ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 11, pp. 1911-1921 © Pleiades Publishing, Ltd., 2024.
1911
Study of Neuroinflammation
in the Rat Hippocampus during Ethanol Exposure
and Pharmacological Correction with Azithromycin:
New Data and Future Perspectives
Marat I. Airapetov
1,2,a
*, Sergei O. Eresko
1,3
, Sofiia A. Shamaeva
1
,
Evgenii R. Bychkov
1
, Andrei A. Lebedev
1
, and Petr D. Shabanov
1,2
1
Institute of Experimental Medicine, 197376 St. Petersburg, Russia
2
Military medical academy of S.M. Kirov, 194044 St. Petersburg, Russia
3
Saint-Petersburg National Research University of Information Technologies, Mechanics and Optics,
197022 St. Petersburg, Russia
a
e-mail: interleukin1b@gmail.com
Received June 2, 2024
Revised July 7, 2024
Accepted October 9, 2024
Abstract— With prolonged ethanol ingestion, disturbances in the emotional spectrum develop, and memory
problems are noted. These symptoms could be mediated by the development of neurochemical changes in
the hippocampus of the brain. Although there is evidence that hippocampus is vulnerable to chronic alcohol
intoxication and that neuroinflammation and neurodegeneration develop in this brain region, the key molec-
ular mechanisms have not been identified. The aim of the study was to investigate changes in the immune
system in the periphery as well as in the hippocampus of rat brain during ethanol exposure and during
pharmacological correction with azithromycin (AZM). Long-term ethanol exposure was modeled by injecting
rats with a 20% ethanol solution (4 g/kg) for 4 weeks. General biochemical and clinical blood analysis was
performed in animals. Expression levels of the cytokine genes (Il1β, Ccl2, Il6, Il11, Il13, Tnfα, Tgfβ), Toll-like
receptor system genes (Tlr3, Tl4, Tlr7, Nfkb1, Hmgb1), and TLR system-related microRNA molecules (miR-182,
miR-155-5p, miR-96-5p, miR-let-7b) were evaluated in the hippocampus. IL-1β protein content was also assessed
in the hippocampus. Prolonged exposure to alcohol caused increase in the mRNA and protein levels of IL-1β,
and decrease in the mRNA levels of Tnfα, Il11, Tlr3, and Tlr7. The contents of miRlet7b, miR96, and miR155
were downregulated in the hippocampus after long-term alcohol exposure. Elevated levels of THE Il1β mRNA
and protein and Hmgb1 mRNA were maintained under conditions of ethanol abstinence. The Tlr3 mRNA
levels were decreased after abstinence. Administration of AZM reduced the IL1β, TLR3, and HMGB1 mRNA
levels under conditions of ethanol abstinence; and at higher doses of the drug decrease in the IL-1β protein
levels in the hippocampus of rat brain was observed. Thus, the study provided new insights into the mecha-
nisms of neuroinflammation in the hippocampus during prolonged exposure to ethanol and upon abstinence.
The obtained results allowed us to suggest a number of tasks for further studies in this direction.
DOI: 10.1134/S0006297924110051
Keywords: ethanol, hippocampus, Toll-like receptors, cytokines, IL-1β, microRNAs, azithromycin
* To whom correspondence should be addressed.
INTRODUCTION
New publications appear periodically, which
expand our current knowledge on the neuroinflam-
mation theory of alcoholism suggested more than
20years ago that the long-term exposure of an organ-
ism to ethanol activated neuroinflammation mecha-
nisms thus causing development of neurodegeneration
in the brain and, as a result, disruption of the coor-
dinated executive control at the higher level of brain
AIRAPETOV et al.1912
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
Abbreviations: AZM, azithromycin; TLR, Toll-like receptors.
functioning, which, in turn, exacerbate course of the
disease [1-4]. The fact that chronic alcohol consump-
tion causes death of nerve cells is considered nowa-
days as fully established [1-8], however, first obser-
vations of this have been reported in the study by
S.  S.  Korsakoff in 1887  [9]. Later this disorder was
termed Korsakoff’s syndrome (also known as Korsa-
koff’s amnesic syndrome) that develops due to chronic
alcohol intoxication. Almost irreversible memory dis-
order develops in this state, pharmacological interven-
tions are ineffective, and rehabilitation of the patients
with Korsakoff’s syndrome mostly involves adaptation
of the individual to life with limited memory capabil-
ities [6, 8-10]. From the emotional point of view the
patients could exhibit either euphoria and placidity,
or, vice versa, apathy and lethargy  [11]. This syn-
drome is acute manifestation of neurodegeneration,
which could develop on the background of chronic
consumption of ethanol. However, it was shown in
the recent studies that development of the signs of
neurodegeneration could be observed in the course
of experiments with less severe exposure of an or-
ganism to ethanol, i.e., more often, not only in the
case of Korsakoff’s syndrome  [8,  9]. It has been sug-
gested that such pathogenetic processes could occur
during transition from the state of excessive drink-
ing (binge drinking) to early stages alcoholism, which
isfollowed by the development of more severe forms
of alcoholism  [8,  9]. It is likely associated with the
fact that death of the cells in different regions of the
brain chronically exposed to ethanol disrupts coordi-
nated functioning of brain thus affecting processes of
psycho-physiological control of an organism behavior,
which is manifested as symptoms characteristic of al-
coholism – inability to stop drinking, cognitive and
emotional disorders [1, 2, 12, 13].
The data obtained in the course of examination
of the post  mortem samples from the patients with
chronic alcohol consumption reveal presence of neu-
roinflammation developed in the cerebral cortex
[8, 9]. These data allowed suggesting that formation
of alcohol dependence could be associated not only
with dysfunction of neurotransmitter and neuropep-
tide systems, but also is mediated by various factors
of neuroinflammation  [8-11]. The system of Toll-like
receptors (TLR), being a key component of innate im-
munity, participates in regulation of synthesis of nu-
merous inflammatory response factors [1,  2,  14,  15].
This system includes endogenous TLR agonists (such
as Hmgb1 and a number of microRNAs), Toll-like re-
ceptors, and intracellular adapter proteins (including
MyD88, TRIF, IRF, NF-κB1, and others), which initiate
activation of the genes associated with neuroinflam-
mation [1, 2, 14, 15].
Modeling of long-term exposure to ethanol both
in vitro and in vivo allowed establishing that the sys-
tem of Toll-like receptors in nervous tissue cells indeed
responds to ethanol exposure– overexpression of the
TLR genes proteins, of their endogenous agonists has
been reported, as well as overexpression of the genes
of proinflammatory cytokines [1-4]. However, despite
the existence of such knowledge, there is no full un-
derstanding of the mechanisms of the effects of long-
term ethanol consumption on this system in different
regions of the brain. In this regard, the structures com-
prising elements of the so-called brain reinforcement
system associated with the development of alcohol
addiction attract the most attention [16-18]. One of
such key structures is hippocampus [16-18]. It seems
interesting to evaluate levels of expression of the ele-
ments of TLR system and associated molecules in the
hippocampus during modeling of long-term ethanol
exposure and ethanol abstinence, as well as during
pharmacological correction with the help of azithro-
mycin (AZM), which, according to the literature data,
isan effective agent for treatment of neuroinflamma-
tion [19-22]. This was the goal of our study.
MATERIALS AND METHODS
Animals. Three-months old male Wistar rats
(n  =  56) with average body mass 250-300  g were used
in the study, which were purchased in the Rappolovo
laboratory animal facility (Russia). Prior to the exper-
iment animals were divided into groups (8 animals
in each group): control group, group with long-term
exposure to ethanol, five groups with ethanol absti-
nence (ethanol abstinence on the day  7; ethanol ab-
stinence  +  water; ethanol abstinence  +  AZM, 40  mg/kg;
ethanol abstinence  +  AZM, 80  mg/kg; ethanol absti-
nence  +  AZM, 160  mg/kg). Animals have free access to
standard animal feed.
Modeling of long-term ethanol exposure and
state of abstinence was performed according to the
models described in the literature with some modi-
fications [23-25]. Long-term exposure to ethanol was
modeled by intragastric administration of 20% ethanol
solution through a gastric tube at a ratio 4  g of pure
ethanol per 1  kg of body weight on Monday-Friday of
each week for 4  weeks (20 administrations in total).
Control animals received equivalent volumes of water
according to the same scheme. Animals have free ac-
cess to water all the time. Animals in ‘ethanol group’
were decapitated on the last day of ethanol exposure
2  h after the last administration of ethanol. To model
ethanol abstinence, the animals exposed to ethanol
were kept for 7  days without administration of eth-
anol and next were sacrificed by decapitation (group
‘ethanol abstinence, 7 days’).
EFFECT OF ETHANOL ON INFLAMMATION IN HIPPOCAMPUS 1913
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
Table 1. Sequences of primers
Gene
Primers
Forward (5′→3′) Reverse (5′→3′)
Tlr3 AACTGGAGAACCTCCAAGA CACCCTGGAGAAAACTCTTT
Tlr4 ACTCTGATCATGGCATTGTT GTCTCAATTTCACACCTGGA
Tlr7 TGAAAATGGTATTTCCAATGTG TAAGGGTAAGGTTGGTGGTA
Nfκb1 ATACTGCTTTGACTCACTCC AGGTATGGGCCATCTGTT
Hmgb1 CTCTGATGCAGCTTATACGA AAAAGACTAGCTTCCCCTTG
Il1β TGTCTGACCCATGTGAGCTG TTTGGGATCCACACTCTCCAG
Ccl2 AAGATGATCCCAATGAGTCG TGGTGACAAATACTACAGCTT
Tnfα CACGTCGTAGCAAACCAC TATGAAATGGCAAATCGGCT
Il13 TGTAACCAAAAGGCCTCGGA TGGCCATAGCGGAAAAGTTG
Tgfβ GGACTACTACGCCAAAGAAG GGACTACTACGCCAAAGAAG
Il11 GGGACATGAACTGTGTTTGT GGTAGGTAGGGAGTCCAGAT
Il6 ACTTCACAAGTCGGAGGCTT AATTGCCATTGCACAACTCTTTTC
miR-182 TTTGGCAATGGTAGAACTCACACCG GCGAGCACAGAATTAATACGAC
miR-155-5p TTAATGCTAATTGTGATAGGGGT GCGAGCACAGAATTAATACGAC
miR-96-5p TTTGGCACTAGCACATTTTTGCT GCGAGCACAGAATTAATACGAC
miR-let-7b GCGGCGGCTATACAACCTACTGC GCGAGCACAGAATTAATACGAC
U6 TGCTTCGGCAGCACATATAC AGGGGCCATGCTAATCTTCT
Gapdh GCCAGCCTCGTCTCATA GTGGGTAGAGTCATACTGGA
Injection of pharmacological agents. After the
long-term exposure to ethanol the animals were sub-
jected to daily intragastric administration of azithro-
mycin through a gastric tube for three days [40  mg/kg,
80  mg/kg, 160 mg/kg; Hemomycin, powder for prepa-
ration of suspension for oral administration (Hemo-
farm, Serbia)]. Corresponding volume of water was
administered to the rats in control groups (group “eth-
anol abstinence  +  water”). Animals in all ‘ethanol ab-
stinence groups’ were decapitated on the day 7 after
the last ethanol administration.
Sample preparation. Boundaries of brain struc-
tures were determined in accordance with the rat
brain atlas  [26]. Brain samples were immediately fro-
zen at –80°C. Blood was sampled at the moment of
animal decapitation into special tubes for biochemical
and clinical analysis.
Blood analysis. Blood parameters was analyzed
out within first 2  h after sampling with a veterinary
hematological analyzer (Mindray, China). Determina-
tion of biochemical parameters in blood serum was
carried out with an Erba Mannheim XL-100 automatic
analyzer (Germany).
RNA isolation from brain samples. Isolation of
total RNA was carried out using an ExtractRNA re-
agent (Evrogen, Russia) in accordance with the man-
ufacturer’s instruction. Purity and concentration of
obtained RNA were evaluated with an Implen Nano-
Photometer P330 (Implen, Germany) from the A260/
A280 ratio (normal level  ≥  1.8).
RT-PCR. Synthesis of cDNA was carried out us-
ing reverse transcription (RT) in 20  µl of reaction
mixture of a MMLV RT kit (Evrogen) in accordance
with the manufacturer’s instruction. Prior to conduct-
ing RT microRNA were polyadenylated with the help
of poly(A)-polymerase Escherichia coli (New England
Biolabs Inc., USA) according to the previously de-
scribed technique  [27]. RT of microRNA was carried
AIRAPETOV et al.1914
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
in 10  µl volume reaction mixture with a MMLV RT
kit and specific PolyT-adapter (5′-GCGAGCACAGAAT
TAATACGACTCACTATAGGTTTTTTTTTTTTVN-3′).
Concentration of cDNA obtained in the course
of RT was measured with an Implen NanoPhotome-
ter P330.
Polymerase chain reaction (PCR) with real-time
detection was carried out with a Mx3005P amplifier
(Stratagene, USA) in a 10-µl reaction mixture contain-
ing SYBR Green (Evrogen) and a mixture of specific
of forward and reverse primers (Table  1) (Beagle, Rus-
sia). Relative levels of mRNA and miR were calculated
using 2
–ΔΔCt
method, mRNA content was normalized
to the level of expression of the Gapdh gene, level of
miR was normalized to the level of expression of the
U6 gene. All reactions were conducted in triplicate.
Enzyme-linked immunoassay. Frozen hippocam-
pus samples were homogenized with a CRYOMILL
(China) prior to conducting enzyme-linked immuno-
assay (ELIA); next, the obtained frozen powder was
dissolved in 1  ml of PBS (phosphate-buffered saline,
pH 7.4) and centrifuged for 10  min at 3000g. Aliquots
(100  µl) of the collected supernatants were stored
at –80°C before conducting ELIA. Content of IL1β
was determined with the help of an ELIA kit (Cloud-
Clone Corp., USA) according to the provided protocol.
Absorption in the reaction mixture was recorded with
a Synergy  2 plate reader (Bio Tek, USA). Total protein
content was determined using the Bradford method
with a Bio-Rad Protein Assay Kit (Bio-Rad, USA). Mea-
surements were performed in triplicate.
Statistical data processing was carried out using
the Graph Pad Prizm  v.6 software. All data are pre-
sented as a mean  ±  standard deviation of the mean.
Results in different groups were compared using the
Mann–Whitney U-test for small samples. Differences
were considered statistically significant at p ≤ 0.05.
RESULTS AND DISCUSSION
Biochemical and clinical parameter in blood af-
ter long-term exposure to ethanol. To evaluate gen-
eral state of an animal organism during long-term ex-
posure to ethanol we considered reasonable to assess
biochemical and clinical blood parameters in animals.
Results of analysis demonstrated increased lev-
els of alanine aminotransferase (ALT) and albumin
in blood serum of animals in the experimental group
(Table  2). Increased level of albumin could reflect
changes in the degree of dehydration of the organism,
which is typical for the patient with chronic alcoholism,
and the increased level of ALT serves as an indicator
of possible damage of hepatocytes in the experimental
animals, which is also characteristic for an organism
with long-term alcoholic intoxication [8, 28, 29].
The results of clinical blood analysis demonstrat-
ed decrease of the level of lymphocytes and increase
of the level of monocytes in the animals subjected
to long-term exposure to ethanol (Table 3).
The presented results show existence of immune
system response to the long-term exposure of the an-
imal to ethanol. Increase of the level of monocytes
could reflect to a certain degree presence of chron-
ic peripheral inflammatory response, and decrease
of the level of lymphocytes could indicate decrease
of activity of adaptive immune system, which is ob-
served often under conditions of long-term exposure
of the organism to ethanol [29-31].
Table  2. Biochemical parameters of rat blood serum
upon long-term exposure to ethanol
Indicator Control (n = 8) Ethanol (n=8)
ALT, IU/l 18.63 ± 2.91 28.14 ± 5.64*
Glucose, mmol/l 4.39 ± 0.43 4.01 ± 1.08
Creatinine, µmol/l 25.43 ± 7.65 28.16 ± 3.58
Urea, mmol/l 3.48 ± 0.54 4.07 ± 0.36
Albumin, g/l 44.87 ± 3.99 55.43 ± 4.86*
AST, IU/l 69.53 ± 14.67 64.44 ± 6.35
Total protein, g/l 59.30 ± 8.59 67.38 ± 4.48
Note. ALT, alanine aminotransferase; AST, aspartate amino-
transferase; *  p  ≤  0.05 – in comparison with the control
group.
Table  3. Results of clinical analysis of blood samples
of the rats subjected to long-term exposure to ethanol
Indicator Control (n = 8) Ethanol (n = 8)
Leukocytes, 10
9
/l 8.52 ± 1.82 6.12 ± 2,22
Neutrophils, 10
9
/l 0.61 ± 0.51 0.98 ± 0,53
Lymphocytes, 10
9
/l 7.37 ± 2.10 4.01 ± 1.76*
Monocytes, 10
9
/l 0.5 ± 0.46 1.10 ± 0.69*
Eosinophils, 10
9
/l 0.03 ± 0.01 0.04 ± 0.02
Basophils, 10
9
/l 0 ± 0.00 0 ± 0.00
Erythrocytes, 10
12
/l 8.04 ± 0.41 7.73 ± 0.51
Hemoglobin, g/l 141.5 ± 8.10 145.0 ± 8.74
Hematocrit, % 41.4 ± 1.84 41.9 ± 2.44
Thrombocytes, 10
9
/l 977.33 ± 156.42 754.01 ± 265.26
Note. *  p  ≤  0.05 in comparison with the control group.
EFFECT OF ETHANOL ON INFLAMMATION IN HIPPOCAMPUS 1915
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
Hence, modeling of the long-term exposure of
an organism to ethanol conducted in this study re-
sulted in certain changes of blood parameters in the
animals, which manifest development of a patholog-
ical state. It should be mentioned that body mass of
the animals in both experimental and control group
did not differ significantly in the course of the ex-
periment, and the animals with signs of one or other
disease (such as acquired trauma) were removed from
the experiment.
Expression of the genes of cytokines and genes
of the TLR system in the hippocampus of rats after
long-term exposure to ethanol. Long-term exposure
to ethanol resulted in the increase of the level of ex-
pression of the Il1β gene and decrease of expression of
the Tnfα and Il11 genes in the rat brain hippocampus
(Fig.  1). No significant differences at the mRNA levels
were revealed in the expression of Il6, Tgfβ, and Il13
(Fig.  1). Product of the Il1β gene is a key proinflamma-
tory cytokine, and increase of its content is often as-
sociated with the development of neuroinflammation.
Increase of its expression in the brain exposed for a
long time to ethanol has been reported in the previous
studies [12,  32,  33]. The results obtained in this study
on the enhanced expression of this gene in the hip-
pocampus of rats subjected to long-term exposure to
ethanol are similar to the previously reported data for
different regions of the brain including hippocampus,
but using different conditions for modeling long-term
ethanol exposure [12,  32,  33]. The level of expression
of the Il6 gene in hippocampus in our experiment did
not change, while expression of the Tnfα gene was
downregulated (Fig.  1). Both cytokines, according to
the latest data, exhibit dual action with regard to the
development of inflammation – in some situations
they play a role of proinflammatory factors, while un-
der other conditions they could exert anti-inflammato-
ry effects  [15,  34]. Hence, no unambiguous conclusions
could be made with regards to the decrease of the
level of expression of the Tnfα gene, further research
is needed to resolve this issue.
Downregulation of expression of the Il11 gene
seems very interesting (Fig.  1). There are data in the
literature indicating that this cytokine in the nervous
tissue exhibits anti-inflammatory effects, which was
demonstrated in the studies modeling various patholo-
gies [35]. It is likely that in this case we observe man-
ifestation of decreased activities of the mechanisms
of inhibition of proinflammatory processes developing
on the background of chronic consumption of etha-
nol. The decreased level of expression of the Il11 gene
could be one of the reasons for dysfunction of these
mechanisms, and further investigation of this cyto-
kine could help to identify a new molecular target to
correct neuroinflammation. This hypothesis requires
future verification.
In addition to cytokines, expression of some
genes of Toll-like receptors was assessed in this study.
Wedid not observe any significant changes in the ex-
pression of the Tlr4, Hmgb1, and Nfκb1 genes, while
expression of the Tlr3 and Tlr7 genes was downregu-
lated (Fig. 2). In the previous studies the researchers
reported increase in the level of expression of the
Tlr7 gene, which was associated with manifestations
of neurodegenerative process [1,  5]. It is likely that
the observed differences between the results of ours
and other studies is due to the regional peculiarities
of expression of this gene, or due to the use of dif-
ferent model of long-term exposure to moderate doses
of ethanol.
It was observed in our previous studies that there
were only minimal changes in the TLR system under
condition of long-term exposure to ethanol, however,
Fig.  1. Content of cytokine mRNAs in the hippocampus of
rats subjected to long-term ethanol exposure; *  p  ≤  0.05 in
comparison with the control group.
Fig.  2. Relative level of mRNAs of the TLR system genes in
the hippocampus of rats subjected to long-term exposure
to ethanol; *  p  ≤  0.05 in comparison with the control group.
AIRAPETOV et al.1916
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
Table  4. Relative level of expression of microRNAs
in the hippocampus of the rats, arb. units
miR Control (n = 8) Ethanol (n=8)
miRlet7b 0.78 ± 0.13 0.43 ± 0.19*
miR96 1.08 ± 0.34 0.38 ± 0.15*
miR155 0.96 ± 0.37 0.51 ± 0.25*
miR182 1.01 ± 0.25 0.79 ± 0.17
Note. * p < 0.05 in comparison with the control group.
abstinence from the long-term ethanol exposure
caused pronounced disbalance in their expression[36-
38]. In particular, the similar results were obtained
for in the nucleus accumbens of the rat brain in the
similar model of long-term exposure to ethanol [37].
Hence, it seems interesting to investigate the mRNA
and protein levels of cytokines, as well as other com-
ponents of TLR-signaling pathway not only under
conditions of long-term exposure to alcohol, but also
under conditions of alcohol abstinence.
Investigation of the content of microRNAs in
hippocampus of the rats subjected to long-term
exposure to ethanol. Analysis of relative content
of microRNA molecules in the hippocampus of the
rats revealed that the levels of miRlet7b, miR96, and
miR155 changes significantly in the group of animals
subjected to long-term exposure ethanol: the level
of the miRlet7b decreased 1.8-fold, of the miR96 –
2.8-fold, and of the miR155 – 1.9-fold (Table  4).
The miR molecules tested in our study were se-
lected on the basis of their functional association with
the TLR-signaling pathways [39-43]. It is known that
miR-let7b is an endogenous agonist of TLR7 [1,  12].
It has been reported that the change in expression of
miR-let7b could have functional association with the
TLR7-signaling cascade [5, 12].
Increase of the content of miR-155 in the microg-
lia cells of the mice was observed with increase of ac-
tivity of TLR-signaling, while in the mice with knock-
out of the Tlr4 gene (TLR4-KO) no such increase was
observed [41]. Content of miR-96 in the cerebral cortex
does not change in the TLR4-KO mice, while long-term
exposure of the wild type mice to alcohol decreased
the level of miR-96[42,  43]. The data are available ex-
emplified with miR-182-5p that indicate existence of
functional interactions of the miR-183C cluster (that
include miR-96 and miR-182) with the TLR4 protein
[42,  43]. It is also worth mentioning that not only the
content of miR-let7b (endogenous agonist for TLR7)
was decreased in our experiments, but also the level
of Tlr7 mRNA, which emphasizes importance of fur-
ther research aiming at establishing possible function-
al association between the observed changes.
Expression of the genes of cytokines and of the
TLR system in rat brain hippocampus under condi-
tions of ethanol abstinence. There is no information
on the state of the investigated system of genes under
conditions of ethanol abstinence. Few facts available
in this regard were mainly obtained either during
modeling of chronic and sub-chronic forms alcohol
addiction or on the next day after abstinence [2,  13].
In our present experiment we analyzed expression of
the investigated genes on the day 7 after abstinence
from the long-term ethanol exposure (Fig. 3).
The obtained results revealed that 7 days after
abstinence expression levels of the genes Tlr3, Tlr4,
Tlr7, and Hmgb1 were increased, while expression of
the Nfκb1 gene did not change (Fig. 3). The highest
increase of expression was observed for the Tlr4 gene.
The obtained data allows suggesting involvement of
the system of Toll-like receptors into pathogenic mech-
anisms in the brain hippocampus developing on the
background of long-term exposure of an organism
to ethanol. It was observed in our experiments that
the levels of expression of the Tlr3 and Tlr7 genes in
hippocampus decreased in the group of animals sub-
jected to long-term exposure to ethanol(Fig.  2), while
increase of the levels of their expression was ob-
served under conditions of ethanol abstinence (Fig.  3).
The obtained results are in agreement with the data
obtained by other researchers for other brain struc-
tures, as well as for the biopsies from the patients
with chronic alcohol intoxication [2,  13,  24]. It was
shown in a series of studies devoted to elucidation
of functional significance of such changes that the
increase of expression of the Tlr4 and Hmgb1 genes
resulted in activation of the genes of proinflammatory
cytokines and, as a result, to the development of neu-
roinflammation [12, 13, 24, 33,41]. Increase of activity
Fig.  3. Content of mRNAs of the cytokines genes and of the
genes of TLR system in the hippocampus of rat brains during
ethanol abstinence; *p≤0.05 in comparison with the control
group.
EFFECT OF ETHANOL ON INFLAMMATION IN HIPPOCAMPUS 1917
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
of the Hmgb1 and Tlr7 genes leads to activation of the
mechanisms of programmed cell death in the neuro-
nal cell cultures (in  vitro studies), i.e., to manifestation
of the signs of neurodegeneration  [5]. With regard to
the Tlr3 gene, information is available that activation
of the product of expression of this gene, endosomal
protein receptor TLR3, with specific agonists results
in increase of the level of voluntary consumption of
ethanol by animals  [2]. Hence, the observed changes
in the expression of these genes indicates presence of
persistent pathological processes in the hippocampus
of rat brain 7 days after abstinence of ethanol, and
the system of investigated genes participate in their
realization. The obtained data emphasize once more
significance of studies in this research area.
Use of azithromycin for correction of expres-
sion of the genes of cytokines and of the system of
Toll-like receptors under conditions of abstinence
of ethanol. Here we present results of our first ob-
servations aimed at evaluation of expression of the
cytokine genes and of the genes of TLR system in the
rat brain hippocampus under conditions of abstinence
after long-term exposure to ethanol and during phar-
macological correction by azithromycin. AZM has been
recognized as an effective neuroprotector in different
models of pathological states, which decreases the lev-
els of inflammatory factors and slows down the pro-
cess of neuronal cell death [19-22]. Exact mechanism
is not known. In particular, it has been suggested that
the effect could be realized through the protein com-
plex NF-κB  [19-22], which is a key component in the
pathway of transduction of intracellular signals from
TLR[14,15]. We have set a goal to assess possible neu-
roprotective effect of AZM on the investigated system
of the TLR genes in the hippocampus under conditions
of abstinence of long-term exposure to ethanol.
In this study we also obtained the data on ex-
pression of the Tlr3, Hmgb1, and Nfκb1 at the day 7
after abstinence of long-term exposure to ethanol– ex-
pression of the Tlr3 and Hmgb1 genes was increased,
and the level of expression of the Nfκb1 gene did not
change (Fig.4). Treatment with AZM provided correc-
tion of the levels of expression of the Tlr3 and Hmgb1
genes (Fig. 4). With respect to the Hmgb1 gene, all
three used doses of the preparation exhibited positive
effect, while use of the lowest dose of AZM (40mg/kg)
did not affect expression of the Tlr3 gene (Fig.  4).
The AZM preparation did not affect expression of the
Nfκb1 gene(Fig.  4). In addition, we evaluated effects of
AZM on the levels of expression of the genes of proin-
flammatory cytokines Il1β and Ccl2 under conditions
of ethanol abstinence (Fig. 5). Previously, the effects
of AZM on these cytokines were investigated in oth-
er pathological states; it was shown that AZM is ca-
pable of correcting levels of these cytokines [19-22].
In our earlier study we also reported our observa-
tions on expression of the genes of these cytokines
on the day 7 after ethanol abstinence, but the ob-
tained data on their expression were different – in-
crease of expression of the Ccl2 gene was revealed,
and there were no changes in the expression of the
Il1β gene  [36]. These differences could be explained by
the fact that different protocols of modeling long-term
ethanol exposure were used. In the present experi-
ment increase of the level of the Il1β gene expression
was demonstrated, while there were no significant
changes in the expression of the Ccl2 gene (Fig.  5).
Fig. 4. Contents of mRNAs of the genes of TLR system in the
hippocampus of rats under conditions of ethanol abstinence
followed by pharmacological correction with azithromycin;
* p < 0.05 in comparison with the control group; # p < 0.05
in comparison with the group “Abstinence from ethanol
+ water.”
Fig. 5. Contents of mRNAs of the cytokine genes in the
hippocampus of rats under conditions of ethanol absti-
nence followed by pharmacological correction with azith-
romycin; *  p  <  0.05 in comparison with the control group;
#  p  <  0.05 in comparison with the group “Abstinence from
ethanol  +  water.”
AIRAPETOV et al.1918
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
Treatment with AZM allowed to decrease the elevated
level of the Il1β gene expression at all doses of the
preparation used (Fig. 5).
Level of the IL-1β protein under condition of
long-term exposure to ethanol and pharmacologi-
cal correction with azithromycin in the rat hippo-
campus. We concentrated our attention on measuring
of the level of IL-1β protein in the rat hippocampus.
This protein is a key proinflammatory cytokine; level
of this protein increases in the brain tissues during
neuroinflammation development [1, 2, 13].
Role of the IL-1β protein, which mediates devel-
opment of cognitive and emotional disfunctions, has
been investigated in different pathologies. In partic-
ular, in the experiment with mice subjected to psy-
cho-social stress, reduced social interactions and dis-
ruptions of working memory was observed, which
was prevented with knockout of the Il1r1 gene (gene
of the IL-1 protein receptor); and the virus-mediated
selective deletion of the Il1r1 gene in the hippocam-
pus neurons also demonstrated its crucial role in the
stress-induced behavioral dysfunctions. In addition,
it was shown that the stress-induced transport of
monocytes into brain was also blocked by the knock-
out of the Il1r1 gene  [44]. In another study a lentivi-
ral construct was used to induce hyperexpression of
IL-1β in the dorsal hippocampus of rats. As a result,
reduced neurogenesis in the hippocampus was ob-
served together with the decreased level of neurite
branching on neurons  [45]. Data are available indicat-
ing that proinflammatory cytokines suppress long-
term potentiation in the hippocampus, thus trig-
gering changes in the key mechanisms of memory
formation. The researchers revealed using synapto-
somes and neuronal cell cultures that IL-1β directly
suppresses plasticity via neuron-specific mechanisms.
It has also been reported that IL-1β could suppress
long-term potentiation directly in the mouse synapses
[46]. Furthermore, it is known that the hippocampal
neurons express high levels of IL-1R1[46]. These data
indicate involvement of the cytokine in the disruption
of memory formation mechanisms. There is a number
of studies supporting these suggestions, which were
conducted using various animal models [46].
The results of our study showed that the ani-
mals in the group with long-term exposure to etha-
nol and in the group 7 days after ethanol abstinence
have elevated levels of the IL-1β protein (Fig.  6).
Hence, it could be concluded based on the available
information on IL-1β that the observed increase of
the level of this protein in hippocampus (more than
2-fold increase) during the long-term exposure of an
organism to ethanol could be the cause of develop-
ment of emotional and cognitive disorders, as well
as of disruption of the mechanisms of memory for-
mation.
In the experiment we used two doses of azithro-
mycin to test its efficiency with respect to correction
of the IL-1β protein content. Use of azithromycin at
the dose 40  mg/kg did not produce any significant ef-
fect, but using the dose of 160  mg/kg resulted in the
decrease of the level of the protein (to almost con-
trol levels) both in comparison with the group after
ethanol abstinence and with the group of animals
subjected to long-term exposure to ethanol (Fig.  6).
At the same time, analysis at the mRNA level demon-
strated efficiency of both doses of AZM used (40  mg/kg
and 160  mg/kg) (Fig.  5). Hence, the dose of 40  mg/kg,
which is sufficient for reduction of the level of ex-
pression of the Il1β gene, is insufficient to decrease to
the level of the protein product. The observed effect
could be mediated by the effects of azithromycin on
mechanisms of maturation or degradation of the IL-1β
product. The IL-1β protein is formed in the course
of proteolysis from its precursor pro-IL-1β, and, de-
spite the observed decrease of the level of products
of transcription of this gene at the particular time
point, the increased level of the IL-1β protein could
be maintained due to formation of the protein from
the pro-IL-1β molecule in the course of posttransla-
tional mechanisms. Moreover, it is known that deg-
radation of the IL-1β protein also occurs through a
complex pathway, which is mediated, in particular, by
matrix metalloproteinases  [47,  48]. It would be inter-
esting to investigate in future possible contribution
of azithromycin to regulation of the pathways regu-
lating the rate of IL-1β protein degradation. It could
be suggested that the observed persistent increase of
the levels of IL-1β protein with the decreased levels
of the level of expression could be explained by ac-
tivation of the pathways leading to the decrease of
the rate ofprotein degradation. The available dynamic
Fig. 6. Level of IL-1β in the rat hippocampus; *  p  <  0.05 in
comparison with the control group; #p<0.05 in comparison
with the “Abstinence from ethanol + water” group.
EFFECT OF ETHANOL ON INFLAMMATION IN HIPPOCAMPUS 1919
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
correlations also show existence of deviation in time
between the levels of IL-1β mRNA and protein – de-
crease in the levels of mRNA is accompanied with the
increasing trend of the protein level [49].
Summarizing the obtained results about the con-
tent of the key proinflammatory cytokine protein
IL-1β, it could be stated that there are signs of neu-
roinflammation in the hippocampus of the rats sub-
jected to long-term exposure to ethanol and ethanol
abstinence. The tested compound, azithromycin, was
shown to exert positive effect at certain doses with
regard to decrease of the level of neuroinflammatory
mediator IL-1β, which is in agreement with the results
of other studies.
CONCLUSIONS
Modeling of the long-term exposure to moderate
doses of ethanol conducted in this study revealed sev-
eral changes both in biochemical (increase of the lev-
els of ALT and albumin) and clinical (increase of the
level of monocytes and decrease of the level of lym-
phocytes) parameters of the blood, and in the system
of neuroinflammation in the rat brain hippocampus.
We analyzed the levels of activity of the genes of the
Toll-like receptors system, as well as of the molecules
functionally associated with this system including
microRNAs (miRlet7b, miR96, miR155, miR182) and
cytokines. Long-term exposure to ethanol caused in-
crease in the IL-1β mRNA level and the level of IL-1β
cytokine protein, while the levels of Tnfα, Il11, Tlr3,
and Tlr7 mRNAs were found to be decreased. Seven
days after ethanol abstinence the increased levels of
IL-1β mRNA and protein were preserved, as well as
of the Hmgb1 mRNA. On the contrary, the level of
the Tlr3 mRNA was found to be increased after the
ethanol abstinence. Peroral administration of azith-
romycin facilitated correction of some biochemical
changes developed during ethanol abstinence – the
increased levels of Il1β, Tlr3, and Hmgb1 mRNAs were
decreased, and higher doses facilitated decrease of the
increased levels of the IL-1β protein in the rat hippo-
campus. Contents of miRlet7b, miR96, miR155 were
decreased in the hippocamp as a result of long-term
exposure to alcohol. These molecules are functional-
ly associated with the system of TLR, and changes in
their content could reflect or mediate (not known at
the moment) dysfunctions in molecular mechanisms
of functioning of Toll-like receptors.
Investigation of biochemical changes in the rat
hippocampus during modeling of long-term exposure
to ethanol and its abstinence is of significant interest,
because patients with alcohol addiction exhibit disrup-
tion in memory formation and in emotional sphere.
Hippocampus plays an important role in these pro-
cesses, and evaluation of biochemical changes could
help to obtain new information expanding our under-
standing of pathophysiological mechanisms develop-
ing in this brain region during long-term exposure of
an organism to ethanol.
Contributions. All authors contributed signifi-
cantly to the concept development, conducting re-
search, and preparation of the manuscript, all authors
read and approved final version of the manuscript.
M.I.A., S.O.E., S.A.S., and E.R.B. acquiring and analysis
of the data; A.A.L. and P.D.S. development of general
concept of the study, preparation of the final version
of the manuscript.
Funding. This work was financially supported by
the State Budget Project of the Institute of Experimen-
tal Medicine FGWG-2024-0015 “Neurobiological Mech-
anisms of Pathogenesis of Socially Significant Diseas-
es and Posttraumatic Disorders. New Approaches to
Modeling of Pathological Processes and Correction of
Disorders.”
Ethics declarations. All applicable international,
national, and/or institutional guidelines for the care
and use of animals were followed. All procedures in
the animal studies were approved by Ethics Commit-
tee of the Saint-Petersburg State University (protocol
no.131-03-8,29.04.2024). The authors of this work de-
clare that they have no conflict of interest.
REFERENCES
1. Crews, F.T., Lawrimore, C. J., Walter, T. J., and Cole-
man, L. G., Jr. (2017) The role of neuroimmune sig-
naling in alcoholism, Neuropharmacology, 122, 56-73,
https://doi.org/10.1016/j.neuropharm.2017.01.031.
2. Airapetov,M., Eresko,S., Lebedev,A., Bychkov,E., and
Shabanov, P. (2021) The role of Toll-like receptors in
neurobiology of alcoholism, Biosci. Trends, 15, 74-82,
https://doi.org/10.5582/bst.2021.01041.
3. Guerri,C., and Pascual,M. (2019) Impact of neuroim-
mune activation induced by alcohol or drug abuse on
adolescent brain development, Int.J. Dev. Neurosci., 77,
89-98, https://doi.org/10.1016/j.ijdevneu.2018.11.006.
4. Anand, S.K., Ahmad, M.H., Sahu, M.R., Subba,R., and
Mondal, A.C. (2023) Detrimental effects of alcohol-in-
duced inflammation on brain health: from neurogen-
esis to neurodegeneration, Cell. Mol. Neurobiol., 43,
1885-1904, https://doi.org/10.1007/s10571-022-01308-2.
5. Coleman, L.G., Zou,J., and Crews, F.T. (2017) Microg-
lial-derived miRNA let-7 and HMGb1 contribute to
ethanol-induced neurotoxicity via TLR7, J. Neuroin-
flamm., 14, 1-15, https://doi.org/10.1186/s12974-017-
0799-4.
6. Arts, N. J., Walvoort, S. J., and Kessels, R. P. (2017)
Korsakoff’s syndrome: a critical review, Neuropsychi.
AIRAPETOV et al.1920
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
Dis. Treat., 13, 2875-2890, https://doi.org/10.2147/NDT.
S130078.
7. Shabanov, P. D. (1985) Experimental memory disor-
ders and their pharmacological correction [in Rus-
sian], Vestn. Akad. Med. Nauk SSSR, 9, 31-38.
8. Grigorenko, A. Ya., Afanasiev, V. V., and Babakhanyan,
R. V. (2008) Chronic Alcohol Intoxication [in Russian],
Izd-vo R. Aslanova Yuridicheskii Tsentr Press, Saint
Petersburg.
9. Korsakov, S. S., About alcoholic paralysis [in Russian],
Dissertation, Moscow, 1887.
10. Shabanov, P. D., and Borodkin, Yu. S. (1989) Memory
Disorders and their Correction [in Russian], Nauka,
Leningrad.
11. Tsygankov, B. D., and Ovsyannikov, S. A. (2011) Psychi-
atry [in Russian], GEOTAR-Media, Moscow.
12. Crews, F. T., Qin, L., Sheedy, D., Vetreno, R. P., and
Zou, J. (2013) HMGB1/TLR receptor danger signaling
increases brain neuroimmune activation in alcohol
dependence, Biol. Psychiatry, 73, 602-612, https://
doi.org/10.1016/j.biopsych.2012.09.030.
13. Crews, F.T., Walter, T.J., Coleman, L.G., and Vetreno,
R. P. (2017) Toll-like receptor signaling and stages of
addiction, Psychopharmacology (Berl), 234, 1483-1498,
https://doi.org/10.1007/s00213-017-4560-6.
14. Kokryakov, V. N. (2006) Essays on Innate Immunity
[inRussian], Nauka, St. Petersburg.
15. Lebedev, K. A., and Ponyakina, I. D. (2017) Immunol-
ogy of Pattern Recognition Receptors [in Russian],
Lenand, Moscow.
16. Nozdrachev, A. D., Lebedev, A. A., and Shabanov,
P.D. (2000) Organization of reinforcement systems in
brain [in Russian], Vestn. Sankt-Petersburgskogo Univ.
Ser.3. Biol., 4, 62-76.
17. Shabanov, P. D., and Lebedev, A.A. (2001) Reinforce-
ment systems of the brain: localization, neurochem-
ical organization, participation in development of
dependence of psychostimulants [in Russian], Psikho-
farmakol. Biol., 1, 13-26.
18. Becker H. C. (2014) Alcohol and the Nervous Sys-
tem, Handbook of Clinical Neurology, Elsevier, Am-
sterdam.
19. Ramarao, S., Pang, Y., Carter, K., and Bhatt, A. (2022)
Azithromycin protects oligodendrocyte progenitor
cells against lipopolysaccharide-activated microg-
lia-induced damage, Dev. Neurosci., 44, 1-12, https://
doi.org/10.1159/000519874.
20. Lin, S.J., Kuo, M.L., Hsiao, H.S., and Lee, P.T. (2016)
Azithromycin modulates immune response of human
monocyte-derived dendritic cells and CD4
+
T cells,
Int. Immunopharmacol., 40, 318-326, https://doi.
org/10.1016/j.intimp.2016.09.012.
21. Barks, J. D. E., Liu, Y., Wang, L., Pai, M. P., and Sil-
verstein, F. S. (2019) Repurposing azithromycin for
neonatal neuroprotection, Pediatr. Res., 86, 444-451,
https://doi.org/10.1038/s41390-019-0408-6.
22. Kopper, T. J., and Gensel, J. C. (2021) Continued de-
velopment of azithromycin as a neuroprotective
therapeutic for the treatment of spinal cord inju-
ry and other neurological conditions, Neural Re-
gen. Res., 16, 508-509, https://doi.org/10.4103/1673-
5374.293146.
23. McMahan, R. H., Najarro, K. M., Mullen, J. E., Paul,
M. T., Orlicky, D.J., Hulsebus, H. J., and Kovacs, E. J.
(2021) A novel murine model of multi-day moder-
ate ethanol exposure reveals increased intestinal
dysfunction and liver inflammation with age, Im-
mun. Ageing, 18, 37, https://doi.org/10.1186/s12979-
021-00247-8.
24. Coleman, L. G., Jr., Zou, J., Qin, L., and Crews, F. T.
(2018) HMGB1/IL-1b complexes regulate neuroim-
mune responses in alcoholism, Brain Behav. Immun.,
72, 61-77, https://doi.org/10.1016/j.bbi.2017.10.027.
25. Tucker, A. E., Alicea Pauneto, C.D.M., Barnett, A. M.,
and Coleman, L.G., Jr. (2022) Chronic ethanol causes
persistent increases in Alzheimer’s tau pathology in
female 3xTg-AD mice: a potential role for lysosom-
al impairment, Front. Behav. Neurosci., 16, 886634,
https://doi.org/10.3389/fnbeh.2022.886634.
26. Paxinos G., and Watson C. (2017) The Rat brain in Ste-
reotaxic Coordinates, Academic Press, Sydney.
27. Shi,R., Sun, Y.H., Zhang, X.H., and Chiang, V.L. (2012)
Poly(T) adaptor RT-PCR, Methods Mol. Biol., 822,
53-66, https://doi.org/10.1007/978-1-61779-427-8_4.
28. Burov, Yu. V.,and Vedernikova, N. N. (1985) Neuro-
chemistry and Pharmacology of Alcoholism [in Rus-
sian], Meditsina, Moscow.
29. Vetlugina, T. P., Prokop’eva, V. D., and Bokhan, N. A.
(2023) Biological Bases of Adjuvant Therapy of Alcohol-
ism [in Russian], Tomsk State University Publishing,
Tomsk.
30. Gazatova, N. D., Yurova, K. A., Gavrilov, D. V., and
Litvinova, L. S. (2018) Alcohol and immunity, Geny
Kletki, 13, 47-55.
31. Tsygan, V. N., Akperov, E. K., Vostrikov, V. V., and
Shabanov, P.D. (2007) Immune dysfunctions in drug
addicts and methods of their correction, Rev. Clin.
Pharmacol. Drug Ther., 5, 2-81.
32. Priyanka, S.H., Thushara, A.J., Rauf, A. A., and Indi-
ra,M. (2019) Alcohol induced NLRP3 inflammasome
activation in the brain of rats is attenuated by ATRA
supplementation, Brain Behav. Immun. Health, 2,
100024, https://doi.org/10.1016/j.bbih.2019.100024.
33. Alfonso-Loeches,S., Pascual-Lucas, M., Blanco, A. M.,
Sanchez-Vera, I., and Guerri,C. (2010) Pivotal role of
TLR4 receptors in alcohol-induced neuroinflamma-
tion and brain damage, J. Neurosci., 30, 8285-8295,
https://doi.org/10.1523/JNEUROSCI.0976-10.2010.
34. Ketlinskii, S. A., and Simbirtsev, A. S. (2008) Cytokines
[in Russian], Foliant, St. Petersburg.
35. Airapetov, M., Eresko, S., Ignatova, P., Lebedev, A.,
Bychkov,E., and Shabanov,P. (2022) A brief summary
EFFECT OF ETHANOL ON INFLAMMATION IN HIPPOCAMPUS 1921
BIOCHEMISTRY (Moscow) Vol. 89 No. 11 2024
regarding the roles of interleukin-11 in neurological
diseases, Biosci. Trends, 16, 367-370, https://doi.org/
10.5582/bst.2022.01331.
36. Airapetov, M.I., Eresko, S.O., Kochkin, D.V., Bychkov,
E.R., Lebedev, A.A., and Shabanov, P.D. (2022) Ginse-
nosides affect the system of Toll-like receptors in the
brain of rats under conditions of long-term alcohol
withdrawal, Biomed. Khim., 68, 459-469, https://
doi.org/10.18097/PBMC20226806459.
37. Airapetov, M., Eresko, S., Ignatova, P., Lebedev, A.,
Bychkov, E., and Shabanov, P. (2024) Effect of ri-
fampicin on TLR4-signaling pathways in the nucle-
us accumbens of the rat brain during abstinence of
long-term alcohol treatment, Alcohol Alcohol., 59,
agae016, https://doi.org/10.1093/alcalc/agae016.
38. Airapetov, M.I., Eresko, S.O., Bychkov, E.R., Lebedev,
A. A., and Shabanov, P. D. (2020) Expression of Toll-
like receptors in emotiogenic structures of rat brain
is changed under longterm alcohol consumption and
ethanol withdrawal, Med. Immunol., 22, 77-86, https://
doi.org/10.15789/1563-0625-EOT-1836.
39. Lim, Y., Beane-Ebel, J. E., and Tanaka, Y. (2021) Ex-
ploration of alcohol use disorder-associated brain
miRNA- mRNA regulatory networks, Transl. Psychiatry,
11, 504, https://doi.org/10.1038/s41398-021-01635-w.
40. Lehmann, S. M., Krüger, C., Park, B., Derkow, K.,
Rosenberger, K., Baumgart, J., Trimbuch,T., Eom, G.,
Hinz, M., Kaul,D., Habbel,P., Kälin, R., Franzoni,E.,
Rybak, A., Nguyen, D., Veh, R., Ninnemann, O.,
Peters, O., Nitsch, R., Heppner, F. L., Golenbock, D.,
Schott, E., Ploegh, H. L., Wulczyn, F. G., and
Lehnardt,S. (2012) Anunconventional role for miRNA:
let-7 activates Toll-like receptor 7 and causes neu-
rodegeneration, Nat. Neurosci., 15, 827-835, https://
doi.org/10.1038/nn.3113.
41. Lippai, D., Bala, S., Csak, T., Kurt-Jones, E. A., and
Szabo, G. (2013) Chronic alcohol-induced microRNA-
155 contributes to neuroinflammation in a TLR4-
dependent manner in mice, PLoS One, 8, e70945,
https://doi.org/10.1371/journal.pone.0070945.
42. Ureña-Peralta, J. R., Alfonso-Loeches,S., Cuesta-Diaz,
C.M., García-García,F., and Guerri,C. (2018) Deep se-
quencing and miRNA profiles in alcohol-induced neu-
roinflammation and the TLR4 response in mice cere-
bral cortex, Sci. Rep., 8, 15913, https://doi.org/10.1038/
s41598-018-34277-y.
43. Ureña-Peralta, J. R., Pérez-Moraga, R., García-
García, F., and Guerri, C. (2020) Lack of TLR4 modi-
fies the miRNAs profile and attenuates inflammatory
signaling pathways, PLoS One, 15, 0237066, https://
doi.org/10.1371/journal.pone.0237066.
44. DiSabato, D.J., Nemeth, D. P., Liu, X., Witcher, K.G.,
O’Neil, S.M., Oliver,B., Bray, C.E., Sheridan, J.F., God-
bout, J.P., and Quan,N. (2021) Interleukin-1 receptor
on hippocampal neurons drives social withdraw-
al and cognitive deficits after chronic social stress,
Mol. Psychiatry, 26, 4770-4782, https://doi.org/10.1038/
s41380-020-0788-3.
45. Pawley, L.C., Hueston, C.M., O’Leary, J.D., Kozareva,
D.A., Cryan, J.F., O’Leary, O.F., and Nolan, Y.M. (2020)
Chronic intrahippocampal interleukin-1b overexpres-
sion in adolescence impairs hippocampal neurogen-
esis but not neurogenesis-associated cognition, Brain
Behav. Immun., 83, 172-179, https://doi.org/10.1016/
j.bbi.2019.10.007.
46. Prieto, G.A., Tong,L., Smith, E.D., and Cotman, C.W.
(2019) TNFα and IL-1b but not IL-18 suppresses hippo-
campal long-term potentiation directly at the synapse,
Neurochem. Res., 44, 49-60, https://doi.org/10.1007/
s11064-018-2517-8.
47. Vijayaraj, S. L., Feltham, R., Rashidi, M., Frank, D.,
Liu, Z., Simpson, D. S., Ebert, G., Vince, A., Herold,
M. J., Kueh, A., Pearson, J. S., Dagley, L. F., Murphy,
J.M., Webb, A.I., Lawlor, K.E., and Vince, J.E. (2021)
The ubiquitylation of IL-1b limits its cleavage by
caspase-1 and targets it for proteasomal degrada-
tion, Nat. Commun., 12, 2713, https://doi.org/10.1038/
s41467-021-22979-3.
48. Tong,Z., Yang, X., and Li,J. (2022) Research progress
on the mechanism of interleukin-1b on epiphyseal
plate chondrocytes, Eur.J. Med. Res., 27, 313, https://
doi.org/10.1186/s40001-022-00893-8.
49. Kalb, D.M., Adikari, S.H., Hong-Geller,E., and Werner,
J.H. (2019) Single-cell correlations of mRNA and pro-
tein content in a human monocytic cell line after LPS
stimulation, PLoS One, 14, e0215602, https://doi.org/
10.1371/journal.pone.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in published
maps and institutional affiliations. AI tools may have
been used in the translation or editing of this article.