ISSN 0006-2979, Biochemistry (Moscow), 2024, Vol. 89, No. 5, pp. 883-903 © Pleiades Publishing, Ltd., 2024.
883
Molecular Changes in Immunological Characteristics
of Bone Marrow Multipotent Mesenchymal Stromal Cells
in Lymphoid Neoplasia
Nataliya A. Petinati
1,a
*
#
, Aleksandra V. Sadovskaya
1,2#
, Natalia V. Sats
1
,
Nikolai M. Kapranov
1
, Yulia O. Davydova
1
, Ekaterina A. Fastova
1
,
Aminat U. Magomedova
1
, Anastasia N. Vasilyeva
1
, Olga A. Aleshina
1
,
Georgiy P. Arapidi
3,4,5
, Viktoria O. Shender
3,4
, Igor P. Smirnov
3
, Olga V. Pobeguts
3
,
Maria A. Lagarkova
3
, Nina I. Drize
1
, and Elena N. Parovichnikova
1
1
National Medical Research Center for Hematology, Ministry of Health of the Russian Federation,
125167 Moscow, Russia
2
Lomonosov Moscow State University, 119991 Moscow, Russia
3
Lopukhin Federal Research and Clinical Center of Physical-Chemical Medicine,
Federal Medical Biological Agency, 119435 Moscow, Russia
4
Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences,
117997 Moscow, Russia
5
Moscow Institute of Physics and Technology, 141700 Dolgoprudny, Russia
a
e-mail: loel@mail.ru
Received September 15, 2023
Revised November 22, 2023
Accepted November 23, 2023
Abstract— Immune system and bone marrow stromal cells play an important role in maintaining normal he-
matopoiesis. Lymphoid neoplasia disturbs not only development of immune cells, but other immune response
mechanisms as well. Multipotent mesenchymal stromal cells (MSCs) of the bone marrow are involved in immune
response regulation through both intercellular interactions and secretion of various cytokines. In hematological
malignancies, the bone marrow stromal microenvironment, including MSCs, is altered. Aim of this study was to
describe the differences of MSCs’ immunological function in the patients with acute lymphoblastic leukemia (ALL)
and diffuse large B-cell lymphoma (DLBCL). In ALL, malignant cells arise from the early precursor cells localized
in bone marrow, while in DLBCL they arise from more differentiated B-cells. In this study, only the DLBCL patients
without bone marrow involvement were included. Growth parameters, surface marker expression, genes of in-
terest expression, and secretion pattern of bone marrow MSCs from the patients with ALL and DLBCL at the onset
of the disease and in remission were studied. MSCs from the healthy donors of corresponding ages were used as
controls. It has been shown that concentration of MSCs in the bone marrow of the patients with ALL is reduced at
the onset of the disease and is restored upon reaching remission; in the patients with DLBCL this parameter does
not change. Proliferative capacity of MSCs did not change in the patients with ALL; however, the cells of the DLBCL
patients both at the onset and in remission proliferated significantly faster than those from the donors. Expression
of the membrane surface markers and expression of the genes important for differentiation, immunological status
maintenance, and cytokine secretion differed significantly in the MSCs of the patients from those of the healthy
donors and depended on nosology of the disease. Secretomes of the MSCs varied greatly; a number of proteins
associated with immune response regulation, differentiation, and maintenance of hematopoietic stem cells were
Abbreviations: ALL, acute lymphoblastic leukemia; Ct,number of cycles required to reach the probe fluorescence threshold
in PCR; DLBCL,diffuse large B-cell lymphoma; HSCs,hematopoietic stem cells; MFI,mean fluorescence intensity; MSCs,mul-
tipotent mesenchymal stromal cells; REL,relative expression level.
* To whom correspondence should be addressed.
# These authors contributed equally to this work.
PETINATI et al.884
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
depleted in the secretomes of the cells from the patients. Lymphoid neoplasia leads to dramatic changes in the
functional immunological status of MSCs.
DOI: 10.1134/S0006297924050092
Keywords: multipotent mesenchymal stromal cells, acute lymphoblastic leukemia, diffuse large B-cell lymphoma,
gene expression, protein secretion
INTRODUCTION
Bone marrow is responsible for production and
maintenance of blood cell populations, including im-
mune cells, throughout the human life. In addition, it
acts as an important lymphoid organ, housing many
types of mature lymphocytes including B cells, T cells,
natural killer T cells, and innate immune cells [1].
Inbone marrow, lymphoid cells interact with the stro-
mal microenvironment and are involved in regulation
of hematopoiesis and immune response. Hematopoi-
etic stem cells (HSCs) reside in the specialized niches
that maintain them for lifelong blood cell production.
Niches also provide homing and survival of HSCs, reg-
ulate their dormant state, self-renewal, differentiation,
and proliferation. Many cell types are involved in for-
mation and functioning of these niches [2]. Main niche
components include mesenchymal stem cells, which
differentiate into numerous other stromal cells that
make up the niche, keep HSCs in it, and take part in
immune responses in the bone marrow [3].
B-cell lymphoproliferative disorders, which in-
clude multiple myeloma, Hodgkin’s lymphoma, and
chronic lymphocytic leukemia (CLL), as well as pre-
cursor conditions such as monoclonal B-cell lympho-
cytosis, are pathologies characterized by uncontrolled
growth of B-lymphocytes [4]. Lymphoproliferative dis-
orders can occur either in the lymphatic tissues (as
in lymphoma) or in the bone marrow (as in CLL and
multiple myeloma). Course of the disease and treat-
ment vary widely depending on the type of neoplasia
and other individual factors; however, even extramed-
ullary tumors affect the bone marrow stromal micro-
environment [5]. In addition, the bone marrow stroma
can be strongly affected by chronic viral infections.
For example, the CXCL12-abundant reticular cells (CAR
cells) die in the mice with chronic lymphocytic chori-
omeningitis due to production of IFN-α and IFN-γ by
the virus-specific CD8
+
T cells [6]. Chronic viral infec-
tions are associated with hematopoiesis suppression,
bone marrow failure, and depletion of the HSC pool
[7,8]. Combination of functional analysis with 3D mi-
croscopy demonstrated that chronic infection with
lymphocytic choriomeningitis virus leads to the death
of most mesenchymal CAR cells and pro-inflammatory
transcriptional remodeling of the remaining ones. This
causes long-term functional defects and reduced com-
petitive repopulation ability of HSCs. Bone marrow
immunopathology is caused by the virus-specific acti-
vated CD8
+
T cells that accumulate in the bone mar-
row through the interferon-dependent mechanisms.
Combined inhibition of the IFN type I and type  II
pathways by antibodies completely prevents CAR cell
degeneration and protects HSCs from chronic dysfunc-
tion. Thus, viral infections and subsequent immune
response have a lasting effect on the bone marrow ho-
meostasis, permanently reducing repopulation ability
of HSCs and disrupting secretion of the key stromal cy-
tokines that support hematopoiesis [9].
Acute lymphoblastic leukemia (ALL) is a neopla-
sia arising from early progenitors of B-cells(B-ALL) or
T-cells (T-ALL). The disease is characterized by uncon-
trolled proliferation of lymphoid progenitors in the
bone marrow and consequent appearance of large
numbers of immature lymphocytes, disrupting normal
hematopoiesis. B-ALL is considered a genetic disease,
but increasing evidence points to the ability of the
bone marrow microenvironment to significantly con-
tribute to maintenance, progression, response to treat-
ment, and possibly development of the disease, regard-
less of the presence of specific genetic abnormalities
in hematopoietic cells [10]. There is a large body of
evidence suggesting that B-ALL cells can modify the
bone marrow microenvironment creating conditions
conducive to the survival of malignant cells during
chemotherapy, leading to the disease recurrence. Leu-
kemic cells interact with components of the bone mar-
row microenvironment, including multipotent mesen-
chymal stromal cells(MSCs) [11]. Studying interactions
between the bone marrow microenvironment and
ALL cells has led to the discovery of potential thera-
peutic targets that include cytokines/chemokines and
their receptors, adhesion molecules, signal transduc-
tion pathways, and hypoxia-associated proteins [12].
Complex interactions between the leukemic cells and
components of the bone marrow microenvironment
lead to the involvement of MSCs in the suppression of
antitumor response, since these cells secrete cytokines
such as transforming growth factor-β (TGF-β) and he-
patocyte growth factor (HGF), which mediate suppres-
sion of T-cells [13].
Diffuse large B-cell lymphoma (DLBCL) is a hetero-
geneous group of diseases that differ in histological, im-
munohistochemical, and molecular characteristics[14].
LYMPHOID NEOPLASIA 885
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
In DLBCL, histological or molecular methods reveal
damage to the bone marrow only in 10-25% of pa-
tients [15]. It is believed that in the remaining patients
bone marrow is not involved in the malignant process.
However, bone marrow stromal progenitor cells in the
DLBCL patients without bone marrow involvement
are altered [16]. These changes cannot be attributed to
the contact interaction with tumor cells, as occurs in
leukemia [17, 18]. Many tumors secrete cytokines and
chemokines [19, 20], moreover, presence of a tumor
can be considered an inflammatory process [21, 22].
Inflammation is associated with active release of mul-
tiple factors that can activate cells of the bone marrow
stromal microenvironment, in particular MSCs [23].
MSCs activated by IL-1β, TNF, and IFN-γ secrete inhib-
itors and activators of the inflammatory process [24].
The aim of the study was to analyze the effect of
lymphoid neoplasia from early progenitor cells in di-
rect contact with the bone marrow stroma (ALL) and
more mature cells located exclusively extramedullary
(DLBCL) on immunological function of MSCs.
MATERIALS AND METHODS
Patient and donor bone marrow samples. Pa-
tient and donor samples were obtained in accordance
with the Declaration of Helsinki after the written in-
formed consent. The study was approved by the ethics
committee of the Federal State Budgetary Institution
National Medical Research Center for Hematology of
the Ministry of Health of the Russian Federation, pro-
tocol No.171 dated April27, 2023.
The work was performed with MSCs isolated from
the bone marrow of patients with ALL and DLBCL;
MSCs from the bone marrow of healthy donors were
used as controls. To account for the age difference,
two different donor groups were age-matched with
the patients with ALL and DLBCL. As such, the studied
parameters were normalized to the value of the corre-
sponding donor group median. Data on the number of
samples, patients, and healthy donors are presented
inTable1.
MSCs cultivation. Bone marrow was obtained
from the patients during diagnostic punctures and
from the hematopoietic stem cells donors during ex-
fusions after informed consent. To prevent clotting,
2-7 ml of bone marrow were placed in sterile tubes
with 1 ml of heparin (50  units/ml). The bone marrow
samples were diluted 2-fold with an α-MEM (ICN, Cana-
da) containing 0.2% methylcellulose (1500 cP, Sigma-Al-
drich, USA) and left for 40 min at room temperature.
Supernatant was collected and precipitated by centrif-
ugation at 450g for 10 min. Number of nuclear cells
was determined by counting after staining with gen-
tian violet solution (1% solution in 3% acetic acid) in a
Goryaev chamber. Cells (3×10
6
) were placed in a flask
with a bottom area of 25 cm
2
(Corning-Costar, USA)
Table 1. Characteristics of patients and donors
Diagnosis Group
Total number
of patients
Sex
Number
of patients
Age, years
Median
age, years
ALL
onset 31
male 15 19-72 29
female 16 18-55 31
remission 14
male 5 19-55 24
female 9 18-55 30
DLBCL
onset 40
male 14 30-78 48
female 26 34-79 60
remission 40
male 14 30-78 48
female 26 34-79 60
Healthy
donors
ALL 56
male 30
18-48 27
female 26
DLBCL 30
male 10
30-78 54
female 20
PETINATI et al.886
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
in 5 ml of complete α-MEM nutrient medium (ICN,
Canada) supplemented with 10% fetal bovine serum
(FBS) (Hyclone, USA), 2 mM L-glutamine (ICN, Cana-
da), 100 U/ml penicillin (Sintez, Russia), and 5  µg/ml
streptomycin (BioPharmGarant, Russia). MSCs were
cultivated at 37°C and 5% CO
2
. Culture medium was
changed twice a week. After reaching confluency,
the cells were passaged. To do this, the cells were
washed twice with 5ml of Versen’s solution and once
with 0.25 ml of 0.25% trypsin solution (PanEco, Rus-
sia). 0.25 ml of trypsin solution was added, and flasks
were left at room temperature until the cells detached
from the surface. The cells were resuspended in 1 ml
of the medium with FBS, and counted in 0.2% trypan
blue solution (Sigma-Aldrich) to determine their num-
ber and viability (trypan blue only stains dead cells).
During passage, 10
5
cells were seeded in a flask with a
bottom area of 25 cm
2
in 5 ml of the medium. Cultures
were maintained for 4 passages.
The time to P0 was defined as the number of days
from seeding bone marrow to reaching confluence for
the first time.
Calculation of cumulative cell production. Cu-
mulative cell production over 3 passages was calculat-
ed using the formula (1):
N
sum
= N0 + N0 · 
N1
200000
 + N1 · 
N2
200000
 + N2 · 
N3
200000
 , (1)
where N0, N1, N2, and N3 are number of the cells re-
moved from 2 culture flasks at passages 0, 1, 2, and 3,
respectively.
Surface marker expression analysis by flow cy-
tometry. Surface phenotype of MSCs was studied at the
2nd passage by flow cytometry. After removing MSCs
from the flask, they were washed twice with CellWash
solution (BD Biosciences, USA) and then 2×10
4
cells
were incubated for 20 min in the dark with antibod-
ies. The antibody panels were as follows: 1) PE-labeled
anti-CD90 (5E10, BD Pharmingen, USA), FITC-labeled
anti-HLA-ABC (FN50, BioLegend, USA) and APC-labeled
anti-HLA-DR (L243, BioLegend); 2) anti-CD105, labeled
with FITC (43A3, BioLegend), anti-CD54, labeled with
APC (HA58, BioLegend), anti-CD146 PE-labeled (P1H12,
BD Pharmingen, USA); 3) PE-labeled anti-CD73 (AD2,
BD Pharmingen, USA). The analysis was performed
using a CytoFLEX flow cytometer (Beckman Coulter,
USA), data were analyzed with Kaluza Analysis 2.1
(Beckman Coulter). MSC population was determined
by forward and side light scattering. Mean fluores-
cence intensity (MFI) was assessed in APC, FITC, and
PE channels.
Relative level of gene expression analysis.
RNA isolation. To isolate RNA, the cells of the first
passage (10
5
-4.5×10
5
cells) were centrifuged at 300g.
The pellet was washed with 1 ml of phosphate buffer
and centrifuged at 300g. 400  µl of TriZol (Ambion by
Life Technologies, USA) was added to the pellet. Sam-
ples with TriZol were frozen at –70°C. After thawing,
120 µl of chloroform was added to the samples, after
which they were shaken, incubated for 2 min at room
temperature, and centrifuged for 15 min at 13,500g
and 4°C in a Centrifuge 5424 R (Eppendorf, Germany).
The resulting upper phase was transferred into new
tubes. 400 µl of isopropanol was added, the samples
were incubated for 10 min at room temperature and
centrifuged for 10 min at 13,500g and 4°C. The pellet
was washed with 1 ml of 75% ethanol, vortexed, and
centrifuged for 5 min at 13,500g at 4°C. The pellet
was left to dry for 5  min at room temperature. Next,
100 µl of DEPC-treated water was added to the pellet
and left for 30 min on ice for it to dissolve. After vor-
texing, 1 µl was taken to measure the amount of ex-
tracted RNA. The measurement was carried out with
a NanoDrop One spectrophotometer (Thermo Fisher
Scientific, USA) at a wavelength of 260 nm, RNA pu-
rity was determined by the ratio of 260/280 nm (it
should be in the range of 1.8-2.0). To the remaining
99 μl of the RNA solution, 10  μl of 3  M sodium acetate
and 250μl of 96% ethanol were added. Samples were
stored at –20°C.
cDNA synthesis. RNA in a mixture of ethanol and
sodium acetate was centrifuged for 10min at 13,500g
and 4°C. After that, the pellet was washed with 1 ml of
75% ethanol, mixed on a vortex, and centrifuged for
5 min at 13,500g and 4°C. The pellet was left to dry for
5 min at room temperature. 1  µl of DEPC-treated wa-
ter was added per 1 µg of RNA and the samples were
left on ice for 30 min for dissolution. Primers for re-
verse transcription (T13 primers and random hex-
amers) were annealed: 2 µl of RNA solution, 1.25  µl
of each primer (40 pmol/µl) and 5.5  µl of DEPC-treated
water were mixed, incubated in a Tertsik amplifier
(DNA-Technology) for 10  min at 70°C and 10 min at4°C.
After that, 15 μl of the reverse transcription mix
(5.5 µl milliQ water, 5 µl 5X M-MLV reversease buffer
(Promega, USA), 2.5 µl dNTPs mix, 1  µl each RNAsin
(Promega) and M-MLV reversease (Promega)) was add-
ed, and the samples were incubated in a Tertsik ampli-
fier at 42°C for 1 h. 75  μl of milliQ water were added.
The samples were stored at –20°C.
Real-time PCR. Real-time PCR in Taq-man modifi-
cation was performed with an AbiPrism Real Time PCR
System 7500 (Thermo Fisher Scientific) in a 96-well
plate; the reaction volume was 25µl. Each sample was
analyzed in triplicate; a positive control (a reference
mixture of cDNA from 117 donors) was used to assess
the quality of the reaction and correlate the results
of different PCRs, and a negative control was includ-
ed (water was added instead of cDNA). Sequences of
primers and probes are presented in Table  2. PCR re-
agents were mixed into a master mix (12.8 µl milliQ
water, 3.5 µl 25 mM  MgCl
2
(Thermo Fisher Scientific),
LYMPHOID NEOPLASIA 887
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Table 2. Primers and probes sequences
Gene Purpose Sequence
BACT forward primer CAACCGCGAGAAGATGACC
BACT reverse primer CAGAGGCGTACAGGGATAGC
BACT probe ROX-AGACCTTCAACACCCCAGCCATGTACG-BHQ2
GAPDH forward primer GGTGAAGGTCGGAGTCAACG
GAPDH reverse primer TGGGTGGAATCATATTGGAACA
GAPDH probe ROX-CTCTGGTAAAGTGGATATTGTTGCCATCA-BHQ2
VEGFA forward primer AGGCGAGGCAGCTTGAGTTA
VEGFA reverse primer ACCCTGAGGGAGGCTCCTT
VEGFA probe FAM-CCTCGGCTTGTCACATCTGCAAGTACGT-RTQ1
FGF2 forward primer GAAGAGCGACCCTCACATCAAG
FGF2 reverse primer TCCGTAACACATTTAGAAGCCAGTA
FGF2 probe FAM-TCATAGCCAGGTAACGGTTAGCACACACTCCT-RTQ1
IL6 forward primer ACCTGAACCTTCCAAAGATG
IL6 reverse primer CTCCAAAAGACCAGTGATGA
IL6 probe FAM-ATTCAATGAGGAGACTTGCCTGGTG-RTQ1
IL8 forward primer ACCATCTCACTGTGTGTAAAC
IL8 reverse primer GTTTGGAGTATGTCTTTATGC
IL8 probe FAM-CAGTTTTGCCAAGGAGTGCTAAAG-RTQ1
PDGFRB forward primer CTCCCTTATCATCCTCATCA
PDGFRB reverse primer TCCACGTAGATGTACTCATG
PDGFRB probe FAM-TCACAGACTCAATCACCTTCCATC-RTQ1
SPP1 forward primer ATAGTGTGGTTTATGGACTGAG
SPP1 reverse primer ATTCAACTCCTCGCTTTCC
SPP1 probe FAM-CCAGTACCCTGATGCTACAGACGAG-RTQ1
BGLAP forward primer GCAGCGAGGTAGTGAAGAG
BGLAP reverse primer GAAAGCCGATGTGGTCAG
BGLAP probe FAM-CTCCCAGCCATTGATACAGGTAGC-RTQ1
PPARG forward primer TACTGTCGGTTTCAGAAATGC
PPARG reverse primer CAACAGCTTCTCCTTCTCG
PPARG probe FAM-CCATCAGGTTTGGGCGGATGCC-RTQ1
FGFR1 forward primer CAGAATTGGAGGCTACAAGG
PETINATI et al.888
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Table 2 (cont.)
Gene Purpose Sequence
FGFR1 reverse primer TGATGCTGCCGTACTCATTC
FGFR1 probe FAM-CATCATAATGGACTCTGTGGTGC-RTQ1
FGFR2 forward primer CTCATTATGGAAAGTGTGGTC
FGFR2 reverse primer TGGGCCGGTGAGGCGATC
FGFR2 probe FAM-CAGGTGGTACGTGTGATTGATGGA-RTQ1
SOX9 forward primer AGCAAGACGCTGGGCAAG
SOX9 reverse primer GTTCTTCACCGACTTCCTC
SOX9 probe FAM-CTGGAGACTTCTGAACGAGAGC-RTQ1
SDF1 forward primer CTACAGATGCCCATGCCGAT
SDF1 reverse primer TAGCTTCGGGTCAATGCACA
SDF1 probe FAM-CAGTTTGGAGTGTTGAGAATTTTGAG-RTQ1
TGFB1 forward primer TGCGTCTGCTGAGGCTCAA
TGFB1 reverse primer CGGTGACATCAAAAGATAACC
TGFB1 probe FAM-AGGAATTGTTGCTGTATTTCTGGTAC-RTQ1
ICAM1 forward primer GCAATGTGCAAGAAGATAGC
ICAM1 reverse primer CTCCACCTGGCAGCGTAG
ICAM1 probe ROX-CACGGTGAGGAAGGTTTTAGCTGTT-RTQ2
2.5 µl 2.5  mM dNTPs mix, 2.5  µl 10X SmarTaq buffer
(Promega), 1 µl of forward and reverse primers each
(10 pmol/µl), 0.5  µl fluorescent probe (10 pmol/µl),
0.2  µl Taq polymerase (Promega) per reaction). 72 µl of
the master mix were placed into wells of a 96-well PCR
plate and 3 µl of the cDNA solution was added. The
samples were mixed and divided into 3 wells (25 µl
per well) to obtain triplicates. PCR started with 10-min
incubation at 95°C to activate the polymerase; 40 cy-
cles of PCR were performed for the BACT and GAPDH
genes, and 45 cycles for the remaining genes. Cycle pa-
rameters: 15 s at 95°C +  40 s at 60°C.
Calculation of relative gene expression level.
Relative expression level (REL) of genes was calculat-
ed using the modified ΔΔCt method [25]. The mean Ct
of three replicates was used for calculations. Ct is the
number of cycles required to reach the probe fluores-
cence threshold in PCR. For each gene, ΔCt was calcu-
lated using the formula(2):
ΔCt = Ct
sample
– Ct
control
. (2)
The RELs of the housekeeping genes (RELhk) –
BACT and GAPDH– were calculated using the formu-
la(3):
REL
hk
= 2
–ΔCt
. (3)
Next, the sample normalization factor (NF) was
calculated using the formula (4):
NF =
√
REL
BACT
*
REL
GAPDH
. (4)
RELs for the genes of interest were calculated us-
ing the formula (5):
REL = 
(2
−ΔCt
)
NF
 . (5)
Secretome analysis. Preparation of MSCs con-
ditioned medium. MSCs at the passages 2-3 were
seeded at 4×10
3
cells per cm
2
in T175 flasks (Costar,
USA). After the cells reached confluence (3-4 days),
the flasks were washed 5 times with phosphate buffer
LYMPHOID NEOPLASIA 889
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
without Ca
2+
/Mg
2+
(Invitrogen, USA). The cells were
then cultured for 24 h in RPMI1640 medium without
serum and phenol red (HyClone). The conditioned me-
dium was centrifuged at 400g and frozen at –70°C.
Sample preparation for analysis. A protease in-
hibitor cocktail (Halt Protease Inhibitor Cocktail, Ther-
mo Fisher Scientific) was added to each sample, which
were then centrifuged at 1500g for 10  min to remove
debris. Supernatants were immediately frozen and ly-
ophilized to reduce volume. The lyophilized samples
were resuspended for 30 min in a buffer containing
6 M Gd-HCl, 10  mM  Tris-HCl (pH 8) and 2  mM DTT.
Toprecipitate the insoluble fraction, the solutions were
centrifuged at 16,000g for 10min at 4°C. Samples were
concentrated using a centrifuge filter (Corning Spin-X
UF6, Sigma-Aldrich) to replace the buffer. Buffer (8 M
urea, 2 M thiourea, 10  mM Tris-HCl (pH  = 8)) was add-
ed to the concentrated samples at a ratio of 1: 3 and
incubated at room temperature for 30 min. Disulfide
bonds were reduced with 5 mM  DTT at room tempera-
ture for 40  min and next alkylated with 10 mM iodoac-
etamide in the dark at room temperature for 20 min.
Alkylated samples were diluted by adding 50 mM
NH
4
HCO
3
solution at a ratio of 1 :  4 followed by tryp-
sin addition (0.01 μg per 1 μg of protein) and incu-
bation at 37°C for 14 h. The reaction was stopped by
adding formic acid to a final concentration of 5%. The
peptides were desalted using Discovery DSC-18 tubes
(1 ml, 50  mg) (Sigma-Aldrich), dried under vacuum,
and stored at –80°C before analysis. Prior to LC-MS/MS,
samples were redissolved in 5% acetonitrile with 0.1%
trifluoroacetic acid and sonicated.
LC-MS/MS analysis. Analysis was performed us-
ing an Orbitrap Q Exactive HF-X mass spectrometer
equipped with a nano-ESI source and a high pressure
nanoflow chromatograph (UPLC Ultimate 3000) with a
C-18 (100µm) reverse phase column. ×300mm).
Bioinformatic processing of mass spectrome-
try data. Raw data from the mass spectrometer were
converted into .mgf files using MSConvert (ProteoWiz-
ard Software Foundation, USA) with the parameters
“--mgf --filter pickPicking true [1,2]”. To identify pro-
teins, a search was carried out using MASCOT (ver-
sion 2.5.1, Matrix Science Ltd., UK) and X!Tandem
(ALANINE, 2017.02.01, 2017.02.01, The Global Proteome
Machine Organization) in the UniProt human protein
database with concatenated backtrap dataset. Permis-
sible masses of the precursor and fragment were set to
20 ppm and 0.04  Da, respectively. Database search pa-
rameters included the following: tryptic digestion with
one possible gap [26], static modification for urea meth-
yl (C), and dynamic modifications for oxidation (M).
For X!Tandem, parameters were chosen that allowed
to quickly check for the acetylation of the N-terminal
residue of the protein, the loss of ammonia from the
N-terminal glutamine and water from the N-terminal
glutamic acid. The resulting files were processed in
Scaffold 5 (version 5.1.0). An algorithm for estimating
the local false discovery rate (FDR) with standard
grouping of proteins was used. To assess the hits of
peptides and proteins, FDR =  0.05 was chosen for both.
The samples annotated in the Swiss-Prot database were
marked as preferred.
Statistical analysis. Data sets are presented as in-
dividual values with indicated median. For each data
set, a normality test was performed using the Shapiro–
Wilk test (at p  < 0.05, the distribution was taken to be
different from normal). Significance of differences was
analyzed using Mann–Whitney test for non-normal
distributions. Differences were considered statistical-
ly significant at p  < 0.05. Statistical analysis was per-
formed using GraphPad Prism8.03.
RESULTS
Under the influence of lymphoid neoplasia, the
characteristics of MSCs change. Hematopoietic pro-
genitors that initiate tumor development in ALL and
DLBCL differ in the stage of differentiation: in ALL,
early bone marrow progenitors undergo tumor trans-
formation, while in DLBCL, it happens to more differ-
entiated B cells outside the bone marrow. MSCs only
from DLBCL patients without bone marrow involve-
ment were included in this study.
MSCs growth characteristics. Time required for
the MSCs of the patients at the onset of ALL to reach
P0 increased in comparison to the time required for
donor MSCs (p  < 0.0001), which may indirectly reflect
decrease in the number of stromal progenitor cells in
the bone marrow. Upon reaching remission, this pa-
rameter returned to normal. MSCs of the patients with
DLBCL did not differ from those of the healthy do-
nors at the onset of the disease, and in remission they
reached P0 faster than those of the donors (p  = 0.0107).
As a result, the time to P0 was longer in the cells from
the patients with ALL than in the MSCs from the pa-
tients with DLBCL at the onset of the disease (Fig.1a).
In remission, the time to P0 did not differ significantly.
Cumulative cell production of ALL patients’ MSCs
in 3 passages did not differ from that of the healthy
donors. When remission was achieved, total cell pro-
duction of patients with ALL increased significantly
compared to the donors (p  = 0.0419). Cumulative cell
production of the MSCs from the patients with DLBCL
increased in comparison to the donors’ MSCs both at
the onset (p  = 0.0119) and in remission of the disease
(p =  0.0011), and at the onset it was also significantly
higher than at the onset of ALL (Fig.1b).
Thus, we have shown that in ALL, the MSC growth
is suppressed before treatment and returns to nor-
mal in remission, while in DLBCL, on the contrary,
PETINATI et al.890
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 1. Time to passage 0 (P0)(a) and cumulative cell production in 3 passages(b) of MSCs from patients with ALL and DLBCL
before treatment and in remission normalized to age-matched donor MSCs’ median value. Data are presented as scatterplots
with indicated median. Horizontal red line indicates the median values of healthy donors’ cells.
the MSCs grow more actively than the cells from the
healthy donors. Other studied characteristics of the
MSCs from the patients differed from the donors’ cells
as well.
Membrane surface marker analysis. MSCs from
the bone marrow of the patients with hematological
diseases and the healthy donors differ in the expres-
sion of surface markers.
Mean fluorescence intensity (MFI) of the surface
markers was studied on the cells of 6 patients before
treatment of ALL and 3 in remission of ALL, 9 patients
before treatment and in remission of DLBCL, and 10
donors for each of the patient groups. According to the
International Society for Cellular Therapy (ISCT) crite-
ria, MSCs express CD90, CD105, and CD73 [27]. These
markers were present on all the studied cells, but their
MFIs differed between the groups (Fig. 2, a-c). CD73
MFI was significantly increased on the MSCs from the
patients with ALL before treatment compared to do-
nors’ (Fig. 2c). This parameter did not differ from the
donors neither at the onset nor in the remission of
DLBCL. However, in the remission of DLBCL MFI of
CD73 on the MSCs became significantly higher than it
was before treatment. The MSCs of patients with DLBCL
in remission had increased MFI of CD105 (Fig. 2b). Be-
fore the treatment of ALL, the observed expression
of HLA-ABC on the cells was significantly increased
compared to donors; in remission its MFI decreased
(Fig. 2d). Before the treatment of DLBCL, HLA-ABC
MFI on the cells did not differ from donors’, but in
the remission it significantly increased. The same ef-
fect was observed for the class II histocompatibility
molecules, HLA-DR, in DLBCL (Fig. 2e). Expression of
CD146 on the surface of the MSCs in the patients with
ALL demonstrated an upward trend compared to the
donors (Fig. 2f). In the patients with DLBCL, it did not
differ from the donors before treatment, but signifi-
cantly increased when remission was achieved. There
were no significant differences in the CD54 expression
between the studied groups except for a significant
increase in the patients in remission of DLBCL com-
pared to the donors (Fig. 2g).
Significant changes in the expression of MSC sur-
face markers were detected.
Changes in gene expression of factors import-
ant for immunoregulatory function of MSCs. Pat-
terns of the MSCs gene expression were studied. The
genes selected for analysis encode factors directly in-
volved in the regulation of immune response –  IL6,
IL8, TGFB1; homing and adhesion factors –  SDF1,
ICAM1; growth factors and their receptors –  FGF2,
FGFR1, FGFR2, PDGFRB, VEGFA. Expression pattern
of the MSC differentiation marker genes BGLAP, SPP1,
SOX9, and PPARG was studied as well, since the differ-
entiated descendants of MSCs– osteoblasts, adipocytes,
etc.– participate in immune regulation.
In the patients with ALL, expression of the IL6
gene in MSCs was significantly increased in compari-
son to the donors at the onset of the disease (p  < 0.0001)
and did not normalize after achieving remission
LYMPHOID NEOPLASIA 891
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 2. Mean fluorescence intensity (MFI) of the surface markers CD 90(a), CD 105 (b), CD 73 (c), HLA-ABC(d), HLA-DR (e),
CD146(f), and CD54(g) on the MSCs of patients with ALL and DLBCL, and healthy donors of corresponding ages. Yaxis shows
MFI fold change relative to the respective median value for the donor cells. Data are normalized to the median values for the
donor groups and presented as scatterplots with marked median.
(p <  0.0001), and in DLBCL it increased after chemo-
therapy compared with the onset of disease (Fig.  3a)
and the healthy donors (p =  0.0018). At the same time,
at the disease onset, IL6 gene expression was higher in
ALL than in DLBCL.
Additionally, at the onset of DLBCL increase in
the IL8 expression level relative to the healthy donors
(p  =  0.0220) was observed, and after treatment REL of
this gene increased even more (Fig. 3b). TGFB1 REL
was lowered in the MSCs of patients at the onset of
ALL compared to donor cells (p  = 0.004) and decreased
even more in remission (p  = 0.0002). In patients with
DLBCL there was also decrease in the REL of this gene
after treatment compared with the onset of the dis-
ease (Fig.3c). In the MSCs of the patients with DLBCL
at the onset and in the remission, the FGF2 REL was
increased compared to donors’ (p  = 0.0121, p =  0.0206,
respectively), at the onset of the disease it was sig-
nificantly higher than in the MSCs of ALL patients
(Fig. 3d). FGF2 receptors differed in their expres-
sion in the patients with ALL and DLBCL (Fig. 3,  e, f).
At the onset of DLBCL, the MSCs had reduced FGFR1
REL (p=0.0166) and increased FGFR2 REL (p  = 0.0017).
In the MSCs of the patients with ALL and DLBCL,
FGFR1 REL was insignificantly reduced at the onset
and remission of the disease, and FGFR2 expression
PETINATI et al.892
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 3. Relative expression levels of genes IL6(a), IL8(b), TGFB1(c), FGF2(d), FGFR1(e), FGFR2(f), PPARG(g), SOX9(h), SPP1(i),
BGLAP(j), VEGFA(k), SDF1(l), PDGFRB(m), ICAM1(n) in the MSCs of the patients with ALL and DLBCL before treatment and
in remission of the disease, normalized to the median REL of the group of corresponding healthy donor. Yaxis shows mRNA
expression level relative to respective median value for the donor groups. The data are presented as scatterplots with indicated
median. Horizontal red line indicates the median REL of the donor MSCs.
LYMPHOID NEOPLASIA 893
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 4. Diagram of distribution of the studied proteins secreted by MSCs in ALL and DLBCL at the onset and in remission of the
disease. Number of proteins not secreted by the given group of MSCs but secreted by other groups is indicated.
was significantly elevated in the MSCs of the patients
with DLBCL compared with the donors and signifi-
cantly decreased when remission was achieved; such
changes were not observed in the patients with ALL.
RELs of the MSC differentiation markers differed
between the studied nosologies. REL of the adipose dif-
ferentiation marker PPARG was increased in the MSCs
of the patients with ALL at the onset of the disease
compared to the donors (p  < 0.0001) and remained
elevated in the remission (p  < 0.0001). At both points,
PPARG gene expression in the MSCs was higher in ALL
than in DLBCL (Fig. 3g). The REL of SOX9, a marker
of chondrogenic differentiation, was lower in patients
with ALL at the onset of the disease than in donors
(p  =  0.0049) and lower than in patients with DLBCL at
the onset and remission (Fig.3h).
In DLBCL, expression of some growth factors and
receptors was also altered. In DBBCL remission, the
expression of PDGFRB in MSCs was reduced in com-
parison with the donor MSCs (p  = 0.0006) and with the
onset of the disease (Fig. 3m). SDF1 REL was increased
in DLBCL at the onset and remission of the disease
compared with donors (p  < 0.0001 and p  =  0.0028, re-
spectively, Fig.  3i). In ALL, VEGFA expression was re-
duced at the onset of the disease compared to donors
(p=0.0036), but was restored upon reaching remission
(Fig. 3k). ICAM1 expression increased in ALL remis-
sion compared to the onset of the disease (Fig. 3n).
Thus, the RELs of growth factors, adhesion fac-
tors, and interleukins in the MSCs are altered in ALL
and DLBCL. Changes in the MSC differentiation mark-
er genes demonstrate propensity toward adipogenic
differentiation in ALL.
Secretome. Secretomes of the MSCs of 2 patients
with ALL, 6 patients with DLBCL, and 21 donors were
studied. No significant changes corresponding to the
changes in the gene expression were observed, which
may be due to the small sample number or post-tran-
scriptional modifications. However, there were chang-
es in the secretion levels of the proteins for which
gene expression was not studied in this work.
The patients with ALL are typically much young-
er than the patients with DLBCL, so two groups of do-
nors were used as controls in the secretome analysis.
The number of secretome proteins analyzed is shown
inFig.4.
938 proteins were commonly secreted by the
MSCs of all studied groups. The MSCs from the ALL
patients did not secrete 1444 proteins, while donors’
MSCs did not secrete 1140. DLBCL patients’ MSCs did
not secrete 433 proteins, of which 31 were found in
the secretomes of the MSCs from ALL patients. These
include proteins important for regulation of immune
response– PDGFA, POSTN, LGALS1, and KIT. The MSCs
from both donors and DLBCL patients secreted 800
proteins, while the donor MSCs did not secrete 793 of
the studied proteins.
In ALL, secretion of 70 proteins was increased
before the treatment compared with donors, the most
interesting of which are CXCL12, POSTIN, HLA-DRB,
LGALS1. Additionally, secretion of the proteins regulat-
ing cell migration and related to cytoskeletal organiza-
tion was increased (Fig.5a). Secretion of 15 proteins,
including VCAM1, CSF1, CTGF, ADAMTS1, was reduced.
Those proteins are involved in vesicular transport and
extracellular matrix organization (Fig. 5b).
After achieving remission of ALL, secretion of the
proteins associated with the immune response by the
MSCs changes (Fig. 5,  c, d). Compared to the onset of
the disease, secretion of the proteins involved in the
functioning of chemokines and cytokines, vesicular
transport, MSC differentiation, etc. increased. At the
same time, other proteins involved in the same sig-
naling pathways could decrease. Secretion of 62 pro-
teins was increased relative to the donors, including
PTMA, DCD, LIMCH1, and POSTIN, and secretion of 80
proteins was decreased, including VCAM1, LTBP1, C3,
ANXA1, IGFBP-1, -3, and -6; LGALS1, ENO1.
PETINATI et al.894
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 5. Enrichment analysis of the signaling pathways with GO database. The most important signaling pathways, components
of which were differentially found in the secretomes of MSCs from the patients with ALL and donors, are presented. Only sig-
nificant changes (p<0.05) were taken into account. Histograms represent -log10 FDR (false discovery rate) values. a)Signaling
pathways components of which were upregulated in the secretomes of MSCs from the ALL patients before treatment compared
to donors’ MSCs. b)Signaling pathways components of which were downregulated in the secretomes of MSCs from the ALL pa-
tients before treatment compared to donors’ MSCs. c)Signaling pathways components of which were upregulated in the secre-
tomes of MSCs from the ALL patients before the treatment compared to remission. d)Signaling pathways components of which
were downregulated in the secretomes of MSCs from the ALL patients before the treatment compared to remission.
LYMPHOID NEOPLASIA 895
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Fig. 6. Enrichment analysis of the signaling pathways with GO database. The most important signaling pathways components
of which were differentially found in the secretomes of MSCs from the patients with DLBCL and donors are presented. Only sig-
nificant changes (p<0.05) were taken into account. Histograms represent -log10 FDR (false discovery rate) values. a)Signaling
pathways components of which were upregulated in the secretomes of MSCs from the DLBCL patients before treatment com-
pared to donors’ MSCs. b)Signaling pathways components of which were downregulated in the secretomes of MSCs from the
DLBCL patients before treatment compared to donors’ MSCs. c)Signaling pathways components of which were upregulated in
the secretomes of MSCs from the DLBCL patients before treatment compared to remission. d)Signaling pathways components
of which were downregulated in the secretomes of MSCs from the DLBCL patients before treatment compared to remission.
PETINATI et al.896
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
The obtained data indicate significant impairment
of the MSCs’ functional properties in ALL, both before
treatment and in remission.
At the onset of DLBCL, secretion of 77 proteins
was increased compared to the donors, including B2M,
CD59, HLA-C, PDGFRA, CSF1, SOD1, CAPG, and levels
of 44 proteins were reduced, including APOs, ACAN,
S100A9, LTBP4. Proteins with the increased secretion
are involved in cytokine signaling pathways, including
TNF, interferons, and interleukins, and are involved in
innate and adaptive immunity (Fig. 6a). Downregulat-
ed proteins are also involved in some of these path-
ways (Fig. 6b). Secretion of the proteins related to the
MSC differentiation and complement system was re-
duced.
Upon achieving remission, secretion of 15 pro-
teins by the patients’ MSCs increased compared to do-
nors’ MSCs. With the exception of B2M, these proteins
differ from those upregulated at the onset of DLBCL.
Important signaling pathways altered upon achieve-
ment of remission include vesicular transport, im-
mune response, and differentiation (Fig. 6c). Notewor-
thy is secretion of the proteins associated with antigen
presentation by the major histocompatibility complex
(MHC) classII. Under the standard cultural conditions,
non-activated MSCs express extremely low levels of
MHC class II, whereas the MSCs from the DLBCL pa-
tients express it much more actively.
At the same time, secretion of 73 proteins de-
creased, including APOs, ACAN, S100A9, LTBP4, PDGFA,
CFHR1, C4BPA, and CRP. Secretion of APOs, ACAN,
S100A9, LTBP4 remains reduced in the remission. Se-
cretion of the proteins that are important for immune
response, such as PDGFA and various complement
components(CFHR1, C4BPA, and CRP) was decreased.
Many of the downregulated proteins are involved in
the immune system – complement system, activation
of platelets and neutrophils (Fig.6d).
The changes observed in the secretomes of the
MSCs from the patients with ALL and DLBCL indicate
systemic inflammation affecting bone marrow in both
nosologies. In remission, secretion of the inflamma-
tion-related proteins decreases, but the secretome
does not normalize.
None of the proteins with the altered secretion
compared to the donors at the onset and remission
of the disease matched between ALL and DLBCL. The
same is true for the proteins that differ between the
onset and the remission in ALL and DLBCL.
DISCUSSION
Inflammation involves not only the cells directly
related to the immune system, but also many others,
including MSCs. It has been shown invitro that MSCs
are able to modulate immune response both through
direct intercellular interaction and through secretion
of various factors. In addition, MSCs, being precursors
of the bone marrow stromal microenvironment, reg-
ulate hematopoiesis and, as a result, formation of all
cells of the immune system. Lymphoid tumors upset
the balance of the immune system, not only by impair-
ing lymphopoiesis, but also by altering other cells as-
sociated with the immune system.
Lymphoproliferative diseases considered in this
work– DLBCL and ALL– differ in cell differentiation
stage and localization. In ALL, early lymphoid progen-
itors are located in the bone marrow, while in DLBCL,
a tumor of more mature B cells may not affect the
bone marrow, as happened in patients whose MSCs
were studied in this work. However, it is known that
the properties of MSCs change significantly not only in
ALL [28], when they are in close proximity to malig-
nant cells and interact with them, but also in DLBCL,
in the absence of direct contact [5].
In the case when the same number of bone mar-
row mononuclear cells is seeded, the time it takes to
achieve confluency depends on the number of plas-
tic-attaching cells capable of proliferating, and thus
may indirectly reflect the number of mesenchymal
precursors in the bone marrow. The increase in time
to P0 only in the MSCs of the patients at the onset of
ALL is most likely due to the fact that only in this case
the MSCs are in direct contact with tumor cells and are
damaged by them. This assumption correlates with
the results of other studies indicating damage to the
stromal microenvironment in acute leukemia [29-31].
In DLBCL, on the contrary, activation of the stromal
microenvironment can be assumed, since increase in
the cell production of these patients’ MSCs was ob-
served both at the onset of the disease and in the re-
mission. Moreover, in remission, the time to P0 was
also reduced, i.e., concentration of the stromal precur-
sors in the bone marrow increased.
It is believed that leukemia is associated with
chronic inflammation [32, 33]. The study of surface
phenotype of the MSCs in ALL patients showed in-
creased MFI of the class I major histocompatibility
complex (HLA-ABC) and ecto-5′-nucleotidase (CD73)
proteins prior to the treatment. In addition, the MSCs
of ALL patients before treatment secreted more HLA-
DRB than the donor cells. The MSCs of patients at the
onset of DLBCL did not differ from the cells of healthy
donors in these parameters. However, upon reaching
remission, surface expression of HLA of both classes
(HLA-ABC and HLA-DR), CD73, CD54, and CD146 sig-
nificantly increased. In the secretomes of DLBCL pa-
tients’ MSCs, content of HLA-C and B2M proteins was
increased at the onset of the disease. In remission,
B2M remained upregulated. These changes suggest
that the MSCs, on which HLAs are typically weakly
LYMPHOID NEOPLASIA 897
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
expressed, are in a pro-inflammatory environment in
the bone marrow and remain activated upon trans-
fer to culture. CD73 has an immunosuppressive effect
through generation of adenosine. Increase in the sur-
face expression of this marker indicates that the MSCs
execute an anti-inflammatory effect. It is known that
increased expression of CD73 frequently occurs in the
tumor cells and cells of the tumor microenvironment
[34-36]. It seems this immune escape mechanism is
implemented by MSCs in ALL and DLBCL. CD54, or
ICAM-1, is an adhesion molecule that is upregulat-
ed when the cells are activated [37, 38]. CD146 is an
adhesion molecule considered to be a marker of the
MSCs with high proliferative potential and ability to
differentiate [39]. Based on this, one could expect fast-
er growth or greater cell production by the MSCs with
increased CD146 expression, which was observed in
the cells of DLBCL patients after treatment. We studied
the MSCs in the DLBCL patients without bone marrow
involvement. In the MSCs of DLBCL patients, prolifera-
tive activation was not observed before treatment, but
occurred in remission, which implies that activation
might be associated with the treatment. Chemotherapy
activates and severely damages immune system of the
patients [40].
In remission of DLBCL, an increased content of
CD105, or endoglin, was also found on the MSCs. En-
doglin is involved in keeping hematopoietic stem cells
in a dormant state along with TGFβ1 [41]. Expression
level of the TGFB1 gene in the MSCs was reduced at
the onset of ALL, which could contribute to tumor
proliferation. After chemotherapy, TGFB1 REL was re-
duced in both ALL and DLBCL. Perhaps this is neces-
sary to restore hematopoiesis and immunity, which are
inevitably damaged during treatment.
Among the factors influencing the immune re-
sponse, an increase in the REL of the pro-inflammato-
ry cytokine IL6 was observed at the onset of ALL. It did
not normalize upon reaching remission. MSCs could
contribute to the increase in the IL6 level observed in
the blood of the patients [42]. We did not find a sig-
nificant increase in the IL6 level in the secretome of
the MSCs, which could be due to insufficient number
of samples and limitations of the method, since oth-
er groups observed increased secretion of IL6 by the
MSCs from ALL patients using the ELISA method [43].
In the patients with DLBCL, increased IL8 expression
was noted before the treatment and increased expres-
sion of IL6 and IL8 after the treatment. Upregulated
expression of the pro-inflammatory interleukin genes
in remission may reflect massive changes in immune
processes associated with both chemotherapy and con-
sequent infectious complications, which is consistent
with the observations of other authors [9].
SDF-1 (CXCL-12) is important for interaction with
HSC. Its expression in the MSCs of the patients did not
differ from the healthy donors in either ALL or DLBCL.
Previous studies have noted that SDF1 expression does
not change in acute myeloid leukemia (AML) [44,  45],
but the level of protein on the surface of the MSCs in
patients is increased [46]. It has been shown that in
ALL, on the contrary, concentration of SDF-1 in the
bone marrow decreases [43,  47]. In the patients’ MSCs
studied in this work, there was a trend towards in-
creased expression of this factor. In the secretomes of
those cells, SDF-1 was significantly upregulated. It can
be assumed that regulation of SDF-1 in acute leukemia
does not occur at the transcription level.
In both ALL and DLBCL, expression of cytokines
involved in formation and regeneration of the stroma
was altered. At the onset of ALL expression of VEGFA
in the MSCs was downregulated despite the fact that
VEGF-A concentration in the blood of the patients is
increased [48,49]. It is possible that the MSCs reduce
expression of this growth factor due to a feedback
loop, and malignant cells are responsible for its secre-
tion [48]. In DLBCL patients’ MSCs, expression of many
growth factors and their receptors was impaired. It is
possible that these changes would have contributed to
the spread of the tumor to bone marrow if the patients
had remained without treatment.
In ALL, change in the relative levels of expression
of the gene markers of MSC predisposition to differen-
tiation lineages was observed. Increased expression
of PPARG suggests that the MSCs of ALL patients are
more prone to adipogenic differentiation than the
MSCs of the healthy donors. This is also confirmed by
a decrease in expression of SOX9, a chondrogenic dif-
ferentiation marker, which, according to some studies,
is able to inhibit differentiation of MSCs into adipo-
cytes [50]. According to the literature data, the MSCs
from ALL patients show an increased tendency to adi-
pose differentiation [28,  43]. Decrease in SOX9 expres-
sion has also been noted [43]. It is worth emphasizing
that the changes in expression of these genes persisted
even after the patients achieved remission. Perhaps
more serious changes occurring in ALL are caused by
the contact with malignant cells.
In DLBCL, no changes in the RELs of the differen-
tiation markers were noted in the MSCs.
The signaling pathways enrichment analysis
showed an indirect relationship between the changes
in the expression of IL8, IL6, TGFB1, VEGFA, PDGFRB,
PPARG and the secretome.
The secretome analysis revealed decrease in the
secretion of proteins involved in regulation of the
immune response and vesicular transport both be-
fore and after the ALL treatment compared to the
donors. Secretion of the vesicles is important for the
regulatory and trophic functions of MSCs [51]. Dys-
regulation of the vesicular transport indicates the
MSCs damage. The MSCs also interact differently
PETINATI et al.898
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
with the extracellular matrix, which is involved in
the regulation of hematopoietic stem cells and B-lym-
phopoiesis [52].
The proteins downregulated in ALL before treat-
ment include: ADAMTS1 – an angiogenesis-inhibiting
metalloprotease associated with VCAM1 (whose se-
cretion is also reduced) [53]; CTGF, connective tissue
growth factor, that plays an important role in some
forms of cancer, fibrotic diseases, and in many biolog-
ical processes, including cell adhesion, migration, pro-
liferation, and angiogenesis [54]; CSF1, a macrophage
growth factor, stimulates increase in phagocytic and
chemotactic activity of macrophages and monocytes,
as well as cytotoxicity against tumor cells [55].
Factors with increased secretion in the MSCs of
ALL patients before treatment compared to the donors
regulate cell migration and are associated with actin
cytoskeleton rearrangement. Those can attract both
immune cells and circulating tumor cells to the bone
marrow.
Presence of a tumor in the body is usually associ-
ated with chronic inflammation [21,  22]. Our observa-
tions are consistent with this hypothesis. Upon achiev-
ing remission of ALL, the MSCs reduced secretion of
the factors involved in the response to proinflamma-
tory cytokines, such as IL-1, TNF, and others (Fig. 5b).
Secretion of some of these factors was decreased be-
fore the treatment and increased when remission was
achieved (Fig. 5d). Several signaling pathways have
components that were differentially secreted: a part of
them was upregulated and a part was downregulated
in the same groups, suggesting that some of the chang-
es may be compensatory.
The list of proteins with secretion reduced in
ALL remission includes C3 complement component;
insulin-like growth factor binding proteins –  IGFBP1,
IGFBP3, which regulate cell growth, and IGFBP6, which
regulates growth and immune response of dendritic
cells [56]; LGALS1 or galectin-1, a protein that inhibits
cell proliferation and is involved in immunosuppres-
sion of CD8
+
T cells [57]; ENO1, a glycolytic enzyme that
functions as a tumor suppressor and is important for
chemoresistance in lymphomas [58]; ANXA1, annex-
inA1, that inhibits innate immune cells and promotes
T cell activation. Activation of T  cells results in the
release of annexin A1 and expression of its receptor.
This pathway appears to finely regulate the strength
of T cell receptor (TCR) signaling. Increased expression
of annexin A1 under pathological conditions could
enhance TCR signaling through the mitogen-activat-
ed protein kinase (MAPK) signaling pathway, thereby
causing T  cell hyperactivation [59]. With the decrease
in secretion of these proteins, the tumor more easily
escapes immune surveillance, partially provided by
the MSCs. It can be concluded that the MSCs of ALL pa-
tients undergo a complex of changes that contribute to
imbalance of immune system and escape of the tumor
cells from immune surveillance.
The MSCs of the DLBCL patients included in the
study were immunologically activated, despite the fact
that the bone marrow was not directly involved in the
tumor process. This is indicated by the increased se-
cretion of the proteins from the signaling pathways
that mediate the immune response, including the pre-
sentation of antigens by the MHCs and the response to
proinflammatory cytokines. After treatment, secretion
of the proteins related to inflammatory processes de-
creased.
In the secretome of MSCs of the patients both be-
fore and after DLBCL treatment, secretion of ACAN,
S100A9, LTBP4, and a number of APOs (apolipopro-
teins) was downregulated compared to donors. When
remission was achieved, secretion of PDGFA, CFHR1,
C4BPA, and CRP decreased as well.
ACAN, or aggrecan, is critical for cartilage skeletal
morphogenesis during development and is expressed
by chondrocytes [60]. Lack of expression of this pro-
tein could be associated with impaired cartilage and
bone differentiation in the patients with DLBCL. In
addition, aggrecan could be involved in the antigen
presentation, as shown for the chondrocytes during in-
flammation [61].
The S100A9 protein is calcium-binding protein A9,
also known as migration inhibitory factor-related pro-
tein14 (MRP14). Intracellular S100A9 is known to re-
duce the ability of neutrophils to respond to bacterial
pathogens [62].
Decrease in the LTBP4 protein, a key regulator of
transforming growth factor beta (TGFB1, TGFB2, and
TGFB3), which controls activation of TGF-β maintain-
ing it in a latent state during storage in the extracel-
lular space, is associated with the functions of TGF-β.
TGF-β is biologically latent after secretion. Thus, LTBP4
is an important regulator of TGF-β signaling and is in-
directly associated with the development, immunity,
injury recovery, and disease, playing a central role in
regulation of inflammation, fibrosis, and cancer pro-
gression [63]. CFHR1, C4BPA, CRP are elements of the
complement system that are normally secreted by the
cells, including MSCs and pericytes, to protect the body
from infections [64].
Decrease in all these proteins in the secretome
of MSCs confirms deterioration of their physiological
functions associated with hematopoiesis and immuni-
ty in the DLBCL patients.
Increased secretion of B2M, CD59, HLA-C, PDGFRA,
CSF1, SOD1, CAPG at the onset of DLBCL in the MSC se-
cretome indicates MSC activation in the bone marrow
of the DLBCL patients without tumor involvement.
Inthe remission, the level of these proteins, with the
exception of B2M, normalized, which implies that
these changes are partially reversible.
LYMPHOID NEOPLASIA 899
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
Comparison of MSC secretomes of patients with
ALL and DLBCL confirmed the presence of significant
functional changes in comparison with the donors and
the difference of the nosologies from each other. The
MSCs from the DLBCL patients did not secrete many
proteins secreted by the MSCs from the donors and
the patients with ALL; proteins involved in regulation
of the immune response, PDGFA, POSTN, and LGALS1
(reduced in the secretomes of MSCs in ALL) and KIT
were not found in their secretomes. POSTN is a secret-
ed extracellular matrix protein that is involved in tis-
sue development and regeneration, binds to integrins
to support adhesion and migration, and plays a role
in cancer stem cell maintenance and metastasis [65].
Growth factors that support stromal cells and hema-
topoietic stem cells are also absent in the secretomes
of MSCs from the DLBCL patients, which confirms ab-
normalities in the bone marrow MSCs without direct
contact with the tumor B cells.
Thus, regardless of the tumor location, there are
significant changes in the functional status of bone
marrow MSCs, which contribute to the decrease in
antitumor immunity in the lymphoid neoplasia. In ad-
dition, in both pathologies, the MSCs acquire features
of the senescent cells associated with chronic inflam-
mation. The MSC senescence may be the reason for in-
complete restoration of hematopoiesis for a long peri-
od after achieving remission.
Analysis of the functional status of MSCs revealed
both differences and similarities between the impair-
ments occurring in the MSCs during the transforma-
tion of early hematopoietic precursors in the bone
marrow (ALL) and more mature ones outside the bone
marrow (DLBCL). Some of the differences may be re-
lated to the participation of the bone marrow lym-
phocytes in the MSC differentiation  [66]. In ALL, pre-
disposition of the MSCs to bone and fat differentiation
changes as evidenced by the gene expression and pro-
tein secretion. Some of the differences between the
DLBCL and ALL are age related. In DLBCL, signaling
pathways of the growth factors IGF and PDGF in the
MSCs are altered.
Identification of the specific signs in the bone mar-
row stroma indicates the possibility of the relapse risk
assessment [46]. A more detailed study of the metabo-
lism of MSCs from the patients will allow for identifica-
tion of the drugs that could modulate reactive oxygen
species associated with inflammation and cell aging.
CONCLUSION
Lymphoid neoplasias have a pathological effect on
the function of bone marrow MSCs. Concentration of
these cells in the bone marrow, their ability to prolif-
erate, immunophenotype, and expression pattern of
the genes important for differentiation, maintenance
of immunological status, and expression of cytokines
change. The functions of MSCs are diverse and form a
complex of reactions to the state and demands of the
body. Changes in the immunological status of MSCs de-
pend on the nosology and, despite the fundamental dif-
ferences, generally contribute to optimizing the niche
for the needs of the tumor and tumor escape from im-
munological surveillance. The obtained data demon-
strate the importance of MSCs for immunity and imply
the possibility to target not only the malignant cells,
but their microenvironment as well. Lymphoid tumors
are not only the transformation of hematopoietic cells
of varying degrees of maturity, but also concomitant
changes in the stromal microenvironment.
Acknowledgments. The equipment (tablet reader
Infinite 200 (Tecan, Austria)) from the collective use
center of the Pushchino Scientific Center was used in
the work. The authors also express their gratitude to
the Center for High-Precision Editing and Genetic Tech-
nologies for Biomedicine of the Lopukhin Center for
Physical-Chemical Medicine for LC-MS/MS analysis.
Contributions. E.N.P. supervised and managed
the work with the patients; N.A.P. and N.I.D. concep-
tualized and managed the study; E.A.F., A.U.M., A.N.V.,
and O.A.A. worked with the donors and patients;
N.A.P., A.V.S., N.V.S., N.M.K., and Yu.O.D. conducted the
experiments with MSCs; M.A.L. supervised the secre-
tome analysis and edited the text of the article; G.P.A.,
V.O.Sh., I.P.S., and O.V.P. performed the secretome study
and bioinformatic analysis; N.A.P., A.V.S., and N.I.D. an-
alyzed the study results; N.A.P., A.V.S. and N.I.D. wrote
and edited the text of the article.
Funding. This work was supported by the Rus-
sian Foundation for Basic Research (grant no.17-001-
00170) (DLBCL patients and donors’ samples) and by
the Russian Science Foundation (grant no.22-15-00018,
https://rscf.ru/project/22-15-00018/ [in Russian]) (all pa-
tients and donors’ samples).
Ethics declarations. All procedures performed
in the course of research comply with the ethical
standards of the national committee (permission to
conduct the study was obtained from the ethical com-
mittee for research ethics (National Medical Research
Center for Hematology of the Ministry of Health of the
Russian Federation, protocol no. 171 of 04/27/2023)).
All studies were conducted in accordance with the
principles of biomedical ethics as outlined in the 1964
Declaration of Helsinki and its later amendments.
Each participant in the study provided a volun-
tary written informed consent after receiving an ex-
planation of the potential risks and benefits, as well as
the nature of the upcoming study.
The authors of this work declare that they have
no conflicts of interest.
PETINATI et al.900
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
REFERENCES
1. Schürch, C.M., Caraccio,C., and Nolte, M.A. (2021) Di-
versity, localization, and (patho)physiology of mature
lymphocyte populations in the bone marrow, Blood,
137, 3015-3026, doi:10.1182/blood.2020007592.
2. Kaushansky,K., and Zhan,H. (2018) The regulation of
normal and neoplastic hematopoiesis is dependent on
microenvironmental cells, Adv. Biol. Regul., 69, 11-15,
doi:10.1016/J.JBIOR.2018.06.003.
3. Beerman,I., Luis, T.C., Singbrant,S., Lo Celso,C., and
Méndez-Ferrer,S. (2017) The evolving view of the he-
matopoietic stem cell niche, Exp. Hematol., 50, 22-26,
doi:10.1016/j.exphem.2017.01.008.
4. Luca, D.C. (2021) Update on lymphoblastic leukemia/
lymphoma, Clin. Lab. Med., 41, 405-416, doi:10.1016/
J.CLL.2021.04.003.
5. Petinati, N. A., Bigildeev, A. E., Karpenko, D. S., Sats,
N.V., Kapranov, N.M., Davydova, Y.O., Fastova, E.A.,
Magomedova, A.U., Kravchenko, S.K., Arapidi, G.P.,
Rusanova, M. I., Lagarkova, M. M., Drize, N. I., and
Savchenko, V.G. (2021) Humoral effect of a B-cell tu-
mor on the bone marrow multipotent mesenchymal
stromal cells, Biochemistry (Moscow), 86, 207-216,
doi:10.1134/S0006297921020097.
6. Zhou, X., Ramachandran, S., Mann, M., and Popkin,
D.L. (2012) Role of lymphocytic choriomeningitis vi-
rus (LCMV) in understanding viral immunology: past,
present and future, Viruses, 4, 2650-2669, doi:10.3390/
v4112650.
7. Schürch, C.M., Riether,C., and Ochsenbein, A.F. (2014)
Cytotoxic CD8
+
T cells stimulate hematopoietic pro-
genitors by promoting cytokine release from bone
marrow mesenchymal stromal cells, Cell Stem Cell,
14, 460-472, doi:10.1016/j.stem.2014.01.002.
8. Demerdash,Y., Kain,B., Essers, M.A.G., and King, K.Y.
(2021) Yin and Yang: the dual effects of interferons on
hematopoiesism, Exp. Hematol., 96, 1-12, doi:10.1016/
j.exphem.2021.02.002.
9. Isringhausen, S., Mun, Y., Kovtonyuk, L., Kräutler,
N. J., Suessbier, U., Gomariz, A., Spaltro,G., Helbling,
P.M., Chyn Wong,H., Nagasawa,T., Manz, M.G., Oxe-
nius,A., and Nombela-Arrieta,C. (2021) Chronic viral
infections persistently alter marrow stroma and im-
pair hematopoietic stem cell fitness, J.Exp. Med., 218,
e20192070, doi:10.1084/jem.20192070.
10. Fallati, A., Di Marzo, N., D’amico, G., and Dander, E.
(2022) Mesenchymal stromal cells (MSCs): an ally of
B-cell acute lymphoblastic leukemia (B-ALL) cells
in disease maintenance and progression within the
bone marrow hematopoietic niche, Cancers, 14, 3303,
doi:10.3390/CANCERS14143303.
11. Kihira,K., Chelakkot, V.S., Kainuma,H., Okumura,Y.,
Tsuboya, N., Okamura, S., Kurihara, K., Iwamoto, S.,
Komada,Y., and Hori,H. (2020) Close interaction with
bone marrow mesenchymal stromal cells induces the
development of cancer stem cell-like immunopheno-
type in B cell precursor acute lymphoblastic leukemia
cells, Int.J. Hematol., 112, 795-806, doi:10.1007/s12185-
020-02981-z.
12. Chiarini, F., Lonetti, A., Evangelisti, C., Buontem-
po, F., Orsini, E., Evangelisti, C., Cappellini, A., Neri,
L.M., McCubrey, J.A., and Martelli, A.M. (2016) Ad-
vances in understanding the acute lymphoblastic
leukemia bone marrow microenvironment: from
biology to therapeutic targeting, Biochim. Bio-
phys. Acta, 1863, 449-463, doi: 10.1016/j.bbamcr.
2015.08.015.
13. Zhi-Gang, Z., Wei-Ming, L., Zhi-Chao, C., Yong, Y.,
and Ping, Z. (2008) Immunosuppressive prop-
erties of mesenchymal stem cells derived from
bone marrow of patient with hematological ma-
lignant diseases, Leuk. Lymphoma, 49, 2187-2195,
doi:10.1080/10428190802455875.
14. Beltran, B. E., Quiñones, P., Morales, D., Malaga,
J.M., Chavez, J.C., Sotomayor, E.M., and Castillo, J.J.
(2018) Response and survival benefit with chemoim-
munotherapy in Epstein-Barr virus-positive diffuse
large B-cell lymphoma, Hematol. Oncol., 36, 93-97,
doi:10.1002/hon.2449.
15. Swerdlow, S. H. (2017) in WHO Classification of Tu-
mours (Swerdlow, S.H., Campo, E., Harris, N.L., Jaffe,
E. S., Pileri, S. A., Stein, H., and Thiele, J., eds) Lyon,
International Agency for Research on Cancer, Lyon,
pp.199-215.
16. Fastova, E.A., Magomedova, A.U., Petinati, N.A., Sats,
N. V., Kapranov, N. M., Davydova, Y. O., Drize, N. I.,
Kravchenko, S. K., and Savchenko, V. G. (2019) Bone
marrow multipotent mesenchymal stromal cells in
patients with diffuse large B-Cell lymphoma, Bull.
Exp. Biol. Med., 167, 150-153, doi: 10.1007/s10517-
019-04480-6.
17. Chen, Q., Yuan, Y., and Chen, T. (2014) Morphology,
differentiation and adhesion molecule expression
changes of bone marrow mesenchymal stem cells
from acute myeloid leukemia patients, Mol. Med. Rep.,
9, 293-298, doi:10.3892/mmr.2013.1789.
18. Shipounova, I.N., Petrova, T.V., Svinareva, D.A., Mo-
motuk, K.S., Mikhailova, E.A., and Drize, N.I. (2009)
Alterations in hematopoietic microenvironment in pa-
tients with aplastic anemia, Clin. Transl. Sci., 2, 67-74,
doi:10.1111/j.1752-8062.2008.00074.x.
19. Kotyza,J. (2017) Chemokines in tumor proximal fluids,
Biomed. Pap. Med. Fac. Univ. Palacky Olomouc. Czech.
Repub., 161, 41-49, doi:10.5507/bp.2016.062.
20. Vilgelm, A. E., and Richmond, A. (2019) Chemokines
modulate immune surveillance in tumorigenesis,
metastasis, and response to immunotherapy, Front.
Immunol., 10, 333, doi:10.3389/fimmu.2019.00333.
21. Mantovani, A., Allavena, P., Sica, A., and Balkwill, F.
(2008) Cancer-related inflammation, Nature, 454,
436-444, doi:10.1038/nature07205.
LYMPHOID NEOPLASIA 901
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
22. Okrój,M., and Potempa,J. (2019) Complement activa-
tion as a helping hand for inflammophilic pathogens
and cancer, Front. Immunol., 9, 3125, doi: 10.3389/
fimmu.2018.03125.
23. Lund, F. E. (2008) Cytokine-producing B lympho-
cytes-key regulators of immunity, Curr. Opin. Immu-
nol., 20, 332-338, doi:10.1016/j.coi.2008.03.003.
24. Munir, H., Ward, L. S. C., and McGettrick, H. M.
(2018) Mesenchymal stem cells as endogenous reg-
ulators of inflammation, Adv. Exp. Med. Biol., 1060,
73-98, doi:10.1007/978-3-319-78127-3_5.
25. Schmittgen, T.D., and Livak, K.J. (2008) Analyzing re-
al-time PCR data by the comparative CT method, Nat.
Protocols, 3, 1101-1108, doi:10.1038/nprot.2008.73.
26. Kumar, L. P., Kandoi, S., Misra, R., and Verma, R. S.
(2019) The mesenchymal stem cell secretome: a new
paradigm towards cell-free therapeutic mode in re-
generative medicine, Cytokine Growth Factor Rev.,
46, 1-9, doi:10.1016/j.cytogfr.2019.04.002.
27. Dominici, M., Le Blanc, K., Mueller, I., Slaper-Corten-
bach, I., Marini, F., Krause,D., Deans,R., Keating,A.,
Prockop, D., and Horwitz, E. (2006) Minimal crite-
ria for defining multipotent mesenchymal stromal
cells. The international society for cellular ther-
apy position statement, Cytotherapy, 8, 315-317,
doi:10.1080/14653240600855905.
28. Vanegas, N.-D. P., Ruiz-Aparicio, P. F., Uribe, G. I., Li-
nares-Ballesteros, A., and Vernot, J.-P. (2021) Leu-
kemia-Induced cellular senescence and stemness
alterations in mesenchymal stem cells are revers-
ible upon withdrawal of B-cell acute lymphoblastic
leukemia cells, Int.J. Mol. Sci., 22, 8166, doi:10.3390/
ijms22158166.
29. Schroeder, T., Geyh, S., Germing, U., and Haas, R.
(2016) Mesenchymal stromal cells in myeloid malig-
nancies, Blood Res., 51, 225-232, doi:10.5045/br.2016.
51.4.225.
30. Passaro, D., Di Tullio, A., Abarrategi, A., Rouault-
Pierre, K., Foster, K., Ariza-McNaughton, L., Montan-
er,B., Chakravarty,P., Bhaw,L., Diana,G., Lassailly,F.,
Gribben,J., and Bonnet,D. (2017) Increased vascular
permeability in the bone marrow microenvironment
contributes to disease progression and drug response
in acute myeloid leukemia, Cancer Cell, 32, 324-341.
e6, doi:10.1016/J.CCELL.2017.08.001.
31. Shipounova, I. N., Petinati, N. A., Bigildeev, A. E.,
Drize, N.J., Sorokina, T.V., Kuzmina, L.A., Parovich-
nikova, E.N., and Savchenko, V.G. (2017) Alterations
of the bone marrow stromal microenvironment
in adult patients with acute myeloid and lympho-
blastic leukemias before and after allogeneic he-
matopoietic stem cell transplantation, Leuk. Lym-
phoma, 58, 408-417, doi: 10.1080/10428194.2016.
1187277.
32. Ludin, A., Gur-Cohen, S., Golan, K., Kaufmann, K. B.,
Itkin,T., Medaglia,C., Lu, X.-J., Ledergor,G., Kollet,O.,
and Lapidot, T. (2014) Reactive oxygen species regu-
late hematopoietic stem cell self-renewal, migration
and development, as well as their bone marrow mi-
croenvironment, Antioxid. Redox Signal., 21, 1605-
1619, doi:10.1089/ars.2014.5941.
33. Récher,C. (2021) Clinical implications of inflammation
in acute myeloid leukemia, Front. Oncol., 11, 623952,
doi:10.3389/fonc.2021.623952.
34. Beavis, P. A., Stagg, J., Darcy, P. K., and Smyth, M. J.
(2012) CD73: a potent suppressor of antitumor im-
mune responses, Trends Immunol., 33, 231-237,
doi:10.1016/j.it.2012.02.009.
35. Jin,D., Fan,J., Wang,L., Thompson, L.F., Liu,A., Dan-
iel, B.J., Shin,T., Curiel, T.J., and Zhang,B. (2010) CD73
on tumor cells impairs antitumor T-cell responses:
a novel mechanism of tumor-induced immune sup-
pression, Cancer Res., 70, 2245-2255, doi: 10.1158/
0008-5472.CAN-09-3109.
36. Petruk, N., Tuominen, S., Åkerfelt, M., Mattsson, J.,
Sandholm, J., Nees, M., Yegutkin, G. G., Jukkola, A.,
Tuomela, J., and Selander, K. S. (2021) CD73 Facili-
tates EMT Progression and Promotes Lung Metastases
in Triple-Negative Breast Cancer, Sci. Rep., 11, 6035,
doi:10.1038/S41598-021-85379-Z.
37. Bui, T. M., Wiesolek, H. L., and Sumagin, R. (2020)
ICAM-1: a master regulator of cellular respons-
es in inflammation, injury resolution, and tumori-
genesis, J. Leukoc. Biol., 108, 787-799, doi: 10.1002/
JLB.2MR0220-549R.
38. Ren, G., Zhao, X., Zhang, L., Zhang, J., L’Huillier, A.,
Ling,W., Roberts, A.I., Le, A.D., Shi,S., Shao,C., and
Shi, Y. (2010) Inflammatory cytokine-induced inter-
cellular adhesion molecule-1 and vascular cell adhe-
sion molecule-1 in mesenchymal stem cells are critical
for immunosuppression, J.Immunol., 184, 2321-2328,
doi:10.4049/jimmunol.0902023.
39. Russell, K.C., Phinney, D.G., Lacey, M.R., Barrilleaux,
B. L., Meyertholen, K. E., and O’Connor, K. C. (2010)
In vitro high-capacity assay to quantify the clonal
heterogeneity in trilineage potential of mesenchy-
mal stem cells reveals a complex hierarchy of lineage
commitment, Stem Cells, 28, 788-798, doi: 10.1002/
stem.312.
40. Schirrmacher,V. (2019) From chemotherapy to biolog-
ical therapy: a review of novel concepts to reduce the
side effects of systemic cancer treatment, Int.J. Oncol.,
54, 407-419, doi:10.3892/ijo.2018.4661.
41. Borges,L., Oliveira, V.K.P., Baik,J., Bendall, S.C., and
Perlingeiro, R. C. R. (2019) Serial transplantation re-
veals a critical role for endoglin in hematopoietic
stem cell quiescence, Blood, 133, 688-696, doi:10.1182/
blood-2018-09-874677.
42. Portale,F., Cricrì,G., Bresolin,S., Lupi,M., Gaspari,S.,
Silvestri,D., Russo,B., Marino,N., Ubezio,P., Pagni,F.,
Vergani, P., Te Kronnie, G., Valsecchi, M. G., Locatel-
li,F., Rizzari,C., Biondi,A., Dander,E., and D’Amico,G.
PETINATI et al.902
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
(2019) ActivinA: a new leukemia-promoting fac-
tor conferring migratory advantage to B-cell pre-
cursor-acute lymphoblastic leukemic cells, Hae-
matologica, 104, 533-545, doi: 10.3324/haematol.
2018.188664.
43. Balandrán, J.C., Purizaca,J., Enciso,J., Dozal,D., San-
doval,A., Jiménez-Hernández,E., Alemán-Lazarini,L.,
Perez-Koldenkova, V., Quintela-Núñez del Prado, H.,
Rios de los Ríos, J., Mayani, H., Ortiz-Navarrete, V.,
Guzman, M. L., and Pelayo, R. (2017) Pro-inflamma-
tory-related loss of CXCL12 niche promotes acute
lymphoblastic leukemic progression at the expense
of normal lymphopoiesis, Front. Immunol., 7, 666,
doi:10.3389/fimmu.2016.00666.
44. Desbourdes, L., Javary, J., Charbonnier, T., Ishac, N.,
Bourgeais, J., Iltis, A., Chomel, J.-C., Turhan, A., Guil-
loton, F., Tarte, K., Demattei, M.-V., Ducrocq, E., Rou-
leux-Bonnin, F., Gyan, E., Hérault, O., and Dome-
nech, J. (2017) Alteration analysis of bone marrow
mesenchymal stromal cells from de novo acute my-
eloid leukemia patients at diagnosis, Stem. Cells Dev.,
26, 709-722, doi:10.1089/scd.2016.0295.
45. Chandran, P., Le, Y., Li, Y., Sabloff, M., Mehic, J., Ro-
su-Myles, M., and Allan, D. S. (2015) Mesenchymal
stromal cells from patients with acute myeloid leu-
kemia have altered capacity to expand differentiated
hematopoietic progenitors, Leuk. Res., 39, 486-493,
doi:10.1016/j.leukres.2015.01.013.
46. Kim, J.-A., Shim, J.-S., Lee, G.-Y., Yim, H. W., Kim, T.-
M., Kim, M., Leem, S.-H., Lee, J.-W., Min, C.-K., and
Oh, I.-H. (2015) Microenvironmental remodeling as
a parameter and prognostic factor of heterogeneous
leukemogenesis in acute myelogenous leukemia,
Cancer Res., 75, 2222-2231, doi: 10.1158/0008-5472.
CAN-14-3379.
47. Van den Berk, L.C.J., van der Veer,A., Willemse, M.E.,
Theeuwes, M.J. G. A., Luijendijk, M. W., Tong, W.H.,
van der Sluis, I. M., Pieters, R., and den Boer, M. L.
(2013) Disturbed CXCR4/CXCL12 axis in pediatric pre-
cursor B-cell acute lymphoblastic leukemia, Blood,
122, 2643, doi:10.1182/blood.V122.21.2643.2643.
48. El-Obeid,A., Sunnuqrut,N., Hussain,A., Al-Hussein,K.,
Gutiérrez, M.I., and Bhatia,K. (2004) Immature B cell
malignancies synthesize VEGF, VEGFR-1 (Flt-1) and
VEGFR-2 (KDR), Leuk. Res., 28, 133-137, doi: 10.1016/
S0145-2126(03)00188-7.
49. Mizia-Malarz,A., and Sobol-Milejska,G. (2017) Assess-
ment of angiogenesis in children with acute lympho-
blastic leukemia based on serum vascular endotheli-
al growth factor assay, Indian J. Med. Paediatr. Oncol.,
38, 321-325, doi:10.4103/IJMPO.IJMPO_109_17.
50. Azadniv, M., Myers, J. R., McMurray, H. R., Guo, N.,
Rock, P., Coppage, M. L., Ashton, J., Becker, M. W.,
Calvi, L. M., and Liesveld, J. L. (2020) Bone marrow
mesenchymal stromal cells from acute myelogenous
leukemia patients demonstrate adipogenic differenti-
ation propensity with Implications for leukemia cell
support, Leukemia, 34, 391-403, doi: 10.1038/s41375-
019-0568-8.
51. Ren, K. (2019) Exosomes in perspective: a poten-
tial surrogate for stem cell therapy, Odontology, 107,
271-284, doi:10.1007/s10266-018-0395-9.
52. Morales-Hernández, A., and McKinney-Freeman, S.
(2021) GABA gets blood on its hands, Blood, 137, 723-
724, doi:10.1182/blood.2020008772.
53. Luque, A., Carpizo, D. R., and Iruela-Arispe, M. L.
(2003) ADAMTS1/METH1 inhibits endothelial cell
proliferation by direct binding and sequestration of
VEGF165, J.Biol. Chem., 278, 23656-23665, doi:10.1074/
JBC.M212964200.
54. Hall-Glenn,F., and Lyons, K.M. (2011) Roles for CCN2
in normal physiological processes,
Cell. Mol. Life Sci.,
68, 3209-3217, doi:10.1007/s00018-011-0782-7.
55. Nemunaitis, J. (1993) Macrophage function activat-
ing cytokines: potential clinical application, Crit. Rev.
Oncol. Hematol., 14, 153-171, doi: 10.1016/1040-8428
(93)90022-V.
56. Liso,A., Venuto,S., Coda, A.R.D., Giallongo,C., Palum-
bo, G.A., and Tibullo,D. (2022) IGFBP-6: at the cross-
roads of immunity, tissue repair and fibrosis, Int. J.
Mol. Sci., 23, 4358, doi:10.3390/ijms23084358.
57. Gandhi, M. K., Moll, G., Smith, C., Dua, U., Lamb-
ley, E., Ramuz, O., Gill,D., Marlton,P., Seymour, J.F.,
and Khanna, R. (2007) Galectin-1 mediated suppres-
sion of Epstein-Barr virus specific T-cell immunity
in classic hodgkin lymphoma, Blood, 110, 1326-1329,
doi:10.1182/blood-2007-01-066100.
58. Zhu,X., Miao,X., Wu,Y., Li,C., Guo,Y., Liu,Y., Chen,Y.,
Lu, X., Wang, Y., and He, S. (2015) ENO1 promotes
tumor proliferation and cell adhesion mediated
drug resistance (CAM-DR) in non-Hodgkin’s lym-
phomas, Exp. Cell Res., 335, 216-223, doi: 10.1016/
J.YEXCR.2015.05.020.
59. Perretti,M., and D’Acquisto,F. (2009) Annexin A1 and
glucocorticoids as effectors of the resolution of in-
flammation, Nat. Rev. Immunol., 9, 62-70, doi:10.1038/
nri2470.
60. Kiani,C., Chen,L., Wu, Y.J., Yee, A.J., and Yang, B.B.
(2002) Structure and function of aggrecan, Cell Res.,
12, 19-32, doi:10.1038/sj.cr.7290106.
61. Sengprasert,P., Leearamwat,N., Ngarmukos,S., Yuk-
tananda,P., Tanavalee,A., and Reantragoon,R. (2022)
Upregulation of antigen presentation function and
inflammation in chondrocytes by induction of pro-
teoglycan aggrecan peptides (P16-31 and P263-280),
Clin. Exp. Rheumatol., 40, 596-607, doi: 10.55563/
clinexprheumatol/hjzqfs.
62. Monteith, A. J., Miller, J. M., Maxwell, C. N., Chazin,
W. J., and Skaar, E. P. (2021) Neutrophil extracellu-
lar traps enhance macrophage killing of bacterial
pathogens, Sci. Adv., 7, eabj2101, doi: 10.1126/sciadv.
abj2101.
LYMPHOID NEOPLASIA 903
BIOCHEMISTRY (Moscow) Vol. 89 No. 5 2024
63. Su, C.-T., and Urban,Z. (2021) LTBP4 in health and dis-
ease, Genes, 12, 795, doi:10.3390/genes12060795.
64. Xavier,S., Sahu, R.K., Landes, S.G., Yu,J., Taylor, R.P.,
Ayyadevara,S., Megyesi,J., Stallcup, W.B., Duffield, J.S.,
Reis, E.S., Lambris, J.D., and Portilla,D. (2017) Pericytes
and immune cells contribute to complement activation
in tubulointerstitial fibrosis, Am.J. Physiol. Renal. Physi-
ol., 312, F516-F532, doi:10.1152/ajprenal.00604.2016.
65. Morra, L., and Moch, H. (2011) Periostin Expression
and epithelial-mesenchymal transition in cancer:
areview and an update, Virchows Arch., 459, 465-475,
doi:10.1007/s00428-011-1151-5.
66. Ding, L., and Morrison, S. J. (2013) Haematopoietic
stem cells and early lymphoid progenitors occupy
distinct bone marrow niches, Nature, 495, 231-235,
doi:10.1038/nature11885.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in pub-
lished maps and institutional affiliations.