Article

ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 8, pp. 1392-1401 © The Author(s) 2024. This article is an open access publication.

1392

Functional Analysis of the Channelrhodopsin Genes

from the Green Algae of the White Sea Basin

Olga V. Karpova

1,a

*, Elizaveta N. Vinogradova

1,2

, Anastasiya M. Moisenovich

Oksana B. Pustovit

, Alla A. Ramonova

, Denis V. Abramochkin

and Elena S. Lobakova

Division of Biology, Lomonosov Moscow State University, 119991 Moscow, Russia

Genome Center, National

Research Center “Kurchatov Institute”, 123182 Moscow, Russia

e-mail: olgakarpova@ymail.com

Received March 3, 2024

Revised May 31, 2024

Accepted June 19, 2024

Abstract— Optogenetics, the method of light-controlled regulation of cellular processes is based on the use

of the channelrhodopsins that directly generate photoinduced currents. Most of the channelrhodopsin genes

have been identified in the green microalgae Chlorophyta, and the demand for increasing the number of

functionally characterized channelrhodopsins and the diversity of their photochemical parameters keeps

growing. We performed the expression analysis of cation channelrhodopsin(CCR) genes in natural isolates of

microalgae of the genera Haematococcus and Bracteacoccus from the unique Arctic Circle region. The identi-

fied full-length CCR transcript of H.lacustris is the product of alternative splicing and encodes the Hl98CCR2

protein with no photochemical activity. The 5′-partial fragment of the B. aggregatus CCR transcript encodes

the Ba34CCR protein containing a conserved TM1-TM7 membrane domain and a short cytosolic fragment.

Uponheterologous expression of the TM1-TM7 fragment in CHO-K1 cell culture, light-dependent current gen-

eration was observed with the parameters corresponding to those of the CCR. The first discovered function-

al channelrhodopsin of Bracteacoccus has noclose CCR homologues and may be of interest as a candidate

for optogenetics.

DOI: 10.1134/S0006297924080030

Keywords: channelrhodopsins, green algae, photo-induced current, optogenetics

Abbreviations: RACE, rapid amplification of cDNA ends.

* To whom correspondence should be addressed.

INTRODUCTION

Channelrhodopsins are a special group of integral

membrane retinal-binding proteins, which carry out

direct passive ion transport in response to photoacti-

vation, unlike other rhodopsins (in particular, visual

ones) that regulate ion channels indirectly through ac-

tivation of enzymatic cascades [1]. In nature, channel-

rhodopsins are mainly found in motile pho totrophic

organisms, the microalgae Chlorophyta and Crypto-

phyta, where they act as the phototaxis photorecep-

tors. For the first time, photoelectric response in pho-

totaxis was shown in vivo in the cells of green alga

Haematococcus pluvialis [2] and subsequently stud-

ied in detail in the green alga Chlamydomonas rein-

hardtii [3]. The identified photoreceptors CrChR1 and

CrChR2 of C. reinhardtii are cation channelrhodopsins

(CCRs), which differ both in the photoinduction pa-

rameters and in the kinetics of photoelectric response

[3, 4]. It is assumed that the main role in phototaxis is

played by CrChR2, while CrChR1 is involved in protec-

tion from high-intensity light.

Due to unique features, channelrhodopsins are

widely used in optogenetics, a method of light-control-

led regulation of processes within cells. In the opto-

genetic experiment, with heterologous expression in

the target cells, the genes of channelrhodopsins and

ion pumps with specificity for cations and anions pro-

vide depolarization and hyperpolarization of the cell

membrane and thus allow to regulate neuronal activ-

ity [5]. Despite the vast progress in the search for new

CCR GENES OF GREEN ALGAE FROM WHITE SEA 1393

BIOCHEMISTRY (Moscow) Vol. 89 No. 8 2024

channelrhodopsin genes by genomic analysis meth-

ods, the number of genes encoding proteins with ex-

perimentally confirmed functional activity is still very

limited [6]. As a result, the cation channelrhodopsin

CrChR2 of green alga C. reinhardtii remains so far the

most studied and employed in various modifications

for optogenetic research.

Our work is aimed at finding new genes of chan-

nelrhodopsins in the unicellular algae Chlorophyta

and Cryptophyta of the White Sea basin and is based

on the collection of the microalga natural isolates

NAMSU (https://depo.msu.ru/open/public/en/search?

collection=algabiotech), created at the Bioengineering

Department, Division of Biology, Lomonosov Moscow

State University. The presented data expand the results

of our previous study focused on finding novel CCRs

in the green algae Haematococcus and Bracteacoccus.

Earlier, using the PCR-test developed in our laborato-

ry, presence of the CCR gene (34CCR) in the microalgae

of the Bracteacoccus genus was first shown; the CCR

genes (37CCR and non-homologous 98CCR1, 98CCR1-1

genes) corresponding to the already identified Haema-

tococcus lacustris CCR genes were also detected in two

H. lacustris isolates [7]. Thus, this PCR test was effec-

tive not only for analysis of a taxonomic group for the

presence of CCR genes, but also for analysis of the mul-

tigene CCR families.

To study expression of the detected CCR genes of

Haematococcus and Bracteacoccus, their transcripts

were obtained, structural analysis of their protein

products (Hl98CCR2 and Ba34CCR) was carried out,

and functional activity of Hl98CCR2 and Ba34CCR

was determined during heterologous expression in

the culture of Chinese hamster cells CHO-K1. We have

shown that Hl98CCR2 and Ba34CCR proteins contain 7

conserved membrane regions (TM1-TM7) with trans-

membrane localization and are capable of forming

homodimers, which is typical for the spatial struc-

ture of channelrhodopsins. In electrophysiological ex-

periments with transfected CHO-K1 cells using the

patch-clamp method, it was shown that the expressed

Ba34CCR protein is capable of light-dependent current

generation and is comparable to the cation channel-

rhodopsin CrChR2 of C. reinhardtii in its parameters.

Thus, we have discovered and characterized for the

first time a functional cation channelrhodopsin from

the green microalga Bracteacoccus.

MATERIALS AND METHODS

Origin of green algae strains (Chlorophyta)

and cultivation conditions were as previously de-

tailed [7]. To isolate total RNA, actively growing cul-

tures of H.lacustris NAMSU-BM-7/15 and B. aggregatus

NAMSU-BM-5/15 were cultivated in a BG-11 medium

with incubation for 1-2 weeks at 25°C and illumina-

tion with white light at the intensity of 40 μmol PAR

quanta m

–2

·s

–1

RNA isolation and production of CCR-specif-

ic transcripts. Total RNA was isolated from 5-10 ml

of cultures using a RNeasy plus kit (Qiagen, USA). For

RNA extraction, samples (~100 mg of wet weight) were

lysed by mechanical destruction in a FastPrep-24™ 5G

disintegrator (MP Biomedicals, USA) in the presence of

Lysing Matrix typeA microbeads. 250 ng of RNA were

taken to prepare cDNA; full-length transcripts were

prepared by rapid amplification of cDNA ends (RACE)

using a Mint-RACE kit (Evrogen, Russia). The obtained

PCR products were analyzed by electrophoresis in a

1% agarose gel and eluted from the gel with a Cleanup

Mini kit (Evrogen). Further, PCR products were se-

quenced using Sanger method (Center of the collective

use “Genome” at EIMB RAS, Russia), the sequences

were aligned and matched by homology sites (BLASTn,

NCBI).

Structural and functional characteristics of

translated CCR-specific transcript products and

3D modeling. To analyze the translated amino acid

sequences of the obtained CCR transcripts and to de-

termine the homology with the previously identified

Chlorophyta CCR proteins, we applied the CLUSTAL

Omega multiple alignment method (https://www.ebi.

ac.uk/Tools/msa/clustalo/). 3D modeling was performed

using the SWISS-MODEL program (https://swissmodel.

expasy.org/) with the crystal structure of CrChR2 C. re-

inhardtii as a template.

Heterologous expression of rhodopsins in

CHO-K1 cell culture. Construction of expression plas-

mids. For expression in mammalian cells, nucleotide

sequences of Hl98CCR2 (full reading frame, 350 a.a.)

and Ba34CCR (1-295 a.a.) transcripts were codon-opti-

mized (GeneArt; Thermo Fisher Scientific, USA); chem-

ical synthesis of both genes was performed (Evrogen)

and they were subcloned into a pcDNA3.1eYFP expres-

sion vector [8] at BamHI and NotI restriction sites.

Transfection of expression plasmids into CHO-K1

cell culture. An immortalized ovary epithelial cell line

of Chinese hamster Cricetulus griseus (Chinese hamster

ovary cells) was used for heterologous expression of

Ba34CCR and Hl98CCR2 proteins. Transfection of cells

with pcDNA3.1 eYFP. Ba34CCR and pcDNA3.1 eYFP.

Hl98CCR2 expression vectors was performed using

a Lipofectamine® LTX with Plus™ Reagent (Thermo

Fisher Scientific). Marker of successful transfection

was cell fluorescence excited with 490-nm light. Trans-

fected cells were maintained under standard culture

conditions in a DMEM/F12 culture medium (Gibco,

Thermo Fisher Scientific) supplemented with 10% fetal

bovine serum (FBS; HyClone, USA), 2 mM glutamine

(Sigma-Aldrich, USA), and 100 μg/ml penicillin-strepto-

mycin (Gibco, Thermo Fisher Scientific) at 37°C under

KARPOVA et al.1394

BIOCHEMISTRY (Moscow) Vol. 89 No. 8 2024

21% O

and 5% CO

. Twenty-four hours after trans-

fection, 1 μM R2500 trans-retinal (Sigma-Aldrich) was

added to the culture medium.

Fluorescence microscopy of expressed rhodopsins.

To determine localization of the expressed proteins

Ba34CCR and Hl98CCR2, transfected CHO-K1 cells were

treated with fluorescent dyes specific for cytoplasmic

membranes (CellBrite Red; Biotium, UK) and nuclei

(Hoechst 33342, Thermo Fisher Scientific). For that,

cells were incubated with 10 μM CellBrite Red in nor-

mal medium containing 1% DMSO and 5 μg/ml Hoechst

33342 for 15 min, washed twice with PBS and once

with DMEM. Intravital images were obtained using an

Eclipse Ti-E microscope life support system with a con-

focal A1 module (Nikon Corporation, Japan) and Apo

TIRF63×/1.49 lens. All images were captured using the

same dynamic range settings.

Photoelectric activity determination for Ba34C-

CR and Hl98CCR2 rhodopsins. Electrophysiological

experiments were performed 48h after transfection.

Photo-induced current of Hl98CCR2 (I

) or Ba34CCR

) was recorded in the transfected CHO-K1 cells using

whole-cell patch-clamp technique. An Axopatch200A

amplifier (Molecular Devices, USA) was used.

A coverslip with CHO-K1 culture was placed in

an experimental chamber and perfused at room tem-

perature (23 ± 0.5°C) with a solution of the following

composition: 150 mM NaCl; 5.4 mM KCl; 1.8 mM CaCl

;

1.2 mM MgCl

; 10 mM glucose; 10 mM HEPES (pH 7.6).

Only cells emitting green fluorescence upon exposure

to 490-nm excitation light were selected for examina-

tion. 2-2.5 MOhm patch pipettes were made of borosil-

icate glass (Sutter, USA) and filled with a solution of

the following composition: 140 mM KCl; 1 mM MgCl

;

5 mM EGTA; 4 mM MgATP; 10 mM HEPES; 0.03 mM

GTP (pH 7.2). Before the start of current recording,

the pipette capacity, test cell capacity, and access re-

sistance were compensated. Both transmitted light and

490-nm light were also turned off. In data processing,

current amplitudes were normalized to cell capacity

and expressed in pA/pF.

To record I

and I

, two different protocols were

used to study dependence of the current density on in-

tensity of the excitation light and current-voltage de-

pendence, respectively. Both protocols used a holding

potential of –60 mV. In the first protocol, the potential

value was 0 mV, and then 490-nm light was turned

on for 1 s; the resulting outward current was photo-

induced, since there is no leakage current at a poten-

tial of 0 mV. Light intensity of 1, 2, 3, 5, 10, 20, 50, and

100% of the maximum possible for a CoolLED pE-100

light source (CoolLED, UK) was sequentially applied.

Absolute values of light intensity were determined

using a PM160T sensor (Thorlabs, USA). In the second

protocol, the potential was changed stepwise from the

holding potential to values from –100 to 60 mV with a

step of 20 mV for 2 s, while during each of the steps

490-nm light was turned on with intensity of 50% of

the maximum for 1 s. The photo-induced current in

this case was calculated as the difference between the

current in the presence and absence of excitation light

at each of the membrane potential values. In both cas-

es, the maximum (peak) value of the light-induced cur-

rent, as well as the current plateau level (average cur-

rent value in the range of 500-1000 ms of light supply)

were measured. Statistical processing of the results

and plotting were performed using GraphPad Prism 7.

The data are presented as a mean ± standard error of

the mean.

RESULTS

Obtaining CCR transcripts from green microal-

gae Haematococcus and Bracteacoccus. Total RNA of

Haematococcus and Bracteacoccus was isolated accord-

ing to the method described in Materials and Methods

section, after which the CCR-specific transcripts were

prepared by rapid amplification of cDNA ends (RACE).

The RACE procedure was performed sequentially over

3 rounds of PCR using primers presented in Table 1.

As a result, a full-length transcript of the CCR gene

of H. lacustris NAMSU-BM-7/15 and a 5′-partial frag-

ment of the CCR transcript of B.aggregatus NAMSU-

BM-5/15 gene were obtained.

The CCR transcript of Haematococcus was not the

product of any of the genes we have identified previ-

ously [98CCR1 (GenBank: ON643073.1) and 98CCR1-1

(GenBank: ON643074.1)], as it was expected initially,

but subsequently we identified it as the 98CCR2 gene

(data not shown). Homology between the obtained

Hl98CCR2 transcript (GenBank: PP103616) and the

98CCR1 gene is 81.9%.

We were unable to obtain a full-length tran-

script of the Bracteacoccus NAMSU-BM-5/15 CCR gene,

but the 5′-partial fragment of the Ba34CCR transcript

(GenBank: PP103617) was determined to be a prod-

uct of the previously identified 34CCR gene (GenBank:

ON643076.1). As of now, the Ba34CCR transcript has

been entirely mapped to the genomic sequence; it was

found that the corresponding gene region contains

4introns.

Structural and functional characteristics of

Hl98CCR2 and Ba34CCR protein products and 3D

modeling. To determine structural and functional

characteristics, homology modeling was used by align-

ing the translated amino acid sequences of native CCR

transcripts obtained by homologous cloning [9] or

identified by the transcriptome analysis [3, 10, 11].

Figure 1 shows alignment of the translated ami-

no acid sequences of the Haematococcus CCR gene

products and their native transcripts. As shown in Fig.1,

CCR GENES OF GREEN ALGAE FROM WHITE SEA 1395

BIOCHEMISTRY (Moscow) Vol. 89 No. 8 2024

Table 1. PCR primers for amplification of Haematococcus and Bracteacoccus CCR cDNA

RACE, rounds

Gene-specific primers

Haematococcus Bracteacoccus

RACE 5′

round 1 CCR_rev: CCCTTGGGMACDGTRTGGTA 34CCR-ORF_rev: ACCACAGTGTGCGCGACGA

round 2 Hae-687_rev: GTTGGGTGGACTCATAGCCGCAG 34CCR1_rev: CCGTAGCACAAACCAATGCAGA

round 3 98CCR1_rev: GGTGCGTTTGGAGTAGTCATCC 34CCR2_rev: CAAACCCGTCAGGTTGGACAAG

RACE 3′

round 1 CCR_fwd: YGGHTGGGARGAGRTBTACGT 34CCR1_fwd: CTTGTCCAACCTGACGGGTTTG

round 2 Hae-536_fwd: GGAGTGGTTACTGTCATGCCCAGT 34CCR2_fwd: TCTGCATTGGTTTGTGCTACGG

round 3 98CCR1_ fwd: GGATGACTACTCCAAACGCACC 34CCR3_fwd: TCGTCGCGCACACTGTGGT

Hl37CCR, Hl98CCR1, Hl98CCR2, and Hl98CCR1-1 prod-

ucts contain 7 membrane spirals and conserved amino

acid residues typical of channelrhodopsins. There is a

retinal binding site, Lys257, Glu (82, 83, 101, and 123),

as well as Glu90 that determines specificity of the rho-

dopsins cation transfer [1, 6]. Glu235 and Ser245, in-

volved in determining the pH dependence of the spec-

tral characteristics of CCR proteins, are also conserved.

Hou et al. [9] showed for the Mesostigma viride CCR

that replacing Ser at 245 position with Glu resulted in

the complete loss of channel activity. Ser321 is the only

CrChR2 protein phosphorylation site that is located in

the conserved region of the cytosolic loop adjacent to

the TM7 transmembrane domain (helix 7). We were

unable to determine presence of a phosphorylation

site in Hl98CCR2 because the 3′-end of the transcript

exhibited low homology.

The closest homologue of the Ba34CCR partial

transcript product of B. aggregatus NAMSU-BM-5/15 is

CrChR2 C. reinhardtii (59.2% identity at 73% sequence

coverage). Figure2 shows alignment of the translat-

ed amino acid sequences of Ba34CCR and native CCR

transcripts from different Chlamydomonas species.

TheBa34CCR transcript encodes the entire TM1-TM7

membrane fragment with all conserved amino acid

residues and a unique Lys-enriched fragment lacking

homology.

Thus, based on the primary structure analysis of

the Hl98CCR2 and Ba34CCR native transcript prod-

ucts, we conclude that the encoded proteins contain

7 conserved membrane regions (TM1-TM7), along

with the functionally significant amino acid residues

characteristic of the channelrhodopsins. 3D models

of Hl98CCR2 and Ba34CCR proteins also demonstrat-

ed a spatial structure typical of channelrhodopsins:

transmembrane localization of the TM1-TM7 fragment

and formation of homodimers (Fig.3). These results

allow identification of Hl98CCR2 and Ba34CCR pro-

teins as channelrhodopsins and indicate their possible

functional activity.

Determination of functional activity of Ba34C-

CR and Hl98CCR2 channelrhodopsins. This task

was performed using an approach first proposed by

Nagel et al. [12, 13]. When expressed in Xenopus lae-

vis oocytes or in animal cells (HEK293, BHK), chan-

nelrhodopsins C. reinhardtii were shown to function

as light-dependent cation channels. Moreover, not

only full-length proteins, but also their TM1-TM7 frag-

ments were shown to be capable of photoinducing

ion currents, which could be detected by patch-clamp

method. Thus, the experimental task of this step was

to determine photoelectric activity of Ba34CCR and

Hl98CCR rhodopsins during heterologous expression

in mammalian cells.

Heterologous expression of Ba34CCR and Hl98CCR2

in the culture of CHO-K1 cells. For expression in mam-

malian cells, Hl98CCR2 and Ba34CCR codon-optimized

cDNA nucleotide sequences were subcloned into the

pcDNA3.1eYFP expression vector as described in Ma-

terials and Methods section, where the analyzed genes

were transcribed from the highly efficient P_CMV

promoter of cytomegalovirus and translated in the

same frame with YFP (a fluorescence marker). Theob-

tained pcDNA3.1 eYFP. Ba34CCR and pcDNA3.1 eYFP.

Hl98CCR2 expression plasmids were used to transfect

an immortalized Chinese hamster ovary epithelial cell

line CHO-K1. The level of expression and intracellular

localization of Ba34CCR-YFP and Hl98CCR2-YFP protein

conjugates in the transfected cells were determined by

intravital fluorescence microscopy after treatment of

the cells with specific dyes.

The results of a typical experiment are shown in

Fig.4. Comparison of the intrinsic fluorescence of the

Ba34CCR and Hl98CCR2 YFP conjugates with the cell

staining with CellBrite Red determines clearly localiza-

tion of the expressed proteins in the cytoplasmic mem-

brane. Expression level of the full-length Hl98CCR2

protein was reproducibly observed to be below the ex-

pression level of the Ba34CCR protein TM1-TM7 mem-

brane fragment.

KARPOVA et al.1396

BIOCHEMISTRY (Moscow) Vol. 89 No. 8 2024

Fig. 1. Alignment of translated amino acid sequences (CLUSTAL Omega) of the Haematococcus CCR gene products and

their native transcripts. Hl37CCR, 94a.a.; Hl98CCR1, 84 a.a.; Hl98CCR1-1, 97 a.a., fragments of H. lacustris CCR genes [7];

Hl98CCR2, 350a.a., native transcript of the gene 98CCR2; native transcripts: HpChR1 H.pluvialis (lacustris), 677a.a. (GenBank:

JN596950[9]); HpChR H.pluvialis (lacustris), 449a.a [11]; HNG2ChR Haematococcussp. NG2 , 350a.a [11]; HdChR H.droebaken-

sis, 307a.a. (GenBank: KF992059[10]); CrChR2 C.reinhardtii, 737a.a. (GenBank: AF508966[3]). Functionally significant amino

acid residues (numbering corresponds to CrChR2) are highlighted by the following colors: Glu (82, 83, 90, 97, 101, and 123)–

red; Glu235 and Ser245– light blue; Lys257– green; Ser321– yellow.

CCR GENES OF GREEN ALGAE FROM WHITE SEA 1397

BIOCHEMISTRY (Moscow) Vol. 89 No. 8 2024

Fig. 2. Alignment of translated amino acid sequences (CLUSTAL Omega) of native CCR transcript products from Bractea-

coccus and Chlamydomonas. Ba34CCR: partial transcript of the 34CCR gene B.aggregatus NAMSU-BM-5/15, 325a.a.; native

transcripts: CrChR2 C.reinhardtii, 737a.a. (GenBank: AF508966[3]); CaChR1 C.augustae, 715a.a. (GenBank: JN596951[9]);

CraChR2 C.raudensis, 635a.a. (GenBank: JN596949[9]); CyChR1 C.yellowstonensis, 717a.a. (GenBank: JN596948[9]). Function-

ally significant amino acid residues (numbering corresponds to CrChR2) are highlighted by the following colors: Glu (82, 83, 90,

97, 101, and 123)– red; Glu235 and Ser245– light blue; Lys257– green; Ser321– yellow.

Determination of photoelectric activity of the ex-

pressed Ba34CCR and Hl98CCR2 rhodopsins. Figure 5

shows the results of experiments with CHO-K1 cells

transfected with plasmids pcDNA3.1 eYFP. Ba34CCR

and pcDNA3.1eYFP.Hl98CCR2.

In the cells expressing Hl98CCR2, the 490-nm

light in the absence of transmitted light at a mem-

brane potential of –20 mV did not contribute to gen-

eration of the pronounced I

inward or outward cur-

rent (Fig. 5a), or this current was at the noise level.

Therefore, dependence of the current on intensity and

membrane potential could not be analyzed.

In the cells expressing Ba34CCR, the 490-nm

light in the absence of transmitted light at a mem-

brane potential of –20 mV contributed to the I

in-

coming current generation (Fig. 5b), which at the

light intensity values from 0.67 mW/mm

and high-

er had a pronounced peak component that decayed

within 20-65 ms, as well as a stationary component

(plateau). The mean value of time constant for the

peak I

decay at –60 mV was 11.3 ± 0.78 ms (n = 14).

Mean value of the I

plateau current deactivation

with the light turned off was 25.5 ± 2.5 ms (n = 14).

The observed dependence could be explained by

KARPOVA et al.1398

BIOCHEMISTRY (Moscow) Vol. 89 No. 8 2024

Fig. 3. 3D models of identified Ba34CCR(a) and Hl98CCR2(b) channelrhodopsins (SWISSMODEL). The crystal structure of

CrChR2 C. reinhardtii, 6eid.1.A, is used as a template. N and C indicate localization of polypeptide chain ends. Color code (red to

blue) shows the level of homology with the template.

desensitization of the channels formed by the Ba34CCR

protein.

peak and plateau current amplitudes demon-

strated positive dependence on the 490-nm light inten-

sity up to 2.8 mW/mm

. Further increase in the light

intensity resulted in the decrease in the amplitude of

the peak current (Fig.5,b andc). At the negative mem-

brane potential values, both peak current and plateau

current have an inward direction. When crossing the

0-mV level and when the membrane potential is posi-

tive, the current direction changes to the outward one

(Fig.5d). Thus, 0mV is the reversible potential for I

current under the experimental conditions indicated

in the Materials and Methods section.

DISCUSSION

With the development of optogenetic studies, the

demand for a wider variety of channelrhodopsins’

functional characteristics to solve various experimen-

tal problems is growing significantly. As a result, re-

searchers are still turning to the analysis of microalgae

Chlorophyta, a huge group of phototrophic organisms

with a variety of forms and habitats, in search of new

candidate genes for optogenetics. According to the data

available in 2021 [6], testing of 56 CCR genes in Chloro-

phyta (out of 164 identified ones) revealed functional

activity of 40 genes; there are also data on first identifi-

cation and functional activity of the anion channelrho-

dopsin (ACR) genes in green algae [11]. We considered

it relevant to analyze the genes of channelrhodop-

sins of the natural microalgae isolates of the genera

Haematococcus and Bracteacoccus from the White Sea

basin and determine functional activity of their pro-

tein products.

Previously, we identified 2 non-homologous CCR

genes in the microalga H. lacustris NAMSU-BM-7/15

(98CCR1 and 98CCR1-1), however, a full-length Hl98C-

CR2 transcript obtained and characterized in the ex-

pression analysis was not the product of any of the

abovementioned genes. Thus, by rapid amplification

of cDNA ends (RACE) using degenerate primers, we

were able to detect the third CCR gene of H. lacustris

NAMSU-BM-7/15.

Since 7 predicted H. lacustris CCR genes have al-

ready been deposited in the GenBank database, it

seemed relevant to determine homologues of the

98CCR1-1, 98CCR1, and 98CCR2 genes identified in the

H. lacustris NAMSU-BM-7/15 strain. According to our

data, the 98CCR1-1 gene is mapped in a single region

of the genome containing (presumably) the channel-

rhodopsin gene (GenBank: GFH21497). The 98CCR1

gene exhibits the same homology (85% identity at 95%

sequence coverage) with two regions containing chan-

nelopsin1 genes (GenBank: GFH25618 and GFH12230).

The 98CCR2 gene and the Hl98CCR2 transcript, re-

spectively, are mapped in the vast 8-kbp region of the

BLLF01000737 contig, encoding the channelopsin 1

gene (GenBank: GFH14526). However, it is noteworthy

that the open reading frame of the Hl98CCR2 does not

correspond to the model assembly of the GFH14526

protein. Based on these results, we conclude that the

native Hl98CCR2 transcript is one of the alternative

splicing variants.

In this regard, we used the native CCR transcripts

Haematococcus identified in the transcriptomes or

obtained by homologous cloning for comparative

analysis of the Hl98CCR2 transcript protein product

(Fig.1). Itis noteworthy that the full-length Hl98CCR2

transcript encodes a conserved TM1-TM7 membrane

fragment with a short Ser-enriched hydrophilic re-

gion with a total size of 350 a.a. In contrast, all native

CCR transcripts, as well as 5 of the 6 predicted full-

length H. lacustris CCR genes, encode giant proteins

of ~700 a.a. including cytosolic sequences. Notably, the

identified Hl98CCR2 is the product of a single “short”

predicted gene (GenBank: GFH14526). It remains

CCR GENES OF GREEN ALGAE FROM WHITE SEA 1399

BIOCHEMISTRY (Moscow) Vol. 89 No. 8 2024

Fig. 4. Examination of localization of the expressed Ba34CCR and Hl98CCR2 rhodopsins in CHO-K1 cells by intravital confocal

microscopy: Ba34CCR-YFP (upper row) and Hl98CCR2-YFP (lower row). Cell membranes are stained with CellBrite Red; nuclei

are stained with Hoechst 33342. Scale bar: 10μm.

Fig. 5. Characterization of currents generated by Ba34CCR and Hl98CCR2 proteins during the expression in CHO-K1 cells. a)Rep-

resentative example of original Hl98CCR2 current records (I

) induced by 490-nm light at –20mV. b)Representative example

of original Ba34CCR current records (I

) of different intensities induced by the 490-nm light (intensity is indicated at the

peak of each of the curves as a percentage of the maximum, in absolute values of mW/mm

), at a potential level of –20mV.

c)Dependence of I

peak current and I

plateau current on the 490-nm light intensity. d)Voltage-current curves of I

peak

current and stationary current (plateau) of the 490-nm light-induced at 50% of maximum intensity (6.25mW/mm

unclear why the dominant CCR protein of H. lacustris

NAMSU-BM-7/15 contains only the TM1-TM7 mem-

brane fragment, and what conditions required for

expression of the full-length CCR proteins with regu-

latory cytosolic regions [14]. The Hl98CCR2 membrane

integral protein contains all functionally significant

amino acid residues, characteristic of CCR proteins,

and forms dimers, but does not show photoelectric ac-

tivity during heterologous expression in animal cells

under standard conditions (Fig.5a). So far, we do not

exclude that, possibly, the Hl98CCR2 protein requires

other conditions for generation of photocurrents (ab-

sorption spectrum, pH), however, it is worth to men-

tion that its closest homologue and the only tested

CCR protein of H. lacustris, HpChR1 (85% identity) also

does not demonstrate photoelectric activity [9]. More-

over, among the CCR transcripts of Haematococcus,

only the transcript from Haematococcus droebakensis

was confirmed to have a functional protein product,

HdChR [10].

KARPOVA et al.1400

BIOCHEMISTRY (Moscow) Vol. 89 No. 8 2024

The product of the 34CCR gene, Ba34CCR, is of

great interest, since it is the first identified channel-

rhodopsin in the microalga of the Bracteacoccus genus.

We were able to obtain the 5′-partial transcript frag-

ment of the CCR gene B. aggregatus NAMSU-BM-5/15,

which encodes a TM1-TM7 membrane fragment and

a short Lys-enriched region that does not have any

homology. The Ba34CCR protein shows a low level of

homology with the channelrhodopsins of Chlorophyta:

the closest homologue is CrChR2 C. reinhardtii (59%

identity). According to the results of 3D modeling, the

Ba34CCR protein has transmembrane localization and

forms homodimers, which is characteristic of chan-

nelrhodopsins (Fig. 3). All known CCR transcripts of

Chlamydomonas encode proteins of 650-750 a.a. con-

taining a cytosolic fragment along with the membrane

fragment TM1-TM7 [9]. It is likely that the full-length

Ba34CCR product also belongs to this class of proteins.

During the heterologous expression of the

TM1-TM7 fragment of the Ba34CCR protein (1-295 a.a.)

in CHO-K1 cell culture, its effective accumulation in

the cytoplasmic membrane has been observed (Fig. 4).

We also performed electrophysiological experiments

using the patch-clamp technique and showed that

current generation (I

) occurs in the cells expressing

Ba34CCR in response to illumination with the 490-nm

light (Fig.5,b-d).

Since the action spectrum of Ba34CCR rhodopsin

has not been studied at this stage, we consider the re-

sults obtained as preliminary, and their comparison

with the available detailed electrophysiological char-

acteristics of channelrhodopsins CrChR1 and CrChR2

is only partially possible. Nevertheless, it is obvious

that the I

photo-induced current is significantly clos-

er in its properties to the current generated by the

CrChR2 compared to the CrChR1 rhodopsin current.

Like the CrChR2 current [13], I

is subjected to desen-

sitization (inactivation): under the constant supply of

excitation light, it weakens spontaneously, plateauing

for several tens of milliseconds. On the contrary, for

the current generated by the CrChR1, desensitization is

uncharacteristic [12].

The data published in a recent work by Hososhima

etal. [15] allow comparing amplitude and kinetic char-

acteristics of the current generated by the CrChR2 with

, considering that CrChR2 data were obtained using

heterologous expression in another cell line (ND7/23).

The cells expressing CrChR2, when irradiated with

the light at intensity of 2.7 mW/mm

, generated a cur-

rent at holding potential of –60 mV with peak densi-

ty of 32 ± 3.2 pA/pF, decreasing to the plateau level of

12 ± 1.1 pA/pF [15]. In our experiments, light of almost

the same intensity (2.8 mW/mm

) was provided at

holding potential of –20 mV, however, considering the

known voltage-current dependence of the I

(Fig. 5d),

it is possible to estimate approximately the I

peak val-

ue at –60 mV as 3.7 pA/pF, and the plateau current val-

ue as 1.06 pA/pF. Thus, the CrChR2 is able to generate

approximately 10 times more current than Ba34CCR,

when irradiated with the light of same intensity at

470 nm and 490-nm, respectively. On the other hand,

the plateau current value is approximately 37.5% of

the peak current value for CrChR2 [15] and 35% for I

Hence, the CrChR2 and Ba34CCR currents hardly differ

in this parameter.

Kinetic characteristics of the I

are comparable

with those of the CrChR2 current. The plateau current

deactivation time constant occurring after turning off

the 490-nm light was 25.5 ± 2.5 ms (n = 14) for I

, while

the CrChR2 current, according to Hososhima etal. [15],

deactivates 2 times faster (τ

off

 = 12.2 ± 0.69 ms). Inac-

tivation of the I

peak component, to the contrary,

occurs several times faster (τ = 11.3 ± 0.78 ms; n = 14)

than the estimated inactivation time for the CrChR2

current(~63ms).

The current generated by the CrChR2 has a rever-

sion potential of ~0 mV with an ion composition of the

external environment close to that used in our study

[13]. Moreover, if at potentials close to 0 mV (from

–40 to 40 mV), the voltage-current dependence of this

current is close to linear, then with stronger hyperpo-

larization, dependence of the inward current on the

potential becomes close to exponential. Exactly the

same type of voltage-current dependence is character-

istic of I

. Unlike the CrChR1 current with exclusively

proton nature, the CrChR2 current is the mixed cation

current. That is due to indiscriminate permeability of

the CrChR2 for various cations, including bivalent ones

[13]. This is the reason for the zero-reversion poten-

tial of this current under standard physiological con-

ditions. Further experiments with variations in the ion

composition of the external and intracellular solution

will reveal whether the I

current is also a non-selec-

tive cation current.

Acknowledgments. The authors express gratitude

to T. A. Fedorenko (Lomonosov Moscow State Universi-

ty) for providing cultures and cultivation recommenda-

tions, to the MIPT Aging Center (Dolgoprudny) for the

provided expression vector pcDNA3.1eYFP, as well as

to E. G. Maksimov (Lomonosov Moscow State Universi-

ty) for the provided radiation intensity meter. Forthis

study we used equipment purchased within the task of

the “Moscow University’s Development Program until

2020” and the equipment of M. V. Lomonosov Moscow

State University Center of the collective use.

Contributions. E.S.L., O.V.K., and D.V.A. super-

vised the study and came up with the concept; E.N.V.,

O.V.K., A.M.M., O.B.P., and A.A.R. conducted experi-

ments; E.S.L., O.V.K., and D.V.A. discussed the study re-

sults; O.V.K. and D.V.A. prepared the manuscript; E.S.L.

andD.V.A. edited the manuscript.

CCR GENES OF GREEN ALGAE FROM WHITE SEA 1401

BIOCHEMISTRY (Moscow) Vol. 89 No. 8 2024

Funding. This work was financially support-

ed by the Ministry of Science and Higher Educa-

tion of the Russian Federation under the agreement

no. 075-15-2021-1396 of 26.10.2021. DNA sequencing

was carried out as part of the State Budget project

ofthe Kurchatov Institute Research Center.

Ethics declaration. This work does not describe

any studies involving humans or animals as objects

performed by any of the authors. The authors of this

work declare that they have no conflicts of interest.

Open access. This article is licensed under a Cre-

ative Commons Attribution 4.0 International License,

which permits use, sharing, adaptation, distribution,

and reproduction in any medium or format, as long

as you give appropriate credit to the original author(s)

and the source, provide a link to the Creative Commons

license, and indicate if changes were made. Theimages

or other third-party material in this article are includ-

ed in the article’s Creative Commons license, unless

indicated otherwise in a credit line to the material.

Ifmaterial is not included in the article’s Creative Com-

mons license and your intended use is not permitted

by statutory regulation or exceeds the permitted use,

you will need to obtain permission directly from the

http://creativecommons.org/licenses/by/4.0/.

REFERENCES

1. Govorunova, E.G., Sineshchekov, O.A., and Spudich,

J.L. (2022) Emerging diversity of channelrhodopsins

and their structure-function relationships, Front.

Cell. Neurosci., 15, 800313, https://doi.org/10.3389/

fncel.2021.800313.

2. Sineshchekov, O. A., Govorunova, E. G., Der, A.,

Keszthelyi, L., and Nultsch, W. (1992) Photoelec-

tric responses in phototactic flagellated algae mea-

sured in cell suspension, J.Photochem. Photobiol. B

Biol., 13, 119-134, https://doi.org/10.1016/1011-1344

(92)85051-u.

3. Sineshchekov, O. A., Jung, K.-H., and Spudich, J. L.

(2002) Two rhodopsins mediate phototaxis to low-

and high-intensity light in Chlamydomonas reinhard-

tii, Proc. Natl. Acad. Sci. USA, 99, 8689-8694, https://

doi.org/10.1073/pnas.122243399.

4. Govorunova, E. G., Jung, K.-W., Sineshchekov, O. A.,

and Spudich, J.L. (2004) Chlamydomonas sensory rho-

dopsinsA andB: cellular content and role in photo-

phobic responses, Biophys.J., 86, 2342-2349, https://

doi.org/10.1016/s0006-3495(04)74291-5.

5. Deisseroth,K. (2015) Optogenetics: 10years of micro-

bial opsins in neuroscience, Nat. Neurosci., 18, 1213-

1225, https://doi.org/10.1038/nn.4091.

6. Govorunova, E.G., Sineshchekov, O.A., Li,H., Wang,Y.,

Brown, L.S., Palmateer,A., Melkonian,M., Cheng,S.,

Carpenter,E., Patterson,J., Wong, G.K., and Spudich,

J. L. (2021) Cation and anion channelrhodopsins:

sequence motifs and taxonomic distribution, mBio, 12,

e0165621, https://doi.org/10.1128/mbio.01656-21.

7. Karpova, O.V., Vinogradova, E.N., and Lobakova, E.S.

(2022) Identification of the channelrhodopsin genes

in the green and cryptophytic algae from the White

and Black seas, Biochemistry (Moscow), 87, 1187-1198,

https://doi.org/10.1134/s0006297922100121.

8. Galietta, L. J., Haggie, P. M., and Verkman, A. S.

(2001) Green fluorescent protein-based halide in-

dicators with improved chloride and iodide affini-

ties, FEBS Lett., 499, 220-224, https://doi.org/10.1016/

s0014-5793(01)02561-3.

9. Hou, S. Y., Govorunova, E. G., Ntefidou, M., Lane,

C.E., Spudich, E.N., Sineshchekov, O.A., and Spudich,

J.L. (2012) Diversity of Chlamydomonas channelrho-

dopsins, Photochem. Photobiol., 88, 119-128, https://

doi.org/10.1111/j.1751-1097.2011.01027.x.

10. Klapoetke, N.C., Murata,Y., Kim, S.S., Pulver, S. R.,

Birdsey-Benson,A., Cho, Y.K., Morimoto, T.K., Chuong,

A.S., Carpenter, E.J., Tian,Z., Wang,J., Xie,Y., Yan,Z.,

Zhang, Y., Chow, B. Y., Surek, B., Melkonian, M., Ja-

yaraman,V., Constantine-Paton,M., Wong, G.K., and

Boyden, E.S. (2014) Independent optical excitation of

distinct neural populations, Nat. Methods, 11, 338-346,

https://doi.org/10.1038/nmeth.2836.

11. Rozenberg,A., Oppermann, J., Wietek, J., Fernandez

Lahore, R.G., Sandaa, R.A., Bratbak,G., Hegemann,P.,

and Béjà,O. (2020) Lateral gene transfer of anion-con-

ducting channelrhodopsins between green algae

and giant viruses, Curr. Biol., 30, 4910-4920, https://

doi.org/10.1016/j.cub.2020.09.056.

12. Nagel,G., Ollig,D., Fuhrmann,M., Kateriya,S., Musti,

A.M., Bamberg,E., and Hegemann,P. (2002) Channel-

rhodopsin-1: a light-gated proton channel in green

algae, Science, 296, 2395-2398, https://doi.org/10.1126/

science.1072068.

13. Nagel, G., Szellas, T., Huhn, W., Kateriya, S., Ade-

ishvili, N., Berthold, P., Ollig, D., Hegemann, P., and

Bamberg, E. (2003) Channelrhodopsin-2, a direct-

ly light-gated cation-selective membrane channel,

Proc. Natl. Acad. Sci. USA, 100, 13940-13945, https://

doi.org/10.1073/pnas.1936192100.

14. Govorunova, E. G., and Sineshchekov, O. A. (2023)

Channelrhodopsins: from phototaxis to optogenet-

ics, Biochemistry (Moscow), 88, 1555-1570, https://

doi.org/10.1134/s000629792310015.

15. Hososhima,S., Ueno,S., Okado,S., Inoue,K., and Kon-

no,M. (2023) Alight-gated cation channel with high

reactivity to weak light, Sci. Rep., 13, 7625, https://

doi.org/10.1038/s41598-023-34687-7.

Publisher’s Note. Pleiades Publishing remains

neutral with regard to jurisdictional claims in pub-

lished maps and institutional affiliations.