibir-
icum cells remain unexplored.
In this work, we aimed to investigate the expres-
sion of the esr gene in the culture of E.  sibiricum cells
grown under various conditions and identify the fac-
tors contributing to an increased level of proteorho-
dopsin synthesis in cells.
MATERIALS AND METHODS
The study utilized reagents from Bio-Rad (USA),
Merck (USA), Panreac (Spain); components of bacteri-
al culture media (Difco, USA); organic solvents from
Khimmed (Russia). The solutions were prepared using
MilliQ deionized water. The E. sibiricum 255-15 strain
was provided by Dr.  T.  A.  Vishnivetskaya.
Cultivation of E.  sibiricum cells. Cells of E.  si-
biricum strain255-15 were stored at –70°C in 1/2 TSB
medium (trypticase soy broth diluted 2-fold with dis-
tilled water) supplemented with 20% glycerol. Frozen
cells were reconstituted on 1/2 TSA (trypticase soy
agar) solid nutrient medium at 30°C. The grown col-
onies were transferred to 50 ml tubes (Corning, USA)
and incubated in 1/2TSB nutrient medium at 30°C for
16h to OD600  ≈  4. The resulting inoculum (10ml) was
added to 1 liter shaker flasks containing 200  ml of
sterile tap water or liquid TSB medium diluted 2 and
10 times with sterile tap water. The final dilution of
the medium was thus 1/2, 1/10, or 1/40 TSB. Cultiva-
tion was carried out under an illumination intensity
of 30 μmol photons m
−2
∙sec
−1
(natural light and fluo-
rescent lamps) under forced aeration (200rpm) on an
Innova shaker (Brunswick, USA) at 10 or 25°C. For in-
cubation in the dark, the flasks were covered with foil.
Membrane fraction isolation. The cells were
centrifuged at 7000g for 10min at 5°C, after which the
pellet was resuspended in a buffer containing 50mM
Tris-HCl (pH 8.0), 5 mM EDTA, 20% sucrose and lyso-
zyme (0.4mg/ml), incubated for 1h and disrupted by
ultrasonication. The suspension was centrifuged for
30 min (6000g, 5°C). The resulting supernatant was
centrifuged for 1 h (100,000g, 5°C) and the membrane
fraction pellet was resuspended in 50 mM Tris-HCl
(pH 8.0).
To remove cytoplasmic protein impurities, 300μl
of a cooled 100 mM Na
2
CO
3
solution was added to
100 μl of the suspension, incubated for 1  h with stir-
ring in an ice bath, after which centrifugation at
100,000g and 5°C was repeated. The pellet was resus-
pended in 50 mM Tris-HCl (pH 8.0) and used for sub-
sequent proteomic analysis.
Membrane fraction spectroscopy was performed
after solubilization of the fraction by adding a solu-
tion of n-dodecyl-β-D-maltopyranoside (Anatrace, USA)
to 0.5% and NaCl to 100mM, incubation at room tem-
perature for 3 h and centrifugation (20,000g, 10 min).
The absorption spectrum of the supernatant was ob-
tained using a Hitachi-557 spectrophotometer (Hitachi,
Japan). The Origin 8.1 program was used for multiex-
ponential approximation of the curves.
Changes in absorption per single flash [532  nm;
7 ns duration, 10 mJ pulse energy; YAG-Nd LS-2131M
laser (LOTISTII, Belarus)] were recorded using a flash
photolysis setup with double monochromatization
of the measuring light. Using an Octopus CompuS-
cope 8327 analog-to-digital converter (GaGe, Canada),
100 single signals were accumulated.
Total RNA isolation. Total RNA was obtained
using the ExtractRNA reagent (Evrogen, Russia). E. si-
biricum cells in an amount corresponding to 1 OD
unit at 600 nm were sedimented by centrifugation in
a tabletop centrifuge for 2 min at 10,000g and sus-
pended in 1 ml of the reagent with the addition of
200 μl of a mixture of 150-300 μm and 400-600 μm
glass beads (Sigma-Aldrich, USA). The suspension was
shaken in a Mini Bead Mill (VWR, USA) at the maxi-
mum speed for 1min, then heated for 10min at 70°C.
E.sibiricum PROTEORHODOPSIN GENE EXPRESSION 913
BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025
This treatment was repeated 3 times, ensuring effec-
tive cell destruction and maximum RNA yield.
The subsequent steps were carried out accord-
ing to the protocol of the ExtractRNA manufacturer.
The resulting lysate was centrifuged for 10 min at
15,000g at room temperature, 0.2 ml of chloroform
was added to the supernatant, after which the mix-
ture was incubated for 5 min at room temperature
with periodic shaking. After 15 min centrifugation
(12,000g, 4°C), the upper aqueous phase was collected
and 0.5 ml of 100% isopropanol was added to it, the
mixture was incubated for 10 min at room tempera-
ture, then centrifuged for 10 min at 12,000g. The sed-
iment was washed with 1ml of 75% ethanol and cen-
trifuged at room temperature (20,000g for 5min), then
air-dried and dissolved in 30 μl of RNase-free water.
To remove genomic DNA, the samples were treat-
ed with DNase I (Thermo Fisher Scientific, USA) ac-
cording to the manufacturer’s recommendations, then
the preparation was purified using the CleanRNA
Standard kit (Evrogen). If DNA impurities were de-
tected in the total RNA preparation, additional purifi-
cation was performed using the TURBO DNA-free Kit
(Thermo Fisher Scientific). The concentration of the
obtained RNA was determined using Qubit2.0 (Thermo
Fisher Scientific).
cDNA synthesis and qPCR. RevertAid reverse
transcriptase (Thermo Fisher Scientific) was used for
cDNA synthesis. The reaction mixture (20  μl) included
4μl of 5× buffer, 1 μl of random hexamer primer mix
(Invitrogen, USA), 0.5 μl of RiboLock RNase inhibitor
(Thermo Fisher Scientific), 2 μl of dNTP mix, 1  μl of
enzyme, and 1μg of isolated RNA. The sample was in-
cubated for 10min at room temperature and then for
60 min at 42°C. The reaction was stopped by heating
for 10min at 70°C. The concentration of the obtained
cDNA was determined by using Qubit 2.0.
Quantitative PCR (qPCR) was performed using
a LightCycler 96 PCR analyzer (Roche, Switzerland).
The relative quantitative analysis mode was selected
for measurements; the esr gene fragment was ampli-
fied in the presence of ESR_F1 and ESR_R1 primers.
Fragments of the genes of DNA gyrase, gyrA, and of
the β-subunit of RNA polymerase, rpoB, were ampli-
fied as references using primers gA2F and gA2R, rB1F
and rB1R, respectively. The primers (synthesized by
Evrogen) were selected using the Primer3Plus pro-
gram. The sequences of all the primers used in this
study are given in Table 1.
The stability of reference gene expression was
confirmed using the geNorm test. The reaction mixture
(20  μl) contained 4  μl of the ready-made qPCRmix-HS
SYBR mixture (Evrogen), 8  pM of each primer, and
100 ng of cDNA. The reaction conditions were as fol-
lows: denaturation at 95°C for 5 min; 45 cycles (95°C
for 20 sec; 60°C for 20 sec; 72°C for 20 sec); melt-
ing at 95°C for 10 sec, then at 65°C for 60 sec. All
measurements were performed in three independent
replicates with a negative control (template-free mix-
ture). The absence of genomic DNA impurities in
RNA samples was checked by adding the appropriate
amount of the RNA preparation that had not been
reverse transcribed to the reaction mixture instead
of cDNA. The data were processed using LightCycler
Software 1.1.
Protein hydrolysis with trypsin in solution. An
aliquot of the suspension containing 20 μg of protein
was dried thoroughly in a SpeedVac centrifugal vac-
uum concentrator (Savant, France) and dissolved in
20 μl of a buffer solution containing 100 mM Tris-
HCl (pH 8.5), 1% sodium deoxycholate, 10 mM TCEP
(Tris(2-carboxyethyl)phosphine) and 20 mM 2-CAA
(2-chloroacetamide); heated for 10 min at 85°C and
cooled to room temperature. Trypsin (0.4μg) in 10 μl
of 100mM Tris-HCl (pH8.5) was added to the protein
solution and the mixture was incubated at 37°C over-
night. After incubation, an equal volume of 2% TFA
was added to the reaction mixture and the peptides
were desalted on a laboratory-made SDB-RPS StageTip
microcolumn constructed as described by Rappsilber
et al. [29]. The peptide solution was applied to the
microcolumn by centrifugation at 300g, washed twice
with a solvent mixture (50 μl of 1% TFA, 50 μl eth-
yl acetate), then with 50 μl of 0.2% TFA and eluted
with 60 μl of a solution containing 5% ammonium
hydroxide and 60% acetonitrile in water. The eluate
was dried and stored at −80°C. Before analysis, the
peptides were dissolved in 40μl of a solution contain-
ing 0.1% TFA and 2% acetonitrile in water.
Chromatography-mass spectrometry analysis.
The samples were loaded onto a laboratory-made pre-
column (50  ×  0.1  mm) packed with Reprosil-Pur 200
C18-AQ 5μm sorbent (Dr. Maisch, Germany) in a solu-
tion containing 2% acetonitrile, 98% H
2
O, 0.1% TFA
at a flow rate of 4.2 μl/min and separated at room
temperature on a fused silica column (300  ×  0.1 mm)
with an emitter manufactured on a P2000 Laser Puller
Table  1. The sequences of the primers used in the study
Primer name 5′→3′ primer sequence
ESR_F1 AATCGACGGTTTTCCAACAG
ESR_R1 TAGATCCAGGCGAAACATCC
gA2F GACGATGATTCCGGTCAACT
gA2R ATTGATTCGGGCATAAGCAG
rB1F GACGTTTCACCGAAACAGGT
rB1R AGGATTTCACGTGCCGTTAC
PETROVSKAYA etal.914
BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025
Fig. 1. The effects of medium composition, illumination (a) and temperature (b) on the esr gene expression level; +NaCl –
with the addition of NaCl up to 30g/liter. Normalization was performed for the expression level under illumination during
growth on 1/40 TSB at 25°C.
(Sutter, USA) and packed with Reprosil-Pur 200 C18-AQ
1.9  μm sorbent (Dr.  Maisch) in the laboratory. Re-
versed-phase chromatography was performed on an
Ultimate 3000 Nano LC System chromatograph (Ther-
mo Fisher Scientific) coupled to an Orbitrap Q Exac-
tive Plus mass spectrometer (Thermo Fisher Scientific)
via a nanoelectrospray source (Thermo Fisher Scien-
tific). For chromatographic separation of peptides, sol-
vent systemsA (99.9%water; 0.1% formic acid) and B
(19.9% water; 0.1% formic acid; 80% acetonitrile) were
used. The peptides were eluted from the column using
a linear gradient: A  →  3% B for 3 min; 3  →  6% B for
2min; 6  →  32%B for 100min; 32  →  50%B for 18min;
50  →  99% B for 0.1 min; 99% B for 3 min; 99 → 3% B
for 0.1 min at a flow rate of 500 nl/min.
Analysis of mass spectrometric data was car-
ried out by using the MaxQuant 2.4.2.0 [30] and
Perseus 2.0.10.0 [31] programs. The Uniprot protein
sequence database (version date 06.2023) was used
to correlate tandem mass spectra with amino acid
protein sequences.
RESULTS
The effect of cultivation conditions on esr gene
expression. To determine the optimal cultivation
mode providing the maximum level of ESR proteor-
hodopsin gene expression in E.  sibiricum cells, the
bacterial culture was grown while varying the follow-
ing parameters: 1)medium composition (TSB nutrient
medium diluted 2, 10, and 40 times with sterile tap wa-
ter); 2) presence/absence of light; 3) presence/absence
of NaCl; 4) temperature (10 and 25°C). It should be
noted that E.  sibiricum cells turned out to be resistant
to standard treatments used in RNA isolation, which
required the development of a special technique for
their destruction. The esr gene expression level was
determined by qPCR; normalization was performed
according to the expression level of the reference
genes gyrA and rpoB.
The experiments demonstrated that the esr gene
expression level was 4 times higher when grown on
1/10 TSB than on 1/2 TSB (data not shown). Cultivation
of E.  sibiricum cells on 1/40 TSB showed that limiting
nutrient resources further increases the content of the
corresponding mRNA. Thus, the esr gene expression
level in the culture grown on 1/40 TSB under natural
light was 30 times higher than in the culture grown
on 1/10TSB, but when grown in the dark, it decreased
by about 3times (Fig.1a). Addition of NaCl to the nu-
trient medium at a concentration of 30g/liter resulted
in a decrease in the expression level by 1.8 times, re-
gardless of the presence or absence of a light source.
It is known that E.  sibiricum is a psychrotrophic
organism with the ability to grow at low ambient tem-
peratures [21, 32]. In the course of this study, it was
established that E.  sibiricum cells retain their viabili-
ty during cultivation on various media for a week at
10°C (Fig.2). We studied the expression of the esr gene
Fig. 2. Growth dynamics of E.  sibiricum on various media
at 10°C.
E.sibiricum PROTEORHODOPSIN GENE EXPRESSION 915
BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025
Fig. 3. Carotenoid synthesis in E. sibiricum cells. Colonies grown on 1/2 TSA plates (a) and the absorption spectrum of
the membrane fraction of cells cultured at 10°C (b). The black line is the experimental curve; the red line is the result
of approximation using Gaussian functions; the corresponding curves are shown in green. The calculated positions of the
absorption maxima are indicated.
in cells cultured at 10°C for seven days on 1/40 TSB
under illumination. Determination of the amount of
mRNA by qPCR showed that the expression level un-
der these conditions increases significantly. After a
week of cultivation at 10°C it is 7 times higher than
the expression level achieved at room temperature
(Fig. 1b).
Spectroscopic analysis of the membrane frac-
tion of E.  sibiricum cells. E. sibiricum cells exhibit a
yellow-orange color during cultivation in liquid and
solid media [21] (Fig. 3a). We isolated the membrane
fraction from cells grown for a week at 10°C and an-
alyzed it using spectroscopic methods. The absorption
spectrum of the membrane fraction solubilized in the
presence of n-dodecyl-β-D-maltopyranoside detergent
contains characteristic peaks indicating the synthesis
of carotenoids (Fig. 3b). Approximation of the curves
showed the presence of absorption maxima at 414,
452, 477, and 506 nm. Previously, the presence of ca-
rotenoids, including lycopene, β-carotene and zeaxan-
thin was demonstrated in extracts of Exiguobacterium
acetylicum, Exiguobacterium auranticum, Exiguobac-
terium profundum [33, 34] and other representatives
of this genus. It should be noted that the maximum
corresponding to proteorhodopsin of E.  sibiricum
(532nm) was not detected in the absorption spectrum.
Also, no light-induced changes in absorption (photocy-
cle) were detected in the studied sample at the wave-
lengths characteristic of ESR mediated by the func-
tional activity of the retinal protein (data not shown).
Proteomic analysis of the membrane fraction
of E.  sibiricum cells. To confirm the obtained data,
we performed a comparative analysis of the mem-
brane fractions of cells grown at 25 and 10°C using la-
bel-free quantitative chromatography-mass spectrom-
etry (high performance liquid chromatography with
tandem mass-spectroscopy, HPLC-MS/MS). A total of
1604 polypeptides were identified, including enzymes,
transporters, components of the secretion system, sen-
sory and other proteins. In particular, the presence of
peptides corresponding to E.  sibiricum rhodopsin was
detected, and the ESR content in the sample obtained
as a result of cultivation at 10°C was 1.57 times high-
er than its content in the sample from cells grown at
room temperature. Also noteworthy is the increased
level of synthesis of phytoene desaturases, which are
involved in the biosynthesis of carotenoids (Exig_0517,
Exig_0735, Exig_0736, and Exig_0738). The content of
these enzymes turned out to be 1.54, 1.81, 2.47, and
2.93 times higher, respectively, in samples of mem-
brane fractions of cells grown at a lower temperature.
DISCUSSION
Permafrost deposits are characterized by a set of
conditions that hinder survival of living organisms
(decreased temperature, low nutrient concentration,
low water activity)[35,36]. A number of studies have
shown that growth of microorganisms (Pelagibacter
ubique, Vibrio sp., etc.) on minimal or highly diluted
media promotes an increase in the expression of rho-
dopsin genes[12, 37, 38]. Similar results were obtained
in our study as well. Growing E.  sibiricum cultures
under resource-limited conditions (on 1/40 TSB) led
to a 30-fold increase in esr gene expression, with illu-
mination promoting a higher expression level, as was
shown, for example, for Dokdonia sp. MED134 [38].
The optimum temperature for E. sibiricum is 36°C,
however, this bacterium is capable of growing in the
temperature range from −2.5 to +40°C[21]. Ithas been
established that at low temperatures, the bacterial cells
PETROVSKAYA etal.916
BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025
Fig. 4. Fragments of the E.sibiricum genomic sequence containing the esr (Exig_1419;a) and phytoene desaturase (Exig_0735–
Exig_0738;b) genes. The data were obtained from the KEGG website, https://www.kegg.jp/genome/T00687. The numbers indi-
cate the locations of genes on the E. sibiricum chromosome.
undergo a significant changes of their gene expres-
sion profile, with many of their genes encoding pro-
teins synthesized only under certain conditions [32].
In this study, we found that a decrease in tempera-
ture to 10°C promotes a significant (7-fold) increase
in the esr gene expression. Oligotrophic environment
and decreased temperature correspond to the condi-
tions observed in the seasonally thawed permafrost
layer in summer, and access to solar energy on the
soil surface is mainly preserved during this season
due to poor vegetation cover. Previously, similar regu-
lation of synthesis was described for xanthorhodopsin
in Sphingomonas glaciales AAP5 from an alpine lake,
which begins to accumulate in cells only at tempera-
tures below 16°C [39].
ESR-specific peptides were detected in the mem-
brane fraction of cells using HPLC-MS/MS analysis.
The protein content was significantly higher in the
sample obtained from the culture grown at a lower
temperature. The lower degree of increase in protein
content compared to the degree of increase in mRNA
content (1.57 and 7 times, respectively) may indicate
differences in the regulation of ESR expression at the
level of transcription and translation.
Despite the obtained data demonstrating the
presence of ESR in E.  sibiricum cells, the absence of
a maximum corresponding to the retinal protein in
the absorption spectrum of the membrane fraction as
well as light-induced absorption (photocycle) changes
suggests that under the studied conditions the cells
do not synthesize retinal, which is necessary for the
formation of functional rhodopsin. The absence of ret-
inal in cells and an increased level of proteorhodopsin
gene synthesis with a low level of blh gene expression
were previously described for a number of Flavobac-
terium strains isolated from glaciers [40].
The coding sequences of rhodopsin-like proteins
are often included in operons that contain genes of
enzymes of the β-carotene and retinal biosynthesis
pathway [41]. Thus, the coding sequence of proteor-
hodopsin (PR) is located before a cluster of six genes
(idi, crtEIBY and blh) responsible for the synthesis
of such enzymes [6]. In the E. sibiricum genome, the
proteorhodopsin gene is not a part of such a cluster
(Fig. 4a). At a significant distance from the esr gene
are the genes of phytoene synthases and phytoene de-
saturases (Fig. 4b), which could potentially carry out
the synthesis of carotenoids[32,41]. However, the gene
for β-carotene-15,15′-dioxygenase (blh), which produc-
es all-trans-retinal from β-carotene, is not detected. It
should be noted that for approximately 28% of E.  si-
biricum proteins, no possible functions could be pre-
dicted due to a lack of homologous sequences in the
databases [32].
Thus, at present, no bioinformatic or experimen-
tal evidence has been obtained proving that E.  sibir-
icum is capable of synthesizing retinal as a cofactor
for proteorhodopsin. The ESR molecule contains a ly-
sine residue, necessary for the formation of a Schiff
base, in a position corresponding to that of homolo-
gous proteins. Heterologous expression of the esr gene
in Escherichia coli cells upon the addition of retinal
is accompanied by its binding with the formation of
a functional holo-form of the protein [22]. It can be
assumed that retinal synthesis by E. sibiricum cells oc-
curs under conditions that could not be reproduced in
our experiment and with the participation of enzymes
that have no homologues among the known proteins.
There is also a hypothetical possibility of using bacte-
rial retinal from the environment, as is probably the
case with the rhodopsins of Saccharibacteria [42] or
Rhodoluna lacicola [43]. However, given the low con-
centration of microbial cells in permafrost sediments,
this option seems unlikely.
An alternative explanation may be the presence
of additional functions of ESR that do not depend on
the presence of retinal and facilitate cell survival un-
der extreme environmental conditions. For example,
the presence of scramblase activity, which improves
biophysical properties of a cell membrane (its fluidity
and membrane potential), was established for prote-
orhodopsin of the psychrophilic bacterium Psychrof-
lexus torquis [44]. Escherichia coli cells that express
this protein demonstrate increased resistance to stress
even in the absence of light and without the addition
of retinal. Increased mobility of membrane lipids could
contribute to maintaining the viability of E.  sibiricum
cells at low temperatures. It is known that increased
synthesis of desaturases is one of the adaptation
mechanisms of psychrophilic microorganisms[45,46].
E.sibiricum PROTEORHODOPSIN GENE EXPRESSION 917
BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025
Fig. 5. A proposed scheme of carotenoid biosynthesis pathways in E.sibiricum cells according to KEGG data, https://www.
kegg.jp/pathway/esi00906. FPP – farnesyl pyrophosphate; GGPP – geranylgeranyl pyrophosphate. The enzymes whose genes
have been identified in the E.sibiricum genome are shown. The lycopene cyclase gene crtY was not found in the genome;
the putative enzyme catalyzing this stage is indicated.
To confirm this hypothesis, further analysis of the
presence of scramblase activity in ESR is proposed.
Along with the increased expression of the esr
gene in bacterial cells at 10°C, we also found an in-
crease in the content of some enzymes involved in
carotenoid synthesis at this temperature. At present,
it has not been experimentally established which ca-
rotenoids are contained in E.  sibiricum cells; how-
ever, based on the presence of coding sequences for
the corresponding enzymes in the genome, it can be
positively stated that lycopene and/or its derivatives
are synthesized (Fig.  5). The enzyme that synthesiz-
es β-carotene (CrtY lycopene cyclase) has not been
identified in the genome of E.  sibiricum and other
representatives of the Exiguobacterium genus; how-
ever, it is known that many of them contain this ca-
rotenoid [33, 34]. It can be assumed that the function
of CrtY in Exiguobacterium cells is performed by phy-
toene synthase Exig_0737 or some other enzyme of
this metabolic pathway. Indeed, enzymes with both ac-
tivities have been found in some microorganisms[47].
Carotenoids are of particular importance for the sur-
vival of cold-adapted bacterial species, as they possess
antioxidant and photoprotective properties, and also
have a cryoprotective effect on membranes, protect-
ing them during repeated freeze-thaw cycles [48-52].
Increased carotenoid synthesis at low temperatures
has been noted in many species of psychrophilic and
psychrotolerant bacteria, including Staphylococcus xy-
losus[51], Sphingobacterium antarcticus[52], etc.[49].
CONCLUSION
In this work, the expression of the proteorho-
dopsin gene of the soil bacterium E.  sibiricum un-
der various conditions was studied for the first time.
It was found that cultivation on a poor medium at
a low temperature promotes a significant increase
in the expression level of ESR and the enzymes of
the carotenoid biosynthesis pathways, which may
reflect the corresponding changes in cell pheno-
types under seasonal thawing of permafrost deposits.
However, we failed to detect the presence of a func-
tional retinal-containing protein in the cells, presum-
ably due to the absence of an enzymatic system for
retinal synthesis in E.  sibiricum. The results of the
study facilitate the development of ideas concern-
ing the molecular mechanisms of microorganism ad-
aptation to extreme environmental conditions and
the possible role of microbial rhodopsins in these
processes.
PETROVSKAYA etal.918
BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025
Abbreviations. ESR, Exiguobacterium sibiricum
proteorhodopsin; TSB, trypticase soy broth.
Contributions. L. E. Petrovskaya, E. M. Rivkina,
D. A. Dolgikh, and M. P. Kirpichnikov – concept and
supervision of the work; E. V. Spirina, E. A. Kryuko-
va, A. Yu. Sukhanov, E. P. Lukashev, R. H. Ziganshin,
and L. E. Petrovskaya – experiments; L. E. Petrovska-
ya, E. P. Lukashev, R. H. Ziganshin, E. M. Rivkina, and
D. A. Dolgikh – discussion of the results of the work;
L. E. Petrovskaya, A. Yu. Sukhanov, E. V. Spirina, and
E. M. Rivkina– writing the text of the paper.
Funding. This work was financially support-
ed by the Russian Science Foundation (project
no. 23-14-00160; qPCR, spectroscopic studies and
proteomic analysis) and by the State Assignment
no. 12204500038-3 “Permafrost deposits and frozen
soils: temperature regime, biota, biogeochemical pro-
cesses, and prospects for ecosystem functioning un-
der global warming” (bacterial cultures acquisition,
RNAisolation).
Ethics approval and consent to participate. This
work does not contain any studies involving human
and animal subjects performed by any of the authors.
Conflict of interest. The authors of this work de-
clare that they have no conflicts of interest.
REFERENCES
1. Rozenberg, A., Inoue, K., Kandori, H., and Béjà, O.
(2021) Microbial rhodopsins: the last two decades,
Annu. Rev. Microbiol., 75, 427-447, https://doi.org/
10.1146/annurev-micro-031721-020452.
2. Pinhassi,J., DeLong, E.F., Béjà,O., González, J.M., and
Pedrós-Alió, C. (2016) Marine bacterial and archaeal
ion-pumping rhodopsins: genetic diversity, physiolo-
gy, and ecology, Microbiol. Mol. Biol. Rev., 80, 929-954,
https://doi.org/10.1128/mmbr.00003-16.
3. Govorunova, E. G., Sineshchekov, O. A., Li, H., and
Spudich, J. L. (2017) Microbial rhodopsins: diversi-
ty, mechanisms, and optogenetic applications, Annu.
Rev. Biochem., 86, 845-872, https://doi.org/10.1146/
annurev-biochem-101910-144233.
4. Gordeliy, V., Kovalev, K., Bamberg, E., Rodriguez-
Valera, F., Zinovev, E., Zabelskii, D., Alekseev, A.,
Rosselli, R., Gushchin, I., and Okhrimenko, I. (2022)
Microbial rhodopsins, in Rhodopsin: Methods and
Protocols (Gordeliy, V. ed) Springer US, New York, NY,
pp.1-52, https://doi.org/10.1007/978-1-0716-2329-9_1.
5. Brown, L.S. (2022) Light-driven proton transfers and
proton transport by microbial rhodopsins – A bio-
physical perspective, Biochim. Biophys. Acta, 1864,
183867, https://doi.org/10.1016/j.bbamem.2022.183867.
6. Martinez,A., Bradley, A.S., Waldbauer, J.R., Summons,
R.E., and DeLong, E.F. (2007) Proteorhodopsin photo-
system gene expression enables photophosphorylation
in a heterologous host, Proc. Nat. Acad. Sci. USA, 104,
5590-5595, https://doi.org/10.1073/pnas.0611470104.
7. Atamna-Ismaeel,N., Finkel, O.M., Glaser,F., Sharon,I.,
Schneider,R., Post, A.F., Spudich, J.L., von Mering,C.,
Vorholt, J. A., Iluz, D., Béjà, O., and Belkin, S. (2012)
Microbial rhodopsins on leaf surfaces of terrestri-
al plants, Environ. Microbiol., 14, 140-146, https://
doi.org/10.1111/j.1462-2920.2011.02554.x.
8. Béjà, O., Spudich, E. N., Spudich, J. L., Leclerc, M.,
and DeLong, E. F. (2001) Proteorhodopsin photot-
rophy in the ocean, Nature, 411, 786-789, https://
doi.org/10.1038/35081051.
9. Atamna-Ismaeel, N., Sabehi, G., Sharon, I., Witzel,
K.-P., Labrenz, M., Jürgens, K., Barkay, T., Stomp, M.,
Huisman,J., and Beja,O. (2008) Widespread distribu-
tion of proteorhodopsins in freshwater and brackish
ecosystems, ISMEJ., 2, 656-662, https://doi.org/10.1038/
ismej.2008.27.
10. Koh Eileen,Y., Atamna-Ismaeel, N., Martin, A., Cowie
Rebecca, O. M., Beja, O., Davy Simon, K., Maas
Elizabeth,W., and Ryan Ken,G. (2010) Proteorhodop-
sin-bearing bacteria in antarctic sea ice, Appl. Envi-
ron. Microbiol., 76, 5918-5925, https://doi.org/10.1128/
AEM.00562-10.
11. Gómez-Consarnau, L., Akram, N., Lindell, K.,
Pedersen,A., Neutze,R., Milton, D.L., González, J.M.,
and Pinhassi, J. (2010) Proteorhodopsin phototrophy
promotes survival of marine bacteria during starva-
tion, PLOS Biol., 8, e1000358, https://doi.org/10.1371/
journal.pbio.1000358.
12. Steindler, L., Schwalbach, M.S., Smith, D.P., Chan,F.,
and Giovannoni, S. J. (2011) Energy starved candi-
datus Pelagibacter ubique substitutes light-mediat-
ed ATP production for endogenous carbon respi-
ration, PLoS One, 6, e19725, https://doi.org/10.1371/
journal.pone.0019725.
13. DeLong, E.F., and Beja,O. (2010) Thelight-driven pro-
ton pump proteorhodopsin enhances bacterial surviv-
al during tough times, PLoS Biol., 8, e1000359, https://
doi.org/10.1371/journal.pbio.1000359.
14. Gómez-Consarnau, L., Raven, J. A., Levine, N. M.,
Cutter, L. S., Wang, D., Seegers, B., Arístegui, J.,
Fuhrman, J. A., Gasol, J. M., and Sañudo-Wilhelmy,
S.A. (2019) Microbial rhodopsins are major contribu-
tors to the solar energy captured in the sea, Sci. Adv.,
5, eaaw8855, https://doi.org/10.1126/sciadv.aaw8855.
15. Finkel, O. M., Béjà, O., and Belkin, S. (2013) Global
abundance of microbial rhodopsins, ISME J., 7, 448-
451, https://doi.org/10.1038/ismej.2012.112.
16. Feng, S., Powell, S. M., Wilson, R., and Bowman,
J. P. (2013) Light-stimulated growth of proteorho-
dopsin-bearing sea-ice psychrophile Psychroflexus
torquis is salinity dependent, ISME J., 7, 2206-2213,
https://doi.org/10.1038/ismej.2013.97.
17. Kondo, K., Ohtake, R., Nakano, S., Terashima, M.,
Kojima,H., Fukui,M., Demura,M., Kikukawa,T., and
E.sibiricum PROTEORHODOPSIN GENE EXPRESSION 919
BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025
Tsukamoto, T. (2024) Contribution of proteorhodop-
sin to light-dependent biological responses in Hy-
menobacter nivis P3T isolated from red snow in ant-
arctica, Biochemistry, 63, 2257-2265, https://doi.org/
10.1021/acs.biochem.4c00286.
18. Kim, S.-H., Jung,B., Hong, S.G., and Jung, K.-H. (2020)
Temperature dependency of proton pumping activity
for marine microbial rhodopsin from antartic ocean,
Sci. Rep., 10, 1356, https://doi.org/10.1038/s41598-
020-58023-5.
19. Lamm, G. H. U., Marin, E., Alekseev, A., Schellbach,
A. V., Stetsenko, A., Bourenkov, G., Borshchevskiy, V.,
Asido, M., Agthe, M., Engilberge, S., Rose, S. L.,
Caramello,N., Royant,A., Schneider, T.R., Bateman,A.,
Mager, T., Moser, T., Wachtveitl, J., Guskov, A., and
Kovalev, K. (2024) CryoRhodopsins: a comprehen-
sive characterization of a group of microbial rho-
dopsins from cold environments, bioRxiv, https://
doi.org/10.1101/2024.01.15.575777.
20. Guerrero, L. D., Vikram, S., Makhalanyane, T. P., and
Cowan, D. A. (2017) Evidence of microbial rhodop-
sins in Antarctic Dry Valley edaphic systems, Envi-
ron. Microbiol., 19, 3755-3767, https://doi.org/10.1111/
1462-2920.13877.
21. Rodrigues, D. F., Goris, J., Vishnivetskaya, T., Gili-
chinsky, D., Thomashow, M. F., and Tiedje, J. M.
(2006) Characterization of Exiguobacterium isolates
from the Siberian permafrost. Description of Exig-
uobacterium sibiricum sp. nov, Extremophiles, 10,
285-294, https://doi.org/10.1007/s00792-005-0497-5.
22. Petrovskaya, L.E., Lukashev, E.P., Chupin, V.V., Sychev,
S. V., Lyukmanova, E. N., Kryukova, E. A., Ziganshin,
R. H., Spirina, E. V., Rivkina, E. M., Khatypov, R. A.,
Erokhina, L.G., Gilichinsky, D.A., Shuvalov, V.A., and
Kirpichnikov, M. P. (2010) Predicted bacteriorhodop-
sin from Exiguobacterium sibiricum is a function-
al proton pump, FEBS Lett., 584, 4193-4196, https://
doi.org/10.1016/j.febslet.2010.09.005.
23. Balashov, S. P., Petrovskaya, L. E., Lukashev, E. P.,
Imasheva, E.S., Dioumaev, A.K., Wang, J.M., Sychev,
S. V., Dolgikh, D.A., Rubin, A. B., Kirpichnikov, M.P.,
and Lanyi, J.K. (2012) Aspartate-histidine interaction
in the retinal Schiff base counterion of the light-driv-
en proton pump of Exiguobacterium sibiricum,
Biochemistry, 51, 5748-5762, https://doi.org/10.1021/
bi300409m.
24. Balashov, S. P., Petrovskaya, L. E., Imasheva, E. S.,
Lukashev, E.P., Dioumaev, A.K., Wang, J. M., Sychev,
S. V., Dolgikh, D.A., Rubin, A. B., Kirpichnikov, M.P.,
and Lanyi, J. K. (2013) Breaking the carboxyl rule:
lysine 96 facilitates reprotonation of the Schiff base
in the photocycle of a retinal protein from Exiguo-
bacterium sibiricum, J.Biol. Chem., 288, 21254-21265,
https://doi.org/10.1074/jbc.M113.465138.
25. Petrovskaya, L., Balashov, S., Lukashev, E., Ima-
sheva, E., Gushchin, I. Y., Dioumaev, A., Rubin, A.,
Dolgikh, D., Gordeliy, V., Lanyi, J., and Kirpich-
nikov, M. (2015) ESR – a retinal protein with un-
usual properties from Exiguobacterium sibiricum,
Biochemistry (Moscow), 80, 688-700, https://doi.org/
10.1134/S000629791506005X.
26. Siletsky, S. A., Mamedov, M. D., Lukashev, E. P.,
Balashov, S. P., Dolgikh, D. A., Rubin, A. B., Kirpich-
nikov, M. P., and Petrovskaya, L. E. (2016) Electro-
genic steps of light-driven proton transport in ESR,
a retinal protein from Exiguobacterium sibiricum,
Biochim. Biophys. Acta, 1857, 1741-1750, https://
doi.org/10.1016/j.bbabio.2016.08.004.
27. Petrovskaya, L. E., Siletsky, S. A., Mamedov, M. D.,
Lukashev, E. P., Balashov, S. P., Dolgikh, D. A., and
Kirpichnikov, M.P. (2023) Features of the mechanism
of proton transport in ESR, retinal protein from Ex-
iguobacterium sibiricum, Biochemistry (Moscow), 88,
1544-1554, https://doi.org/10.1134/s0006297923100103.
28. Gushchin,I., Chervakov,P., Kuzmichev,P., Popov, A.N.,
Round, E., Borshchevskiy, V., Ishchenko, A., Petrov-
skaya, L., Chupin, V., Dolgikh, D. A., Arseniev, A. S.,
Kirpichnikov, M., and Gordeliy, V. (2013) Structural
insights into the proton pumping by unusual proteor-
hodopsin from nonmarine bacteria, Proc. Nat. Acad.
Sci. USA, 110, 12631-12636, https://doi.org/10.1073/
pnas.1221629110.
29. Rappsilber, J., Mann,M., and Ishihama,Y. (2007) Pro-
tocol for micro-purification, enrichment, pre-frac-
tionation and storage of peptides for proteomics
using StageTips, Nat. Protocols, 2, 1896-1906, https://
doi.org/10.1038/nprot.2007.261.
30. Tyanova, S., Temu, T., and Cox, J. (2016) The Max-
Quant computational platform for mass spectrom-
etry-based shotgun proteomics, Nat. Protocols, 11,
2301-2319, https://doi.org/10.1038/nprot.2016.136.
31. Tyanova, S., Temu, T., Sinitcyn, P., Carlson, A.,
Hein, M. Y., Geiger, T., Mann, M., and Cox, J. (2016)
The Perseus computational platform for comprehen-
sive analysis of (prote)omics data, Nat. Meth., 13, 731-
740, https://doi.org/10.1038/nmeth.3901.
32. Rodrigues, D. F., Ivanova, N., He, Z., Huebner, M.,
Zhou, J., and Tiedje, J. M. (2008) Architecture of
thermal adaptation in an Exiguobacterium sibir-
icum strain isolated from 3 million year old per-
mafrost: a genome and transcriptome approach,
BMC Genomics, 9, 547, https://doi.org/10.1186/1471-
2164-9-547.
33. Jinendiran, S., Dileep Kumar, B. S., Dahms, H.-U.,
Arulanandam, C. D., and Sivakumar, N. (2019) Op-
timization of submerged fermentation process for
improved production of β-carotene by Exiguobac-
terium acetylicum S01, Heliyon, 5, e01730, https://
doi.org/10.1016/j.heliyon.2019.e01730.
34. Patel, V.K., Srivastava,R., Sharma,A., Srivastava, A.K.,
Singh,S., Srivastava, A.K., Kashyap, P.L., Chakdar,H.,
Pandiyan, K., Kalra, A., and Saxena, A. K. (2018)
PETROVSKAYA etal.920
BIOCHEMISTRY (Moscow) Vol. 90 No. 7 2025
Halotolerant Exiguobacterium profundum PHM11
tolerate salinity by accumulating L-proline and
fine-tuning gene expression profiles of related met-
abolic pathways, Front. Microbiol., 9, 423, https://
doi.org/10.3389/fmicb.2018.00423.
35. Gilichinsky, D. A., and Rivkina, E. M. (2011) Perma-
frost microbiology, in Encyclopedia of Geobiology,
Springer, pp. 726-732, https://doi.org/10.1007/978-1-
4020-9212-1_162.
36. Jansson, J. K., and Tas, N. (2014) The microbial ecol-
ogy of permafrost, Nat. Rev. Microbiol., 12, 414-425,
https://doi.org/10.1038/nrmicro3262.
37. Akram, N., Palovaara, J., Forsberg, J., Lindh, M. V.,
Milton, D.L., Luo,H., González, J.M., and Pinhassi,J.
(2013) Regulation of proteorhodopsin gene expres-
sion by nutrient limitation in the marine bacterium
Vibrio sp. AND4, Environ. Microbiol., 15, 1400-1415,
https://doi.org/10.1111/1462-2920.12085.
38. Kimura, H., Young, C. R., Martinez, A., and DeLong,
E. F. (2011) Light-induced transcriptional responses
associated with proteorhodopsin-enhanced growth
in a marine flavobacterium, ISME J., 5, 1641-1651,
https://doi.org/10.1038/ismej.2011.36.
39. Kopejtka, K., Tomasch, J., Kaftan, D., Gardiner, A. T.,
Bína, D., Gardian,Z., Bellas, C., Dröge, A., Geffers, R.,
Sommaruga, R., and Koblížek, M. (2022) A bacteri-
um from a mountain lake harvests light using both
proton-pumping xanthorhodopsins and bacteriochlo-
rophyll-based photosystems, Proc. Nat. Acad. Sci.
USA, 119, e2211018119, https://doi.org/10.1073/pnas.
2211018119.
40. Liu, Q., Li, W., Liu, D., Li, L., Li, J., Lv, N., Liu, F.,
Zhu, B., Zhou, Y., Xin, Y., and Dong, X. (2021) Light
stimulates anoxic and oligotrophic growth of glacial
Flavobacterium strains that produce zeaxanthin,
ISME J., 15, 1844-1857, https://doi.org/10.1038/s41396-
020-00891-w.
41. Klassen, J. L. (2010) Phylogenetic and evolutionary
patterns in microbial carotenoid biosynthesis are re-
vealed by comparative genomics, PLoS One, 5, e11257,
https://doi.org/10.1371/journal.pone.0011257.
42. Jaffe, A. L., Konno, M., Kawasaki, Y., Kataoka, C.,
Béjà, O., Kandori, H., Inoue, K., and Banfield, J. F.
(2022) Saccharibacteria harness light energy using
type-1 rhodopsins that may rely on retinal sourced
from microbial hosts, ISME J., 16, 2056-2059, https://
doi.org/10.1038/s41396-022-01231-w.
43. Keffer, J. L., Hahn, M. W., and Maresca, J. A. (2015)
Characterization of an unconventional rhodop-
sin from the freshwater actinobacterium Rhodol-
una lacicola, J. Bacteriol., 197, 2704-2712, https://
doi.org/10.1128/jb.00386-15.
44. Fang, J., Zhang, Y., Zhu, T., and Li, Y. (2023) Scram-
blase activity of proteorhodopsin confers physiolog-
ical advantages to Escherichia coli in the absence of
light, iScience, 26, 108551, https://doi.org/10.1016/j.
isci.2023.108551.
45. Raymond-Bouchard, I., and Whyte, L. G. (2017) From
transcriptomes to metatranscriptomes: cold adapta-
tion and active metabolisms of psychrophiles from
cold environments, in Psychrophiles: From Biodi-
versity to Biotechnology (Margesin, R. ed), Springer
International Publishing, Cham, pp. 437-457, https://
doi.org/10.1007/978-3-319-57057-0_18.
46. Wu, G., Baumeister, R., and Heimbucher, T. (2023)
Molecular mechanisms of lipid-based metabolic ad-
aptation strategies in response to cold, Cells, 12, 1353,
https://doi.org/10.3390/cells12101353.
47. Zhao, Z., Liu, Z., and Mao, X. (2020) Biotechnolog-
ical advances in lycopene β-cyclases, J. Agric. Food
Chem., 68, 11895-11907, https://doi.org/10.1021/acs.
jafc.0c04814.
48. Sajjad, W., Din, G., Rafiq, M., Iqbal, A., Khan, S.,
Zada, S., Ali, B., and Kang, S. (2020) Pigment produc-
tion by cold-adapted bacteria and fungi: colorful tale
of cryosphere with wide range applications, Extrem-
ophiles, 24, 447-473, https://doi.org/10.1007/s00792-
020-01180-2.
49. Collins,T., and Margesin,R. (2019) Psychrophilic life-
styles: mechanisms of adaptation and biotechnologi-
cal tools, Appl. Microbiol. Biotechnol., 103, 2857-2871,
https://doi.org/10.1007/s00253-019-09659-5.
50. Singh,A., Krishnan, K. P., Prabaharan, D., and Sinha,
R. K. (2017) Lipid membrane modulation and pig-
mentation: A cryoprotection mechanism in Arctic
pigmented bacteria, J.Basic Microbiol., 57, 770-780,
https://doi.org/10.1002/jobm.201700182.
51. Seel, W., Baust, D., Sons, D., Albers, M., Etzbach, L.,
Fuss, J., and Lipski, A. (2020) Carotenoids are used
as regulators for membrane fluidity by Staphylococ-
cus xylosus, Sci. Rep., 10, 330, https://doi.org/10.1038/
s41598-019-57006-5.
52. Jagannadham, M. V., Chattopadhyay, M. K., Subbal-
akshmi, C., Vairamani,M., Narayanan, K., Rao, C. M.,
and Shivaji,S. (2000) Carotenoids of an Antarctic psy-
chrotolerant bacterium, Sphingobacterium antarcti-
cus, and a mesophilic bacterium, Sphingobacterium
multivorum, Arch. Microbiol., 173, 418-424, https://
doi.org/10.1007/s002030000163.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in published
maps and institutional affiliations. AI tools may have
been used in the translation or editing of this article.