ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 11, pp. 1950-1960 © Pleiades Publishing, Ltd., 2024.
1950
Prenatal Hypoxia Predisposes to Impaired Expression
of the chrna4 and chrna7 Genes in Adult Rats
without Affecting Acetylcholine Metabolism
during Embryonic Development
Oleg V. Vetrovoy
1,a
*, Sofiia S. Potapova
1
, Viktor A. Stratilov
1
,
and Ekaterina I. Tyulkova
1
1
Laboratory of Regulation of Brain Neuronal Functions, Pavlov Institute of Physiology,
Russian Academy of Sciences, 199034 Saint Petersburg, Russia
a
e-mail: vov210292@yandex.ru
Received April 18, 2024
Revised May 28, 2024
Accepted June 3, 2024
Abstract— Previous studies have shown that the combined effect of fetal hypoxia and maternal stress hormones
predetermines tendency to nicotine addiction in adulthood. This study in rats aimed to investigate the effect of
prenatal severe hypoxia (PSH) on acetylcholine metabolism in the developing brain, as well as on expression
of acetylcholine receptors chrna4 and chrna7 in both the developing brain and adult brain structures following
nicotine consumption. In the developing brain of PSH rats, no changes were found in the activity of choline
acetyltransferase (ChAT) and acetylcholinesterase (AChE) or disturbances in the acetylcholine levels. However,
decreased chrna4 expression was detected on the day 15 of pregnancy, while elevation in the chrna7 expression
was observed on the days 15 and 16 of embryogenesis. In adulthood, the consequences of PSH were mani-
fested as decreased expression of chrna4 in the medial prefrontal cortex (PFC), nucleus accumbens (NAacc),
and hypothalamus (HT), decreased expression of chrna7 in the PFC and hippocampus (HPC). Whereas, nicotine
consumption did not decrease the expression levels of chrna4 and chrna7 compared to the control group in
the adult PSH rats. Thus, prenatal hypoxia predisposes to impaired expression of the chrna4 and chrna7 genes
in adult rats without affecting acetylcholine metabolism during embryonic development.
DOI: 10.1134/S0006297924110099
Keywords: rat, brain development, prenatal hypoxia, acetylcholine metabolism, chrna4, chrna7
Abbreviations: AMG, amygdala; AChE,acetylcholinesterase; ChAT,choline acetyltransferase; chrna4,acetylcholine receptor
subunit alpha-4 mRNA; chrna7 (CHRNA7), acetylcholine receptor subunit alpha-7 mRNA (protein); HPC, hippocampus;
HT,hypothalamus; NAcc,nucleus accumbens; PFC,medial prefrontal cortex; PSH,prenatal severe hypoxia; PVN,thalamic
paraventricular nucleus; VTA, ventral tegmental area.
* To whom correspondence should be addressed.
INTRODUCTION
Nicotine addiction is a serious public threat, with
a death toll of up to 8 million people every year [1].
In contemporary understanding, alongside with the
genetic predisposition to nicotine addiction [2,3], epi-
genetic changes influenced by environmental factors,
which occur especially during embryonic brain devel-
opment, are also of great importance [4,  5]. Thus, ex-
posure to environmental stressors during the prenatal
period, mediated by the maternal endocrine system or
changes in fetal oxygen availability, increases the risk
of substance use disorders [6,  7], especially nicotine
dependence, in offsprings [8,  9].
Fetal hypoxia, often accompanied by the response
of the mother’s glucocorticoid system to impaired ox-
ygen delivery, is one of the most significant factors
that predetermines disturbances in the development
PRENATAL HYPOXIA 1951
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
of the mesolimbic system of the brain. This condition
leads to heightened nicotine consumption in an adult
offspring  [9]. In particular, our previous studies on
rats have highlighted that the increased risk of nico-
tine addiction in adult rats might be associated with
the episodes of severe hypoxia during 14th-16th days
of embryogenesis [10,11], equivalent to 5th-7th weeks
of pregnancy in humans  [12]. During this period, do-
paminergic neurons of the ventral tegmental area
(VTA) complete their axonal guidance to the nucleus
accumbens (NAcc)  [13], while hippocampus and oth-
er cortical structures innervating the NAcc begin to
form  [14]. In our previous investigation, we addition-
ally compared the effects of fetal intrauterine isch-
emia  [11,  15] and prenatal hypoxia induced within a
pressure chamber, combined with the maternal stress
response. We found that the key role in predisposing
individuals to nicotine addiction lies not solely in hy-
poxia itself, but also in the excessive supply of gluco-
corticoids to the developing brain [11]. This led to the
aberrant expression profile of glucocorticoid receptors
in the extrahypothalamic brain structures, causing dis-
ruption of the circadian dynamics of glucocorticoids,
impaired glucocorticoid-dependent expression, and,
consequently, resulting in malfunctioning of the glu-
cocorticoid-dependent processes throughout later life
[16-18]. Hypoxia and stress-related processes could
influence maturation of the cholinergic mediator sys-
tem, both by altering expression of the individual
elements [19] and by requiring a sufficient level of
aerobic oxidative metabolism for the effective acetyl-
choline synthesis [20-22].
Primary mechanisms underlying impact of pre-
natal hypoxia and maternal glucocorticoid stress
hormones on fetal brain development, crucial for
nicotine addiction, still remain unclear. Therefore, in
this study, we studied activity dynamics of the key
enzymes involved in acetylcholine synthesis and deg-
radation, namely choline acetyltransferase (ChAT) and
acetylcholinesterase (AChE), as well as fluctuations in
acetylcholine concentration over the third week of
embryonic development (e15, e16, e17, e20), as well
as on the day  1 after their birth (p1) in the control
rats and the rats exposed to prenatal severe hypox-
ia (PSH). Given the potential for disruptions in the
expression of acetylcholine receptors, we also inves-
tigated transcription dynamics of acetylcholine recep-
tor subunits alpha-4 (chrna4) and alpha-7 (chrna7) in
both developing and adult brains, as well as under
the influence of prenatal hypoxia. Chronic nicotine
dependence originates from the reduced transcription
of acetylcholine receptors due to external nicotine in-
take. We have previously shown that the adult PSH
rats exhibit an increased propensity to consume nic-
otine under free-choice conditions [10], while chronic
nicotine intake through osmotic pumps causes more
pronounced behavioral signs of nicotine dependence
in these rats compared to the control animals [10,11].
In this study, we also used osmotic minipumps to pro-
vide a continuous supply of nicotine over two weeks,
comparing effects of nicotine on the chrna4 and
chrna7 transcription in the brain structures of adult
rats in the control and PSH groups.
MATERIALS AND METHODS
Animals. The study was carried out using animals
from the CCU “Biocollection of laboratory mammals
of different taxonomic affiliation” of the Pavlov Insti-
tute of Physiology of the Russian Academy of Sciences.
Adult pregnant female Wistar rats, aged 12-13 weeks
and weighing 220-250  g, along with their embryonic
(e15, e16, e17, e20), newborn (p1) progeny without sex
definition and adult male offspring, aged 12 weeks
and weighing 320-350  g, were utilized. All experimen-
tal procedures were performed in compliance with
The Guidelines for Reporting Animal Research  [23]
and were approved by the Ethical Committee for the
Use of Animal Subjects at the Pavlov Institute of Phys-
iology (protocol no. 08/02 of 02.08.2022).
Prenatal severe hypoxia. Model of prenatal se-
vere hypoxia (PSH) described in our previous studies
was used as a reliable model of fetal hypoxia [10, 11,
16-18]. To model PSH, we used a flow-type hypobaric
chamber at a temperature of 20°C to 25°C in which
atmospheric pressure was gradually reduced to 180
Torr reaching 5% of oxygen content (equivalent to
11,000  m above sea level) during 20  min. After 3  h of
treatment the oxygen content was returned to normal
within 20  min. Pregnant dams were treated under
such conditions for 3 consecutive days (14th, 15th,
and 16th days of pregnancy) with an interval of 24  h
between the sessions. Mortality rate in the hypobaric
chamber was around 15%. Intact control females were
also placed in the hypobaric chamber for 3  h on the
14th, 15th, and 16th days of pregnancy without being
subjected to hypoxic or hypobaric exposure. Gestation
period was 22-23 days.
Colorimetric methods. To collect brain samples
for colorimetric analysis, tissues from embryonic (e15,
e16, e17, e20) and newborn (p1) brains of both con-
trol and PSH rats were dissected and frozen in liquid
nitrogen. Each rat group consisted of randomly select-
ed embryos or pups from different dams to minimize
litter bias.
Measurement of choline acetyltransferase activity.
ChAT activity was analyzed using a colorimetric assay
kit (E-BC-K125-M; Elabscience, USA). Dissected brain
samples were washed and homogenized in PBS (0.01  M,
pH  7.4) at 4°C and centrifuged at 10,000g for 10  min to
isolate cytosolic proteins. The assay procedures were
VETROVOY et al.1952
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
conducted following the manufacturer’s protocol, and
absorbance was measured at 324  nm using a micro-
plate reader (CLARIOstar PLUS, BMG Labtech, Germa-
ny). Amount of coenzyme A generated during the re-
action was determined using a standard curve. ChAT
activity was calculated as nanomoles of coenzyme A
generated per minute per milligram of total protein.
Both here and in the other biochemical tests below,
total protein in the samples was measured using a
Pierce Rapid Gold Bicinchoninic Acid Protein Assay
Kit (Thermo Fisher Scientific, USA) according to the
manufacturer’s protocol.
Measurement of acetylcholinesterase activity.
AChE activity was analyzed using a colorimetric as-
say kit (E-BC-K052-S; Elabscience). Dissected brain
samples were washed and homogenized in 0.9%  NaCl
at 4°C. The assay procedures were conducted fol-
lowing the manufacturer’s protocol, and absorbance
was measured at 520 nm using a microplate reader
(CLARIOstar PLUS, BMG Labtech). Amount of acetyl-
choline remaining after the reaction was determined
using a standard curve. AChE activity was calculated
as nanomoles of acetylcholine hydrolyzed per minute
per milligram of total protein.
Measurement of acetylcholine levels. Acetylcholine
levels were analyzed using a colorimetric ELISA kit
(E-EL-0081; Elabscience). Dissected brain samples were
washed and homogenized in PBS (0.01  M, pH  7.4) at
4°C and centrifuged at 5000g for 10  min to isolate su-
pernatant containing acetylcholine. The assay proce-
dures were conducted following the manufacturer’s
protocol, and absorbance was measured at 450  nm
using a microplate reader (CLARIOstar PLUS, BMG
Labtech). Amount of acetylcholine was quantified us-
ing a standard curve, calculated and expressed as pi-
comoles per milligram of total protein.
Chronic treatment with nicotine in adult rats.
Rat pups were weaned at 30 days of age, a time when
dams spent no more than 2  h nursing [24]. This post-
partum day aligns with our prior studies on prenatal
pathologies, mitigating the stress typically associated
with weaning. After weaning, the rats were housed
in cages 60  ×  30  ×  20  cm in size, with 5-6 animals in
each. Each rat group consisted of randomly selected
rats born from different dams to minimize litter bias.
The rats received food and water ad  libitum and were
kept on a 12  :  12-h dark-light cycle at room tempera-
ture with a constant humidity of approximately 60%.
For the experimental procedures, we used adult male
offspring with active spermatogenesis from the con-
trol and PSH groups at the age of 3 months. On day1,
osmotic minipumps (2002W, RWD Systems, China)
were subcutaneously implanted into the rats under
isoflurane anesthesia and a nicotine tartrate solution
was pumped at a flow rate of 0.5  μl/h. Nicotine con-
centration in the pumps was adjusted for the differ-
ences in rat body weight, resulting in a continuous
subcutaneous infusion of nicotine tartrate at a rate
of 9  mg/kg per day. In the nicotine-naive control and
PSH rats minipumps were filled with saline (vehicle).
After two weeks of nicotine or vehicle consumption,
the rats were scarified by guillotine, and samples
of brain structures were collected for PCR analysis.
Quantitative RT PCR. Total RNA from embryon-
ic (e15, e16, e17, e20) and newborn (p1) brain sam-
ples of the control and PSH rats, as well as from the
samples of hippocampus (HPC), medial prefrontal
cortex (PFC), amygdala (AMG), nucleus accumbens
(NAcc), thalamic paraventricular nucleus (PVN), hypo-
thalamus(HT), and VTA of adult rats (two weeks after
nicotine or vehicle consumption) was isolated using an
ExtractRNA Kit (BC032, Evrogen, Russia) and purified
using DNAseI (SB-G3342, Servicebio, China) according
to the manufacturers’ instructions. Quality and concen-
tration of total RNA were determined by measuring
optical density at 260  nm and 280  nm using a mi-
croplate reader (CLARIOstar PLUS, BMG Labtech).
cDNA templates were synthesized from 2 μg of total
RNA using a MMLV Reverse Transcription Kit (SK021,
Evrogen). Quantitative reverse transcription poly-
merase chain reaction (RT PCR) was carried out with
a qPCRmix-HS SYBR+LowROX kit (Evrogen) using a
Gentier 96E Thermal Cycler (Tianlong, China). Expres-
sion levels of the target acetylcholine receptor sub-
unit alpha-4 (chrna4) and acetylcholine receptor sub-
unit alpha-7 (chrna7) genes were estimated using the
ΔΔCt method with normalization to β-tubulin mRNA
content as a reference gene. We used the following
primer sequences: chrna4, forward: GGTGAAGGAGG
ACTGGAA, reverse: AAGGCAGACAATGATGAACA (an-
nealing temperature 58°C, 78  bp product); chrna7,
forward: CTCTTGGAATAACTGTCTT, reverse: CGAAGT
ATTGTGCTATCA (annealing temperature 58°C, 105  bp
product); β-tubulin, forward: TAGAGGAGATGCTACTTA,
reverse: AATGGTGATAATACTGTTAA (annealing tem-
perature 58°C, 147  bp product).
Western blotting. To confirm the effect of chang-
es in chrna7 mRNA expression on the CHRNA7 protein
levels in the brain structures of adult control and PSH
rats we used Western blotting. To obtain total protein
extracts for Western blotting, samples of HPC, PFC,
AMG, NAcc, PVN, HT, and VTA were homogenized in
a 50  mM Tris-HCl (pH  8.0) containing 150  mM NaCl,
1%  Triton X100 and a cocktail of protease and phos-
phatase inhibitors (SB-G2006, SB-G2007, Servicebio).
Homogenates were incubated on a shaker for 30min
at 4°C, centrifuged for 10  min at 14,000g, and super-
natants were collected. The samples containing equal
amounts of total protein were boiled for 10  min at
70°C with a 3x Laemmli buffer.
Proteins were separated by sodium dodecyl sul-
fate-polyacrylamide gel electrophoresis (SDS-PAGE)
PRENATAL HYPOXIA 1953
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
and next transferred to PVDF membranes (Thermo
Scientific, USA). After blocking for 1  h in PBS con-
taining 5% skim milk, the membranes were incubat-
ed in PBS with rabbit anti-CHRNA7 (1  :  2000, DF13247,
Affinity Biosciences, USA) and anti-β-Tubulin (1  :  5000,
ab179513, Abcam, UK) primary antibodies for 2  h
at room temperature.
The membranes were then washed thrice with
PBST (PBS with 0.1%  Tween  20) and incubated in
PBS with HRP-conjugated anti-rabbit secondary an-
tibodies (1  :  5000, E-AB-1003, Elabscience) for 1  h at
room temperature. The membranes were next washed
twice with PBST. Immunoreactive protein bands were
visualized using a Clarity ECL chemiluminescence
kit (Bio-Rad, USA) with a ChemiScope 6000 Imaging
System (Clinx Science Instruments, China). Protein
levels were quantified using ImageJ software (NIH,
USA) and normalized to β-Tubulin. Full images of the
Western blots are presented in the Online Resource 1
(Fig. S1).
Statistical analysis. Statistical analysis was
performed using Prism  10 (GraphPad, Inc.). All sam-
ples were assessed for normal distribution using the
Shapiro–Wilk test (p  >  0.05) and QQ-plot. One- or two-
way ANOVA was used as a parametric test. Post  hoc
comparisons were performed using Tukey’s honest sig-
nificance test. Statistical significance was set at p  <  0.05.
The results are expressed as a mean  ±  standard error
of the mean (SEM). For RT PCR and Western blotting,
the mean and SEM were recalculated as% of a respec-
tive age control, taken as 100%.
RESULTS
Impact of prenatal hypoxia on acetylcholine
metabolism in the rat brain during prenatal and
early postnatal development. To investigate the effect
of prenatal hypoxia on acetylcholine metabolism, we
measured activity of choline acetyltransferase (ChAT),
an enzyme that synthesizes this neurotransmitter, as
well as activity of acetylcholinesterase (AChE), an en-
zyme that degrades acetylcholine, in the developing
brain of rat embryos during the third week of preg-
nancy (e15, e16, e17, e20) and in the newborn rats
(p1) (Fig. 1, a, b). We did not detect any changes in
the activity of these enzymes in the brain of PSH rats
compared to the controls. In the brain of PSH rats, we
observed no alterations in the activity of ChAT and
AChE. Likewise, there were no significant changes in
the concentration of acetylcholine across all periods
studied (Fig. 1c).
Impact of prenatal hypoxia on expression of
acetylcholine receptors mRNA in the rat brain
during prenatal and early postnatal development.
To evaluate the effect of prenatal hypoxia on the re-
ceptor part of acetylcholine neurotransmitter system,
we measured relative content of the acetylcholine
receptor subunit alpha-4 (chrna4) and acetylcholine
receptor subunit alpha-7 (chrna7) mRNA in the de-
veloping brain during the third week of pregnancy
(e15, e16, e17, e20) and in the brains of newborn
rats (p1) (Fig. 2, a, b). Decrease in the relative
amount of chrna4 mRNA was found in the rat brain
one day after the first PSH session (Fig. 2a, e15,
ANOVA  F  (1,  9) = 10.2212, p = 0.0127; control vs. PSH,
p = 0.0126685, Tukey’s HST). During further prenatal
development and in the newborn PSH rats, no signif-
icant changes in the chrna4 expression in the brain
Fig. 1. Effect of PSH on ChAT (a) and AChE (b) activity and
acetylcholine(c) levels in the rat brain during prenatal (em-
bryonic days e15, e16, e17, e20) and early postnatal (postna-
tal dayp1) development, detected by colorimetric tests. n=5.
VETROVOY et al.1954
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
Fig. 2. Effect of PSH on chrna4 (a) and chrna7 (b) mRNA
expression levels in the rat brain during prenatal (embryonic
days e15, e16, e17, e20) and early postnatal (postnatal day p1)
development, detected by RT PCR. *  Significant differences
vs. relative control, p < 0.05 (one-way ANOVA, Tukey HST).
n=5.
were detected. In addition, we found increase in the
relative amount of the chrna7 mRNA both 24  h after
the first PSH session (Fig. 2b, e15, ANOVA  F  (1,  9)  =
=  7.2211, p  =  0.0276; control vs. PSH, p = 0.0276166,
Tukey’s HST) and one day after the second PSH session
(Fig.2b, e16, ANOVA F (1,9)=6.6590, p =0.0326; con-
trol vs. PSH, p = 0.0325905, Tukey’s HST). Throughout
further prenatal development and in the newborn PSH
rats, no significant changes in the chrna7 expression
in the brain were detected. Thus, despite the lack of
effect on acetylcholine metabolism, prenatal hypoxia
causes changes in the expression of acetylcholine re-
ceptors in the developing brain.
Impact of prenatal hypoxia on the expression
of acetylcholine receptors mRNA in the rat brain
structures in normal adult animals and in animals
exposed to nicotine. To study long-term consequences
of prenatal hypoxia on the expression of acetylcholine
receptors in the rat brain, we measured relative con-
tent of chrna4 and chrna7 mRNA in the limbic system
structures (HPC, PFC, AMG, NAcc, PVN, HT, VTA) of the
adult (3-month-old) control and PSH rats, both before
and after two weeks of stable nicotine consumption
via osmotic pumps.
When assessing relative amount of mRNA, sig-
nificant decreases in the expression of chrna4 gene
caused by PSH was observed in the PFC (Fig. 3b,
two-way ANOVA Group × Nicotine  F  (1,  16)  =  9.872,
p  =  0.0063; control vs. PSH, p  =  0.0399817, Tukey’s HST),
NAcc (Fig.  3d, ANOVA Group × Nicotine  F  (1,  16)  =
=  5.644, p  =  0.0304; control vs. PSH, p  =  0.0190, Tukey’s
HST), and HT (Fig. 3f, two-way ANOVA Group × Nic-
otine  F  (1,  16)  =  9.673, p  =  0.0067; control vs. PSH, p =
=  0.0061796, Tukey’s HST), with no effect on HPC
(Fig.3a), AMG (Fig.3c), PVN (Fig.3e), and VTA (Fig.3g).
Moreover, following two weeks of nicotine consump-
tion, the amount of chrna4 mRNA in the brains of
control rats significantly decreased to the values
comparable to those of the PSH rats in HPC (Fig.  3a,
two-way ANOVA Nicotine  F  (1,  17)  =  9.989, p  =  0.0057;
control vs. control  +  nicotine, p  =  0.0057263, Tukey’s
HST), PFC (Fig.  3b, two-way ANOVA Group × Nico-
tine  F  (1,  16)  =  9.872, p  =  0.0063, p  =  0.0234; control vs.
control  +  nicotine, p  =  0.0022758, Tukey’s HST), NAcc
(Fig. 3d, two-way ANOVA Group × Nicotine  F  (1,  16)  =
=  5.644, p  =  0.0304; control vs. control  +  nicotine, p =
=  0.0421275, Tukey’s HST) and HT (Fig.  3f, two-way
ANOVA Group × Nicotine  F  (1,  16)  =  9.673, p  =  0.0067;
control vs. control  +  nicotine, p  =  0.0157127, Tukey’s
HST). In contrast, nicotine consumption by the PSH
rats did not induce alterations in the chrna4 mRNA
content across all brain structures when compared to
the intact PSH rats (Fig. 3).
When assessing relative amount of chrna7 mRNA
in the brains of adult rats, PSH was found to cause
significant decrease of the gene expression in the HPC
(Fig. 3h, two-way ANOVA Group × Nicotine  F  (1,  16)  =
=  7.945, p  =  0.0124; control vs. PSH, p  =  0.038 Tukey’s
HST) and PFC (Fig.  3i, two-way ANOVA Group × Nic-
otine  F  (1,  16)  =  9.55, p  =  0.00702; control vs. PSH, p =
=  0.0157, Tukey’s HST), while leaving the AMG (Fig.  3j),
PVN (Fig.  3k), NAcc (Fig.  3l), HT (Fig.  3m) and VTA
(Fig.  3n) unaffected. Association between the changes
in chrna7 mRNA levels and the patterns of CHRNA7
protein expression in the brain structures of adult
control and PSH rats was subsequently tested by West-
ern blotting (Fig.  4). Similar to the changes in rela-
tive mRNA levels, PSH was found to cause decrease
in the CHRNA7 protein levels in the HPC (Fig.  4a,
ANOVA  F  (1,  9)  =  5.6864, p  =  0.0442; control vs. PSH,
p =  0.0442243, Tukey’s HST) and PFC (Fig.  4b, ANOVA
F  (1,  9)  =  11.9926, p  =  0.0085; control vs. PSH, p =
=  0.0085305, Tukey’s HST), but not in AMG (Fig.  4c), PVN
(Fig.  4d), NAcc (Fig.  4e), HT (Fig.  4f) and VTA (Fig.  4g).
Furthermore, following two weeks of nicotine
consumption, the amount of chrna7 mRNA in the
brains of control rats significantly decreased to the
levels observed in the HPC of the PSH rats (Fig.  3h,
two-way ANOVA Group × Nicotine  F  (1,  16)  =  7.945,
p  =  0.0124; control vs. control + nicotine, p  =  0.0103,
PRENATAL HYPOXIA 1955
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
Fig. 3. Effects of PSH and nicotine consumption on chrna4 (a-g) and chrna7 (h-n) mRNA expression levels in the HPC(a,h),
PFC (b, i), AMG(c, j), NAcc (d, k), PVN(e, l), HT (f,m), VTA (g,n) of adult rats, detected by RT PCR. *  Significant differences
vs. control, p < 0.05 (two-way ANOVA, Tukey HST). n=5.
Tukey’s HST) and PFC (Fig.  3i, two-way ANOVA
Group × Nicotine  F  (1,  16)  =  9.55, p  = 0.00702; control
vs. control+ nicotine, p  =  0.0156, Tukey’s HST). Mean-
while, in the brains of PSH rats, nicotine consumption
did not cause changes in the chrna7 mRNA levels com-
pared to the intact PSH rats.
VETROVOY et al.1956
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
Fig. 4. Effects of PSH on CHRNA7 protein expression levels in the HPC(a), PFC(b), AMG(c), NAcc(d), PVN(e), HT(f), VTA(g)
of adult rats, detected by western blotting. *  Significant differences vs. control, p<0.05 (one-way ANOVA, Tukey HST). n=5.
a
e
b
f
c
g
d
DISCUSSION
Environmental factors exert significant impacts
on the developing organism. Conditions for forma-
tion of individual organs and tissues of the fetus
predetermine their subsequent life activities [25-27].
During a normal pregnancy, there is high efficiency
in providing energy substrates essential for intensive
processes of cell proliferation, migration, and estab-
lishment of connections between the brain cells [28].
Moreover, steroid hormone supply is restricted until
the later stages of pregnancy, when glucocorticoids
are involved in the processes such as terminal differ-
entiation of neuronal cells and lung maturation [29-
32]. Restriction of oxygen supply to an embryo causes
significant metabolic disorder, resulting in the devel-
opmental deceleration [25-27, 33, 34], whereas exces-
sive infiltration of glucocorticoids may disrupt forma-
tion of an adequate tissue-specific expression profile,
which could remain throughout the life at epigenetic
level [16, 17, 35, 36].
Hypoxia is inevitably accompanied by the shift
of cellular metabolism towards anaerobic metabolism
regulated by hypoxia-inducible factors (HIF) [37], and
decline in aerobic energy metabolism, resulting in the
reduced production of ATP [38,  39], which is required,
in particular, for the synthesis of acetylcholine  [40].
However, severity of the effects of hypoxia and ma-
ternal stress can vary significantly depending on the
time of the developing brain exposure [12]. Thus, when
prenatal hypoxia was induced on the days 14-16 of
embryonic development, no significant changes were
observed in the activity of both choline acetyltransfer-
ase and acetylcholinesterase. Consequently, this lack
of change did not affect concentration of acetylcholine
in the developing embryonic and early postnatal rat
brain. This finding contrasts with the prior studies,
including our own, which demonstrated intensifica-
tion of the hypoxia-dependent signaling during both
embryogenesis and the postnatal period [26, 41-45].
At the same time, at the early stages of hypoxic ep-
isodes, decrease in the transcription of chrna4 (e15)
and, potentially, glucocorticoid-dependent increase in
the transcription of chrna7 (e15, e16) was shown [11,
19]. During this period of brain development, cholin-
ergic brain structures have been already formed [12,
46], which could help to increase resistance of the
acetylcholine-producing neurons to external stressors.
PRENATAL HYPOXIA 1957
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
However, at this moment formation of the acetylcho-
line-receptive GABAergic neurons within the regions
such as ventral striatum, hippocampus, prefrontal cor-
tex, and amygdala is just beginning [12, 14, 47]. As a
consequence, these brain structures exhibit the most
striking disturbances in the expression of acetylcho-
line receptors in adulthood. These disturbances may
be considered either as a cause of, or as a compensa-
tory response to the increased excitability of the brain
cells reported by other authors [48]. We have previ-
ously shown that the prenatal hypoxia causes lifelong
changes in the expression of glucocorticoid receptors
in the hippocampus and prefrontal cortex, which is
accompanied by the decrease in glucocorticoid-depen-
dent transcription and disruption of glucocorticoid
negative feedback [11,  16,  17]. Moreover, the alpha-7
subunit of acetylcholine receptor has been identified
as a target of transcriptional activity of glucocorti-
coid receptors [19,  49]. Taking into consideration this
information, we detected decrease in the expression
of chrna7 mRNA and protein specifically in the hip-
pocampus and prefrontal cortex caused by prenatal
hypoxia. These glutamatergic brain structures activate
GABAergic neurons in the striatum, which is accom-
panied by the increased dopamine release from the
neurons in the ventral tegmental area, inducing a
phenomenon known as intrinsic reinforcement [50-
52]. Decline in the efficiency of glutamate release,
attributed to the reduced expression of chrna4 and
chrna7 in the prefrontal cortex, chrna7 in the hippo-
campus, and chrna4 in the striatum of the adult rats
due to prenatal hypoxia, could explain the previously
described tendency of these animals towards nico-
tine addiction and pronounced withdrawal syndrome
[10, 11]. Moreover, amygdalar neurons are known to
indirectly inhibit action potentials in the cells of the
ventral striatum [53,  54]. Concurrently, our findings
did not reveal changes in the expression of chrna4
and chrna7 in the amygdala, which could also contrib-
ute to the disruption of the limbic system as a result
of prenatal hypoxia. Finally, hypothalamic neurons
exhibit capacity for the increased stimulation of do-
pamine neurons in the ventral tegmental area [55],
while concurrently exhibit reduction in the relative
chrna4 expression.
The process of developing resistance to nicotine,
which determines development of the dependence
on further consumption, is widely acknowledged in
clinical practice. It is known that one of the mecha-
nisms of such resistance is the decrease in expression
of acetylcholine receptors, including alpha-4 and al-
pha-7 subunits [56-61]. Interestingly, after one week
of nicotine administration, decrease in the expression
of chrna4 (HPC, PFC, NAcc, HT) and chrna7 (HPC, PFC)
was observed solely in the control group. Converse-
ly, the initially low expression of these genes in the
brains of rats exposed to prenatal hypoxia remained
unchanged at the low level.
Therefore, prenatal hypoxia does not affect activ-
ity of acetylcholine synthesis and degradation in the
developing brain. However, it does causes significant
disturbances in the expression of acetylcholine recep-
tors alpha-4 and alpha-7 within the limbic structures
of rats. These disturbances may underlie the previ-
ously observed tendency to nicotine consumption and
manifestation of severe withdrawal syndrome upon
cessation.
Supplementary information. The online version
contains supplementary material available at https://
doi.org/10.1134/S0006297924110099.
Acknowledgments. The authors are deeply grate-
ful to Elena Axenova for her excellent technical assis-
tance in animal model experiments.
Contributions. Conceptualization, O.V.V.; meth-
odology, O.V.V., V.A.S., and E.I.T.; formal analysis, O.V.V.
and V.A.S.; investigation, O.V.V., V.A.S., S.S.P., and E.I.T.;
writing– original draft preparation, O.V.V.; writing– re-
view and editing, O.V.V., V.A.S., and E.I.T.; visualization,
O.V.V. and V.A.S.; supervision, O.V.V.; project adminis-
tration, O.V.V.; funding acquisition, O.V.V. All authors
have read and agreed to the published version of the
manuscript.
Funding. This work was financially supported
by the Russian Science Foundation (grant no. 22-75-
00003).
Ethics declarations. Animal experiments were
performed in accordance with The Guidelines for Re-
porting Animal Research. This study protocol was re-
viewed and approved by the local ethics committee of
the Pavlov Institute of Physiology (protocol no. 08/02
of 02.08.2022). The authors declare that they have
noconflicts of interest.
REFERENCES
1. WHO global report on trends in prevalence of to-
bacco use 2000-2025, fourth edition, accessed Octo-
ber 27, 2023, URL: https://www.who.int/publications/
i/item/9789240039322.
2. Mineur, Y. S., and Picciotto, M. R. (2008) Genetics of
nicotinic acetylcholine receptors: Relevance to nic-
otine addiction, Biochem. Pharmacol., 75, 323-333,
https://doi.org/10.1016/j.bcp.2007.06.010.
3. Gorwood,P., Le Strat,Y., and Ramoz,N. (2017) Genet-
ics of addictive behavior: the example of nicotine de-
pendence, Dialog. Clin. Neurosci., 19, 237-245, https://
doi.org/10.31887/DCNS.2017.19.3/pgorwood.
4. Nestler, E. J. (2014) Epigenetic mechanisms of drug
addiction, Neuropharmacology, 76, 259-268, https://
doi.org/10.1016/j.neuropharm.2013.04.004.
VETROVOY et al.1958
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
5. Muenstermann, C., and Clemens, K.J. (2024) Epigen-
etic mechanisms of nicotine dependence, Neurosci.
Biobehav. Rev., 156, 105505, https://doi.org/10.1016/
j.neubiorev.2023.105505.
6. Reynaert, M. L., Marrocco, J., Gatta, E., Mairesse, J.,
Van Camp,G., Fagioli,F., Maccari,S., Nicoletti,F., and
Morley-Fletcher, S. (2015) A self-medication hypothe-
sis for increased vulnerability to drug abuse in pre-
natally restraint stressed rats, Adv. Neurobiol., 10, 101-
120, https://doi.org/10.1007/978-1-4939-1372-5_6.
7. Pastor, V., Antonelli, M. C., and Pallarés, M.E. (2016)
Unravelling the link between prenatal stress, dopa-
mine and substance use disorder, Neurotox. Res., 31,
169-186, https://doi.org/10.1007/s12640-016-9674-9.
8. Said, N., Lakehayli,S., El Khachibi, M., El Ouahli,M.,
Nadifi, S., Hakkou, F., and Tazi, A. (2015) Prenatal
stress induces vulnerability to nicotine addiction
and alters D2 receptors’ expression in the nucleus
accumbens in adult rats, Neuroscience, 304, 279-285,
https://doi.org/10.1016/j.neuroscience.2015.07.029.
9. Stratilov, V. A., Tyulkova, E. I., and Vetrovoy, O. V.
(2020) Prenatal stress as a factor of the development
of addictive states, J.Evol. Biochem. Physiol., 56, 471-
490, https://doi.org/10.1134/S0022093020060010.
10. Stratilov, V. A., Vetrovoy, O. V., and Tyulkova, E. I.
(2022) Prenatal hypoxia affects nicotine consumption
and withdrawal in adult rats via impairment of the
glutamate system in the brain, Mol. Neurobiol., 59,
4550-4561, https://doi.org/10.1007/s12035-022-02866-8.
11. Stratilov, V., Vetrovoy, O., Potapova, S., and
Tyulkova, E. (2024) The prenatal hypoxic pathology
associated with maternal stress predisposes to dys-
regulated expression of the chrna7 gene and the sub-
sequent development of nicotine addiction in adult
offspring, Neuroendocrinology, 114, 423-438, https://
doi.org/10.1159/000536214.
12. Golan, H., and Huleihel,M. (2006) The effect of pre-
natal hypoxia on brain development: short- and long-
term consequences demonstrated in rodent models,
Dev. Sci., 9, 338-349, https://doi.org/10.1111/j.1467-
7687.2006.00498.x.
13. Prestoz, L., Jaber, M., and Gaillard, A. (2012) Dopa-
minergic axon guidance: which makes what? Front.
Cell. Neurosci., 6, 32, https://doi.org/10.3389/fncel.
2012.00032.
14. Bayer, S. A. (1980) Development of the hippocampal
region in the rat. II. Morphogenesis during embryonic
and early postnatal life, J.Comp. Neurol., 190, 115-134,
https://doi.org/10.1002/cne.901900108.
15. Tsuji, M., Coq, J. O., Ogawa, Y., Yamamoto, Y., and
Ohshima, M. (2018) A rat model of mild intrauterine
hypoperfusion with microcoil stenosis, J. Vis. Exp., 7,
56723, https://doi.org/10.3791/56723.
16. Vetrovoy,O., Stratilov,V., Lomert,E., and Tyulkova,E.
(2023) Prenatal hypoxia-induced adverse reaction to
mild stress is associated with depressive-like chang-
es in the glucocorticoid system of rats, Neurochem.
Res., 48, 1455-1467, https://doi.org/10.1007/s11064-
022-03837-0.
17. Vetrovoy, O., Tyulkova,E., Stratilov, V., Baranova,K.,
Nimiritsky, P., Makarevich, P., and Rybnikova, E.
(2021) Long-term effects of prenatal severe hypoxia
on central and peripheral components of the gluco-
corticoid system in rats, Dev. Neurosci., 42, 145-158,
https://doi.org/10.1159/000512223.
18. Vetrovoy,O., Stratilov,V., Nimiritsky,P., Makarevich,P.,
and Tyulkova,E. (2021) Prenatal hypoxia induces pre-
mature aging accompanied by impaired function of
the glutamatergic system in rat hippocampus, Neu-
rochem. Res., 46, 550-563, https://doi.org/10.1007/
s11064-020-03191-z.
19. Carrasco-Serrano,C., and Criado,M. (2004) Glucocor-
ticoid activation of the neuronal nicotinic acetylcho-
line receptor α7 subunit gene: involvement of tran-
scription factor Egr-1, FEBS Lett., 566, 247-250, https://
doi.org/10.1016/j.febslet.2004.04.049.
20. Gibson, G.E., and Blass, J.P. (1976) Impaired synthesis
of acetylcholine in brain accompanying mild hypoxia
and hypoglycemia, J. Neurochem., 27, 37-42, https://
doi.org/10.1111/j.1471-4159.1976.tb01540.x.
21. Gibson, G.E., Peterson,C., and Sansone, J. (1981) De-
creases in amino acids and acetylcholine metabolism
during hypoxia, J. Neurochem., 37, 192-201, https://
doi.org/10.1111/j.1471-4159.1981.tb05308.x.
22. López-Pérez, S. J., Morales-Villagrán, A., Ventura-
Valenzuela, J., and Medina-Ceja,L. (2012) Short- and
long-term changes in extracellular glutamate and ace-
tylcholine concentrations in the rat hippocampus fol-
lowing hypoxia, Neurochem. Int., 61, 258-265, https://
doi.org/10.1016/j.neuint.2012.03.009.
23. Kilkenny,C., Browne, W.J., Cuthill, I.C., Emerson,M.,
and Altman, D. G. (2010) Improving bioscience re-
search reporting: The arrive guidelines for report-
ing animal research, PLoS Biol., 8, e1000412, https://
doi.org/10.1371/journal.pbio.1000412.
24. Cramer, C.P., Thiels,E., and Alberts, J.R. (1990) Wean-
ing in rats: I. Maternal behavior, Dev. Psychobiol., 23,
479-493, https://doi.org/10.1002/dev.420230604.
25. Ducsay, C. A., Goyal, R., Pearce, W. J., Wilson,S., Hu,
X. Q., and Zhang, L. (2018) Gestational hypoxia and
developmental plasticity, Physiol. Rev., 98, 1241-1334,
https://doi.org/10.1152/physrev.00043.2017.
26. Nalivaeva, N. N., Turner, A. J., and Zhuravin, I. A.
(2018) Role of prenatal hypoxia in brain develop-
ment, cognitive functions, and neurodegeneration,
Front. Neurosci., 12, 825, https://doi.org/10.3389/fnins.
2018.00825.
27. Piešová,M., and Mach,M. (2020) Impact of perinatal
hypoxia on the developing brain, Physiol. Res., 69,
199-213, https://doi.org/10.33549/physiolres.934198.
28. Erecinska, M., Cherian, S., and Silver, I. A. (2004)
Energy metabolism in mammalian brain during
PRENATAL HYPOXIA 1959
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
development, Prog. Neurobiol., 73, 397-445, https://
doi.org/10.1016/j.pneurobio.2004.06.003.
29. Pofi, R., and Tomlinson, J.W. (2020) Glucocorticoids
in pregnancy, Obstet. Med., 13, 62-69, https://doi.org/
10.1177/1753495X19847832.
30. Grier, D.G., and Halliday, H. L. (2004) Effects of glu-
cocorticoids on fetal and neonatal lung develop-
ment, Treat. Respir. Med., 3, 295-306, https://doi.org/
10.2165/00151829-200403050-00004.
31. Tsiarli, M. A., Rudine, A., Kendall, N., Pratt, M. O.,
Krall, R., Thiels, E., DeFranco, D. B., and Monaghan,
A. P. (2017) Antenatal dexamethasone exposure dif-
ferentially affects distinct cortical neural progenitor
cells and triggers long-term changes in murine cere-
bral architecture and behavior, Transl. Psychiatry, 7,
e1153, https://doi.org/10.1038/tp.2017.65.
32. Odaka, H., Adachi, N., and Numakawa, T. (2017) Im-
pact of glucocorticoid on neurogenesis, Neural Re-
gen. Res., 12, 1028-1035, https://doi.org/10.4103/1673-
5374.211174.
33. Barrett, R. D., Bennet, L., Davidson, J., Dean, J. M.,
George, S., Emerald, B. S., and Gunn, A. J. (2007) De-
struction and reconstruction: hypoxia and the devel-
oping brain, Birth Defects Res. C Embryo Today, 81,
163-176, https://doi.org/10.1002/bdrc.20095.
34. Wang, B., Zeng,H., Liu, J., and Sun, M. (2021) Effects
of prenatal hypoxia on nervous system development
and related diseases, Front. Neurosci., 25, 755554,
https://doi.org/10.3389/fnins.2021.755554.
35. Weaver, I.C., Cervoni,N., Champagne, F.A., D’Alessio,
A.C., Sharma,S., Seckl, J.R., Dymov, S., Szyf, M., and
Meaney, M. J. (2004) Epigenetic programming by ma-
ternal behavior, Nat. Neurosci., 7, 847-854, https://
doi.org/10.1038/nn1276.
36. Abul, M., Al-Bader, M. D., and Mouihate, A. (2022)
Prenatal activation of glucocorticoid receptors induc-
es memory impairment in a sex-dependent manner:
role of cyclooxygenase-2, Mol. Neurobiol., 59, 3767-
3777, https://doi.org/10.1007/s12035-022-02820-8.
37. Goda, N., and Kanai, M. (2012) Hypoxia-inducible
factors and their roles in energy metabolism, Int. J.
Hematol., 95, 457-463, https://doi.org/10.1007/s12185-
012-1069-y.
38. Watts, M. E., Pocock, R., and Claudianos, C. (2018)
Brain energy and oxygen metabolism: emerging role
in normal function and disease, Front. Mol. Neurosci.,
11, 216, https://doi.org/10.3389/fnmol.2018.00216.
39. Vetrovoy, O.V., Rybnikova, E.A., and Samoilov, M. O.
(2017) Cerebral mechanisms of hypoxic/ischemic
postconditioning, Biochemistry (Moscow), 82, 392-400,
https://doi.org/10.1134/S000629791703018X.
40. Sha,D., Jin,H., Kopke, R.D., and Wu, J.Y. (2004) Cho-
line acetyltransferase: regulation and coupling with
protein kinase and vesicular acetylcholine transport-
er on synaptic vesicles, Neurochem. Res., 29, 199-207,
https://doi.org/10.1023/b:nere.0000010449.05927.f9.
41. Vetrovoy, O. V., Nimiritsky, P. P., Tyulkova, E. I., and
Rybnikova, E. A. (2020) The content and activity of
hypoxia-inducible factor HIF1α increased in the hip-
pocampus of newborn rats that were subjected to
prenatal hypoxia on days 14-16 of embryogenesis,
Neurochem. J., 14, 286-289, https://doi.org/10.1134/
S1819712420030125.
42. Potapova, S. S., Zachepilo, T. G., Stratilov, V. A.,
Tyulkova, E. I., and Vetrovoy, O. V. (2023) Prenatal
hypoxia causes an increase in the content and tran-
scriptional activity of the hypoxia-inducible factor
HIF1α in the hippocampus of adult and aging rats,
Neurochem. J., 17, 751-754, https://doi.org/10.1134/
S1819712423330012.
43. Vetrovoy,O., Stratilov,V., Potapova,S., and Tyulkova,E.
(2023) Oxidative stress accompanies HIF1-depen-
dent impairment of glucose metabolism in the hip-
pocampus of adult rats survived prenatal severe
hypoxia, Dev. Neurosci., 46, 297-307, https://doi.org/
10.1159/000535326.
44. Trollmann, R., and Gassmann, M. (2009) The role of
hypoxia-inducible transcription factors in the hy-
poxic neonatal brain, Brain Dev., 31, 503-509, https://
doi.org/10.1016/j.braindev.2009.03.007.
45. Gonzalez-Rodriguez, P. J., Xiong, F., Li, Y., Zhou, J.,
and Zhang, L. (2014) Fetal hypoxia increases vul-
nerability of hypoxic-ischemic brain injury in neo-
natal rats: role of glucocorticoid receptors, Neuro-
biol. Dis., 65, 172-179, https://doi.org/10.1016/j.nbd.
2014.01.020.
46. Abreu-Villaça, Y., Filgueiras, C. C., and Manhães,
A. C. (2011) Developmental aspects of the choliner-
gic system, Behav. Brain Res., 221, 367-378, https://
doi.org/10.1016/j.bbr.2009.12.049.
47. Van Eden, C.G., Kros, J. M., and Uylings, H. B. (1990)
The development of the rat prefrontal cortex. Its
size and development of connections with thala-
mus, spinal cord and other cortical areas, Prog.
Brain Res., 85, 169-183, https://doi.org/10.1016/s0079-
6123(08)62680-1.
48. Amakhin, D. V., Soboleva, E. B., Postnikova, T. Y.,
Tumanova, N.L., Dubrovskaya, N.M., Kalinina, D.S.,
Vasilev, D.S., and Zaitsev, A.V. (2022) Maternal hypox-
ia increases the excitability of neurons in the entorhi-
nal cortex and dorsal hippocampus of rat offspring,
Front. Neurosci., 16, 867120, https://doi.org/10.3389/
fnins.2022.867120.
49. Hunter, R. G. (2012) Stress and the α7 nicotinic ace-
tylcholine receptor, Curr. Drug Targets, 13, 607-612,
https://doi.org/10.2174/138945012800398982.
50. Cho, Y. H., and Jeantet, Y. (2010) Differential involve-
ment of prefrontal cortex, striatum, and hippocampus
in DRL performance in mice, Neurobiol. Learn. Mem.,
93, 85-91, https://doi.org/10.1016/j.nlm.2009.08.007.
51. Wang, J.X., Kurth-Nelson,Z., Kumaran,D., Tirumala,D.,
Soyer,H., Leibo, J. Z., Hassabis,D., and Botvinick,M.
VETROVOY et al.1960
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
(2018) Prefrontal cortex as a meta-reinforcement
learning system, Nat. Neurosci., 21, 860-868, https://
doi.org/10.1038/s41593-018-0147-8.
52. Ballard, I.C., Wagner, A.D., and McClure, S.M. (2019)
Hippocampal pattern separation supports rein-
forcement learning, Nat. Commun., 10, 1073, https://
doi.org/10.1038/s41467-019-08998-1.
53. Costa, V.D., Dal Monte,O., Lucas, D.R., Murray, E.A.,
and Averbeck, B.B. (2016) Amygdala and ventral stri-
atum make distinct contributions to reinforcement
learning, Neuron, 92, 505-517, https://doi.org/10.1016/
j.neuron.2016.09.025.
54. Everitt, B. J., Parkinson, J. A., Olmstead, M. C.,
Arroyo, M., Robledo, P., and Robbins, T. W. (1999)
Associative processes in addiction and reward. The
role of amygdala-ventral striatal subsystems, Ann.
NY Acad. Sci., 877, 412-438, https://doi.org/10.1111/
j.1749-6632.1999.tb09280.x.
55. Douma, E.H., and de Kloet, E.R. (2020) Stress-induced
plasticity and functioning of ventral tegmental dopa-
mine neurons, Neurosci. Biobehav. Rev., 108, 48-77,
https://doi.org/10.1016/j.neubiorev.2019.10.015.
56. Hutchison, K.E., Allen, D.L., Filbey, F. M., Jepson,C.,
Lerman, C., Benowitz, N. L., Stitzel,J., Bryan, A., Mc-
Geary, J., and Haughey, H. M. (2007) CHRNA4 and to-
bacco dependence: from gene regulation to treatment
outcome, Arch. Gen. Psychiatry, 64, 1078-1086, https://
doi.org/10.1001/archpsyc.64.9.1078.
57. Mexal,S., Berger,R., Logel,J., Ross, R.G., Freedman,R.,
and Leonard, S. (2010) Differential regulation of
alpha7 nicotinic receptor gene (CHRNA7) expression
in schizophrenic smokers, J. Mol. Neurosci., 40, 185-
195, https://doi.org/10.1007/s12031-009-9233-4.
58. Liu, X. (2014) Effects of blockade of α4β2 and α7
nicotinic acetylcholine receptors on cue-induced re-
instatement of nicotine-seeking behaviour in rats,
Int. J. Neuropsychopharmacol., 17, 105-116, https://
doi.org/10.1017/S1461145713000874.
59. O’Connor, E. C., Parker, D., Rollema, H., and Mead,
A. N. (2010) The α4β2 nicotinic acetylcholine-recep-
tor partial agonist varenicline inhibits both nicotine
self-administration following repeated dosing and re-
instatement of nicotine seeking in rats, Psychophar-
macology, 208, 365-376, https://doi.org/10.1007/s00213-
009-1739-5.
60. McGranahan, T. M., Patzlaff, N. E., Grady, S. R.,
Heinemann, S. F., and Booker, T. K. (2011) α4β2 nic-
otinic acetylcholine receptors on dopaminergic neu-
rons mediate nicotine reward and anxiety relief,
J. Neurosci., 31, 10891-10902, https://doi.org/10.1523/
jneurosci.0937-11.2011.
61. Ramachandran, N. L., and Liu, X. (2019) Targeting
the α4β2- and α7-subtypes of nicotinic acetylcholine
receptors for smoking cessation medication develop-
ment, J.Addict. Res. Ther., 10, 381.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in published
maps and institutional affiliations. AI tools may have
been used in the translation or editing of this article.